- Email: [email protected]
Molecular typing of echovirus serotype 4 isolates
Virus Research 80 (2001) 87 – 92 www.elsevier.com/locate/virusres
Short communication
Molecular typing of echovirus serotype 4 isolates U. Ku¨nkel, S. Diedrich, E. Schreier * Robert Koch-Institut, Berlin, Nordufer 20, D-13353 Berlin, Germany Received 12 September 2000; received in revised form 26 April 2001; accepted 26 April 2001
Abstract We report on clinical samples Stuttgart/97, Berlin/99 and Jasi/99 associated with aseptic meningitis. All three samples contained echovirus 4 (E4) but Stuttgart/97 was simultaneous infected with echovirus 30 (E30). The genetic relationship of the E4 strains was assessed using RT-PCR and direct sequencing of amplicons derived from the genomic region encoding the capsid protein VP1. The sequences have been compared with each other and with sequences of further E4 strains obtained from GenBank. The analysis confirms that sequences of recent isolates have drifted away from elderly strains over a longer period of time. Several amino acid changes in assumed antigenic sites of the VP1 gene may be sufficient to cause changes in antigenic specificity and therefore they may be a reason for failure of serological typing of some new antigenic E4 variants. © 2001 Elsevier Science B.V. All rights reserved. Keywords: Echovirus 4; RT-PCR; Sequencing; Capsid protein VP1; Phylogenetic analysis; Molecular typing
Enteroviruses (family Picorna6iridae) are RNA viruses comprising polioviruses, coxsackieviruses A and B, echoviruses, and the numbered enteroviruses 68–71. In this large group of human pathogens the non-polio enteroviruses cause a wide varity of clinical manifestations ranging from mild gastroenteritis and respiratory illnesses to severe meningitis, encephalitis, or myocarditis. Routine loboratory diagnosis of enteroviruses is cell culture isolation, followed by serotype identification using neutralisation assay. * Corresponding author. Tel.: + 49-1888-7542379; fax: + 49-1888-7542617. E-mail address: [email protected] (E. Schreier).
The most variable regions of the enterovirus genome are within the genes coding for the capsid proteins VP1, VP2, and VP3 which are at least partially exposed on the virus surface. Especially VP1 codes for the major antigenic sites and most type-specific neutralisation determinants. Therefore, this genome region was supposed to be most suitable for discriminating between enteroviruses based on partial sequence analysis and to be useful for identification and molecular epidemiology of enteroviruses (Muir et al., 1998). During the search for genetic variability within the VP1 coding region of echovirus 4 (E4) clinical samples taken at the beginning of aseptic meningitis have been studied. Samples Stuttgart/97 and
0168-1702/01/$ - see front matter © 2001 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 1 ) 0 0 2 9 0 - 8
U. Ku¨nkel et al. / Virus Research 80 (2001) 87–92
88
Berlin/99 circulating in Germany in 1997 and 1999, respectively, and an isolate from Jasi of an outbreak of aseptic meningitis in Romania in 1999 were investigated. Viruses have been isolated from stool and/or cerebrospinal fluid specimens by conventional cell culture methods as described previously (Diedrich et al., 1995). Cultures with an enterovirus cytopathic effect (CPE) were typed by a microneutralisation assay using WHO poolsera as well as monospecific in-house rabbit antiserum. Thus, the E4 was determined for the Romanian isolates and Berlin/99 and the phylogenetic analysis of their sequences of the VP1 gene resulted in an assignment as expected. However, for sample Stuttgart/ 97 there was a discrepancy between results of serological typing and sequence analysis of the VP1 gene. Whereas by serological typing only E30 was determined, the sequence analysis yielded both E30 and E4 sequences depending on the primers used. The successful used primer system for recent E30 strains in Germany (Ku¨ nkel and Schreier, 2000) yielded the expected second round amplicon in Stuttgart/97 RNA. The sequence (GenBank AF240363) was related to E30 strains cocirculating in 1997 (Ku¨ nkel and Schreier, 2000). For molecular identification and analysis of E4 isolates E4 sequences available from database GenBank were reviewed. Primers choosen for RTPCR and sequencing are given in Table 1.
The RNA of the virus-infected samples was extracted from 140 ml of the supernatant of infected cell cultures by a spin column technique using the QIAamp viral RNA kit according to manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). cDNA synthesis was performed with suitable primers and MMLV reverse transcriptase at 42°C for 1 h as reported previously (Diedrich et al., 1995; Ku¨ nkel and Schreier, 1999). The amplification was carried out in 35 cycles consisting of 30 s at 94°C, 30 s at 42°C, and 45 s at 72°C. Both strands of the nested PCR products were sequenced directly, using a dye terminator cycle sequencing kit (Perkin Elmer) and ABI Prism 377 DNA sequencer (Applied Biosystems). E4 sequence data determined for Stuttgart/97, Berlin/99, and Jasi/99 are available in GenBank database at accession numbers AF132497, AF233373 and AF222977, respectively. For the analysis of molecular characteristics of the E4 strains sequence data encoding the entire capsid protein VP1, nucleotide position 2201– 3043 (843 nucleotides resp. 281 deduced amino acids), had been used. Position numbering has been chosen with regard to the echovirus 4 sequence Stuttgart/97 (E4/Stuttgart/97) genomic RNA. Pairwise comparison of nucleotide and deduced amino acid sequences of the entire VP1 gene of E4/Stuttgart/97, E4/Jasi/99, and E4/
Table 1 Primers used in RT-PCR and/or sequencing of echovirus 4 samples Primer
Genomic locationa (5%–3%)
Sequenceb (5%–3%)
Designed from
Sense primer EC15 EC12 EC3 EC21
1406–1426 2161–2179 2327–2349 2779–2799
GCCTCAAGTTATGTGCCCATA GCGTGACACCAAATTTATC GTGCCCAGTGACACTATGCARAC TAGCTTTTATGATGGATGGTC
VP2 VP3 VP1 VP1
Antisense primer EC16 EC20 EC2 EC22 EC24
2425–2406 2806–2786 2937–2915 3189–3170 3219–3200
ATATACGCACGCTGCCCGAG GAAGTTTGACCATCCATCATA CTGATGTGCTTAGGCTTGAAGTA TCTCTGTTGTAGTCCTCCCA CCGTGGGCTGTGGTGGTGCT
VP1 VP1 VP1 2A 2A
a b
Positions refer to E4/Stuttgart/97 (GenBank AF132497). R= A or G (IUB Code for degenerated bases).
U. Ku¨ nkel et al. / Virus Research 80 (2001) 87–92
89
Fig. 1. Alignment of 281 amino acids from the VP1 gene of E4 strains. Dots indicate identity with E4/Stuttgart/97. Antigenic sites deduced by similarity with other enteroviruses are shown boxed. Amino acids corresponding to residues located on the external virion surface of the three-dimensional model of coxsackievirus A9 (Hendry et al., 1999) are shown in bold.
U. Ku¨ nkel et al. / Virus Research 80 (2001) 87–92
90
Table 2 Nucleotide and deduced amino acid identities of pairwise alignments of echoviruses E4/Berlin/99, E4/Jasi/99, E4/Stuttgart/97, and E4 strains Pesacek, DuToit, and Shropshire for comparison at the 843 nucleotide comprehended VP1 gene (Oberste et al., 1999a) Virus strain
E4/Berlin/99 (%)
E4/Jasi/99 (%)
E4/Stuttgart/97 (%)
E4/Berlin/99 E4/Jasi/99 E4/Stuttgart/97 E4/Shropshire E4/DuToit E4/Pesacek
97 91 82 78 77
Amino acid identity 99 98 98 91 83 83 73 80 76 79 Nucleotide identity
Berlin/99, as well as elderly prototype strains Pesacek/51, Shropshire/56, and DuToit/57 (Barron and Karzon, 1961) showed sequence identities of 73 – 97% at the nucleotide level and 92– 99% at the amino acid level (Table 2). The genetic relationships between E4 strains were investigated by phylogenetic analysis based on an alignment of deduced VP1 amino acid sequences using programs Protdist (determination of evolutionary distances) and Neighbor (construction of an unrooted phylogenetic tree) included in the Phylogeny Interference Package (Phylip) version 3.57c (Felsenstein, 1997). The tree was drawn using the program Treeview (Page, 1996). The analysis of 100 bootstrap resamples of the alignment data sets was performed using the Seqboot and Consense programs of Phylip. The alignment of deduced amino acid sequences of VP1 genes of several E4 viruses is given in Fig. 1. The unrooted phylogenetic tree (Fig. 2) derived from deduced amino acid sequences of the VP1 gene of the viruses shows that E4/Stuttgart/97, E4/Berlin/99, and E4/Jasi/99, are clustered phylogenetically together with some genetic distance to the prototype strain E4/Pesacek/51. All facts mentioned demonstrated that the serologically untypeable E4-component of Stuttgart/97 fully corresponds to other E4 sequences. Recently, it has been demonstrated that enterovirus VP1 sequences correlate well with the serotype (Oberste et al., 1999a,b, 2000). Therefore, the serotype of a virologically unclassified enterovirus may be derived simply from the com-
E4/Shropshire/56 E4/DuToit/57 (%) (%)
E4/Pesacek/51 (%)
97 96 95 81 81
96 96 95 95 94 -
93 93 92 93 83
parison of its VP1 sequence with known VP1 sequences. Using this molecular typing technique the criteria for identification of strains with homologous serotypes are at least 75% nucleotide or 88% amino acid identities in the VP1 genomic
Fig. 2. Phylogenetic tree based on deduced amino acid sequences from VP1 caspid proteins showing genetic relationships between recent echovirus 4 strains Stuttgart/97, Jasi/99, Berlin/99 and other GenBank deposited echovirus 4 strains. The confidence value of the nodes were calculated by performing 100 bootstrap analyses and indicated in percent at the branches. The line on the left hand bottom represents a scale for the tree in terms of proportion of amino acids substituted per site [s/s] indicating the genetic distance between the strains. The phylogram was generated by using programs of the phlogeny interference package (PHYLIP) ver. 3.57c (Felsenstein, 1997.
U. Ku¨ nkel et al. / Virus Research 80 (2001) 87–92
region. These criteria are fulfilled for E4 component of Stuttgart/97 (Table 2). The peculiarity of the sample Stuttgart/97 was the simultaneous infection with E30 and E4. As recently reported for a variant of echovirus 4 (Handsher et al., 1999) the WHO serum pools did not neutralize the isolates while the LBM pools identified only few isolates as E4 due to the fact that used pools were raised against strains isolated more than 40 years ago. A genetic drift of recent strains from the prototype strains has been observed for other enteroviruses. (Nairn and Clements, 1999; Ku¨ nkel and Schreier, 1999, 2000). However, mainly the site and less the quantity of mutations in the capsid genes alters antigenicity of picornaviruses and thus the neutralization properties. Clinical sample Stuttgart/97 was resistant to serologically E4 typing possibly because of definite antigenic variation of the capsid protein. The external capsid proteins VP1, VP2, and VP3 of picornaviruses share an eight-stranded antiparallel b-barrel structure formed of b-strands connected by surface-exposed loops. As reviewed by Mateu (1995) an escape of picornaviruses from neutralisation by monoclonal antibodies is mediated by substitutions of very few, defined amino acid residues of the capsid protein, generally located in antigeneic sites mainly in the loops and exposed on the capsid surface. Structural analysis of coxsackievirus B3 (Muckelbauer et al., 1995) and coxsackievirus A9 (Hendry et al., 1999) (phylogenetically clustered with echoviruses) defined the loops of the capsid protein VP1. Since a high degree of sequence identity and similarity of structure exists between enteroviruses based on molecular and biological properties (Hyypia¨ et al., 1997), is it supposed that homologous loops in echovirus 4 also form antigenic sites. Amino acids corresponding to residues located on the external virion surface of the coxsackievirus A9 are shown in bold in the E4/Stuttgart/97 sequence (Fig. 1). Distinct amino acid variations in most of the presumed antigenic sites in particular in the predicted B– C and G– H loops of VP1 in E4/Stuttgart/97 were not found in other E4 strains. These variations could be sufficient to cause changes in the antigenic specificity of the E4 component of sample Stuttgart/97.
91
Altogether, it could be confirmed that RT-PCR combined with amplicon sequencing is a very useful tool for virus typing, especially when serological typing had failed to identify virus infected samples.
Acknowledgements Technical assistance of Heidrun Linke, Ursula Piede, and Heidrun Roeske and the assistance in copy-editing of Claudia Go¨ tte are gratefully acknowledged. Moreover we wish to thank Professor Dr Andrei Aubert-Combiescu, Director of the National Reference Center for Enteroviruses, Cantacuzino Institute, Bucarest, for providing E4 isolate Jasi/99, and Professor Dr Gisela Enders, Medical Laboratory and Institute of Virology, Infectious Diseases and Epidemiology, Stuttgart, for providing isolate Stuttgart/97.
References Barron, A.L., Karzon, D.T., 1961. Characteristics of echo 4 (Shropshire) virus isolated during epidemic of aseptic meningitis. J. Immunol. 87, 608 – 615. Diedrich, S., Driesel, G., Schreier, E., 1995. Sequence comparison of echovirus type 30 isolates to other enteroviruses in the 5% noncoding region. J. Med. Virol. 46, 148 – 152. Felsenstein, J., 1997. Phylip (phylogeny inference package) version 3.57c. Department of Genetics, University of Washington, Seattle. Distributed by author. Handsher, R., Shulman, L.M., Abramovitz, B., Silberstein, I., Neuman, M., Tepperberg-Oikawa, M., Fisher, T., Mendelson, E., 1999. A new variant of echovirus 4 associated with a large outbreak of aseptic meningitis. J. Clin. Virol. 13, 29 – 36. Hendry, E., Hatanaka, H., Fry, E., Smyth, E., Smyth, M., Tate, J., Stanway, G., Satti, J., Maaronen, M., Hyypia¨ , T., Stuart, D., 1999. The crystal structure of coxsackievirus A9: new insights into the uncoating mechanisms of enteroviruses. Structure 7, 1527 – 1538. Hyypia¨ , T., Hovi, T., Knowles, N.J., Stanway, G., 1997. Classification of enteroviruses based on molecular and biological properties. J. Gen. Virol. 78, 1 – 11. Ku¨ nkel, U., Schreier, E., 1999. Characterization of echovirus 25 (ECV 25) in the VP1/2A gene junction region. Arch. Virol. 144, 2253 – 2258. Ku¨ nkel, U., Schreier, E., 2000. Genetic variability within the VP1 coding region of echovirus type 30 isolates. Arch. Virol. 145, 1455 – 1464.
92
U. Ku¨ nkel et al. / Virus Research 80 (2001) 87–92
Mateu, M.G., 1995. Antibody recognition of picornaviruses and escape from neutralization: a structural view. Virus Res. 38, 1 – 24. Muckelbauer, J.K., Kremer, M., Minor, I., Diana, G., Dutko, F.J., Groarke, J., Pevear, D.C., Rossmann, M.G., 1995. The structure of coxsackievirus B3 at 3.5 A, resolution. Structure 3, 653 –667. Muir, P., Ka¨ mmerer, U., Korn, K., Mulders, M.N., Po¨ yry, T., Weissbrich, B., Kandolf, R., Cleator, G.M., van Loon, A.M., 1998. Molecular typing of enteroviruses: current status and future requirements. Clin. Microbiol. Rev. 11, 202– 227. Nairn, C., Clements, G.B., 1999. A study of enterovirus isolations in Glasgow from 1977 to 1997. J. Med. Virol. 58, 304– 312.
Oberste, M.S., Maher, K., Kilpatrick, D.R., Pallansch, M.A., 1999a. Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classification. J. Virol. 73, 1941 – 1948. Oberste, M.S., Maher, K., Kilpatrick, D.R., Flemister, M.R., Brown, B.A., Pallansch, M.A., 1999b. Typing of human enteroviruses by partial sequencing of VP1. J. Clin. Microbiol. 37, 1288 – 1293. Oberste, M.S., Maher, K., Flemister, M.R., Marchetti, G., Kilpatrick, D.R., Pallansch, M.A., 2000. Comparison of classic and molecular approaches for the identifikation of untypeable enteroviruses. J. Clin. Microbiol. 38, 1170 – 1174. Page, R.D., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357 – 358.
Short communication
Molecular typing of echovirus serotype 4 isolates U. Ku¨nkel, S. Diedrich, E. Schreier * Robert Koch-Institut, Berlin, Nordufer 20, D-13353 Berlin, Germany Received 12 September 2000; received in revised form 26 April 2001; accepted 26 April 2001
Abstract We report on clinical samples Stuttgart/97, Berlin/99 and Jasi/99 associated with aseptic meningitis. All three samples contained echovirus 4 (E4) but Stuttgart/97 was simultaneous infected with echovirus 30 (E30). The genetic relationship of the E4 strains was assessed using RT-PCR and direct sequencing of amplicons derived from the genomic region encoding the capsid protein VP1. The sequences have been compared with each other and with sequences of further E4 strains obtained from GenBank. The analysis confirms that sequences of recent isolates have drifted away from elderly strains over a longer period of time. Several amino acid changes in assumed antigenic sites of the VP1 gene may be sufficient to cause changes in antigenic specificity and therefore they may be a reason for failure of serological typing of some new antigenic E4 variants. © 2001 Elsevier Science B.V. All rights reserved. Keywords: Echovirus 4; RT-PCR; Sequencing; Capsid protein VP1; Phylogenetic analysis; Molecular typing
Enteroviruses (family Picorna6iridae) are RNA viruses comprising polioviruses, coxsackieviruses A and B, echoviruses, and the numbered enteroviruses 68–71. In this large group of human pathogens the non-polio enteroviruses cause a wide varity of clinical manifestations ranging from mild gastroenteritis and respiratory illnesses to severe meningitis, encephalitis, or myocarditis. Routine loboratory diagnosis of enteroviruses is cell culture isolation, followed by serotype identification using neutralisation assay. * Corresponding author. Tel.: + 49-1888-7542379; fax: + 49-1888-7542617. E-mail address: [email protected] (E. Schreier).
The most variable regions of the enterovirus genome are within the genes coding for the capsid proteins VP1, VP2, and VP3 which are at least partially exposed on the virus surface. Especially VP1 codes for the major antigenic sites and most type-specific neutralisation determinants. Therefore, this genome region was supposed to be most suitable for discriminating between enteroviruses based on partial sequence analysis and to be useful for identification and molecular epidemiology of enteroviruses (Muir et al., 1998). During the search for genetic variability within the VP1 coding region of echovirus 4 (E4) clinical samples taken at the beginning of aseptic meningitis have been studied. Samples Stuttgart/97 and
0168-1702/01/$ - see front matter © 2001 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 1 ) 0 0 2 9 0 - 8
U. Ku¨nkel et al. / Virus Research 80 (2001) 87–92
88
Berlin/99 circulating in Germany in 1997 and 1999, respectively, and an isolate from Jasi of an outbreak of aseptic meningitis in Romania in 1999 were investigated. Viruses have been isolated from stool and/or cerebrospinal fluid specimens by conventional cell culture methods as described previously (Diedrich et al., 1995). Cultures with an enterovirus cytopathic effect (CPE) were typed by a microneutralisation assay using WHO poolsera as well as monospecific in-house rabbit antiserum. Thus, the E4 was determined for the Romanian isolates and Berlin/99 and the phylogenetic analysis of their sequences of the VP1 gene resulted in an assignment as expected. However, for sample Stuttgart/ 97 there was a discrepancy between results of serological typing and sequence analysis of the VP1 gene. Whereas by serological typing only E30 was determined, the sequence analysis yielded both E30 and E4 sequences depending on the primers used. The successful used primer system for recent E30 strains in Germany (Ku¨ nkel and Schreier, 2000) yielded the expected second round amplicon in Stuttgart/97 RNA. The sequence (GenBank AF240363) was related to E30 strains cocirculating in 1997 (Ku¨ nkel and Schreier, 2000). For molecular identification and analysis of E4 isolates E4 sequences available from database GenBank were reviewed. Primers choosen for RTPCR and sequencing are given in Table 1.
The RNA of the virus-infected samples was extracted from 140 ml of the supernatant of infected cell cultures by a spin column technique using the QIAamp viral RNA kit according to manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). cDNA synthesis was performed with suitable primers and MMLV reverse transcriptase at 42°C for 1 h as reported previously (Diedrich et al., 1995; Ku¨ nkel and Schreier, 1999). The amplification was carried out in 35 cycles consisting of 30 s at 94°C, 30 s at 42°C, and 45 s at 72°C. Both strands of the nested PCR products were sequenced directly, using a dye terminator cycle sequencing kit (Perkin Elmer) and ABI Prism 377 DNA sequencer (Applied Biosystems). E4 sequence data determined for Stuttgart/97, Berlin/99, and Jasi/99 are available in GenBank database at accession numbers AF132497, AF233373 and AF222977, respectively. For the analysis of molecular characteristics of the E4 strains sequence data encoding the entire capsid protein VP1, nucleotide position 2201– 3043 (843 nucleotides resp. 281 deduced amino acids), had been used. Position numbering has been chosen with regard to the echovirus 4 sequence Stuttgart/97 (E4/Stuttgart/97) genomic RNA. Pairwise comparison of nucleotide and deduced amino acid sequences of the entire VP1 gene of E4/Stuttgart/97, E4/Jasi/99, and E4/
Table 1 Primers used in RT-PCR and/or sequencing of echovirus 4 samples Primer
Genomic locationa (5%–3%)
Sequenceb (5%–3%)
Designed from
Sense primer EC15 EC12 EC3 EC21
1406–1426 2161–2179 2327–2349 2779–2799
GCCTCAAGTTATGTGCCCATA GCGTGACACCAAATTTATC GTGCCCAGTGACACTATGCARAC TAGCTTTTATGATGGATGGTC
VP2 VP3 VP1 VP1
Antisense primer EC16 EC20 EC2 EC22 EC24
2425–2406 2806–2786 2937–2915 3189–3170 3219–3200
ATATACGCACGCTGCCCGAG GAAGTTTGACCATCCATCATA CTGATGTGCTTAGGCTTGAAGTA TCTCTGTTGTAGTCCTCCCA CCGTGGGCTGTGGTGGTGCT
VP1 VP1 VP1 2A 2A
a b
Positions refer to E4/Stuttgart/97 (GenBank AF132497). R= A or G (IUB Code for degenerated bases).
U. Ku¨ nkel et al. / Virus Research 80 (2001) 87–92
89
Fig. 1. Alignment of 281 amino acids from the VP1 gene of E4 strains. Dots indicate identity with E4/Stuttgart/97. Antigenic sites deduced by similarity with other enteroviruses are shown boxed. Amino acids corresponding to residues located on the external virion surface of the three-dimensional model of coxsackievirus A9 (Hendry et al., 1999) are shown in bold.
U. Ku¨ nkel et al. / Virus Research 80 (2001) 87–92
90
Table 2 Nucleotide and deduced amino acid identities of pairwise alignments of echoviruses E4/Berlin/99, E4/Jasi/99, E4/Stuttgart/97, and E4 strains Pesacek, DuToit, and Shropshire for comparison at the 843 nucleotide comprehended VP1 gene (Oberste et al., 1999a) Virus strain
E4/Berlin/99 (%)
E4/Jasi/99 (%)
E4/Stuttgart/97 (%)
E4/Berlin/99 E4/Jasi/99 E4/Stuttgart/97 E4/Shropshire E4/DuToit E4/Pesacek
97 91 82 78 77
Amino acid identity 99 98 98 91 83 83 73 80 76 79 Nucleotide identity
Berlin/99, as well as elderly prototype strains Pesacek/51, Shropshire/56, and DuToit/57 (Barron and Karzon, 1961) showed sequence identities of 73 – 97% at the nucleotide level and 92– 99% at the amino acid level (Table 2). The genetic relationships between E4 strains were investigated by phylogenetic analysis based on an alignment of deduced VP1 amino acid sequences using programs Protdist (determination of evolutionary distances) and Neighbor (construction of an unrooted phylogenetic tree) included in the Phylogeny Interference Package (Phylip) version 3.57c (Felsenstein, 1997). The tree was drawn using the program Treeview (Page, 1996). The analysis of 100 bootstrap resamples of the alignment data sets was performed using the Seqboot and Consense programs of Phylip. The alignment of deduced amino acid sequences of VP1 genes of several E4 viruses is given in Fig. 1. The unrooted phylogenetic tree (Fig. 2) derived from deduced amino acid sequences of the VP1 gene of the viruses shows that E4/Stuttgart/97, E4/Berlin/99, and E4/Jasi/99, are clustered phylogenetically together with some genetic distance to the prototype strain E4/Pesacek/51. All facts mentioned demonstrated that the serologically untypeable E4-component of Stuttgart/97 fully corresponds to other E4 sequences. Recently, it has been demonstrated that enterovirus VP1 sequences correlate well with the serotype (Oberste et al., 1999a,b, 2000). Therefore, the serotype of a virologically unclassified enterovirus may be derived simply from the com-
E4/Shropshire/56 E4/DuToit/57 (%) (%)
E4/Pesacek/51 (%)
97 96 95 81 81
96 96 95 95 94 -
93 93 92 93 83
parison of its VP1 sequence with known VP1 sequences. Using this molecular typing technique the criteria for identification of strains with homologous serotypes are at least 75% nucleotide or 88% amino acid identities in the VP1 genomic
Fig. 2. Phylogenetic tree based on deduced amino acid sequences from VP1 caspid proteins showing genetic relationships between recent echovirus 4 strains Stuttgart/97, Jasi/99, Berlin/99 and other GenBank deposited echovirus 4 strains. The confidence value of the nodes were calculated by performing 100 bootstrap analyses and indicated in percent at the branches. The line on the left hand bottom represents a scale for the tree in terms of proportion of amino acids substituted per site [s/s] indicating the genetic distance between the strains. The phylogram was generated by using programs of the phlogeny interference package (PHYLIP) ver. 3.57c (Felsenstein, 1997.
U. Ku¨ nkel et al. / Virus Research 80 (2001) 87–92
region. These criteria are fulfilled for E4 component of Stuttgart/97 (Table 2). The peculiarity of the sample Stuttgart/97 was the simultaneous infection with E30 and E4. As recently reported for a variant of echovirus 4 (Handsher et al., 1999) the WHO serum pools did not neutralize the isolates while the LBM pools identified only few isolates as E4 due to the fact that used pools were raised against strains isolated more than 40 years ago. A genetic drift of recent strains from the prototype strains has been observed for other enteroviruses. (Nairn and Clements, 1999; Ku¨ nkel and Schreier, 1999, 2000). However, mainly the site and less the quantity of mutations in the capsid genes alters antigenicity of picornaviruses and thus the neutralization properties. Clinical sample Stuttgart/97 was resistant to serologically E4 typing possibly because of definite antigenic variation of the capsid protein. The external capsid proteins VP1, VP2, and VP3 of picornaviruses share an eight-stranded antiparallel b-barrel structure formed of b-strands connected by surface-exposed loops. As reviewed by Mateu (1995) an escape of picornaviruses from neutralisation by monoclonal antibodies is mediated by substitutions of very few, defined amino acid residues of the capsid protein, generally located in antigeneic sites mainly in the loops and exposed on the capsid surface. Structural analysis of coxsackievirus B3 (Muckelbauer et al., 1995) and coxsackievirus A9 (Hendry et al., 1999) (phylogenetically clustered with echoviruses) defined the loops of the capsid protein VP1. Since a high degree of sequence identity and similarity of structure exists between enteroviruses based on molecular and biological properties (Hyypia¨ et al., 1997), is it supposed that homologous loops in echovirus 4 also form antigenic sites. Amino acids corresponding to residues located on the external virion surface of the coxsackievirus A9 are shown in bold in the E4/Stuttgart/97 sequence (Fig. 1). Distinct amino acid variations in most of the presumed antigenic sites in particular in the predicted B– C and G– H loops of VP1 in E4/Stuttgart/97 were not found in other E4 strains. These variations could be sufficient to cause changes in the antigenic specificity of the E4 component of sample Stuttgart/97.
91
Altogether, it could be confirmed that RT-PCR combined with amplicon sequencing is a very useful tool for virus typing, especially when serological typing had failed to identify virus infected samples.
Acknowledgements Technical assistance of Heidrun Linke, Ursula Piede, and Heidrun Roeske and the assistance in copy-editing of Claudia Go¨ tte are gratefully acknowledged. Moreover we wish to thank Professor Dr Andrei Aubert-Combiescu, Director of the National Reference Center for Enteroviruses, Cantacuzino Institute, Bucarest, for providing E4 isolate Jasi/99, and Professor Dr Gisela Enders, Medical Laboratory and Institute of Virology, Infectious Diseases and Epidemiology, Stuttgart, for providing isolate Stuttgart/97.
References Barron, A.L., Karzon, D.T., 1961. Characteristics of echo 4 (Shropshire) virus isolated during epidemic of aseptic meningitis. J. Immunol. 87, 608 – 615. Diedrich, S., Driesel, G., Schreier, E., 1995. Sequence comparison of echovirus type 30 isolates to other enteroviruses in the 5% noncoding region. J. Med. Virol. 46, 148 – 152. Felsenstein, J., 1997. Phylip (phylogeny inference package) version 3.57c. Department of Genetics, University of Washington, Seattle. Distributed by author. Handsher, R., Shulman, L.M., Abramovitz, B., Silberstein, I., Neuman, M., Tepperberg-Oikawa, M., Fisher, T., Mendelson, E., 1999. A new variant of echovirus 4 associated with a large outbreak of aseptic meningitis. J. Clin. Virol. 13, 29 – 36. Hendry, E., Hatanaka, H., Fry, E., Smyth, E., Smyth, M., Tate, J., Stanway, G., Satti, J., Maaronen, M., Hyypia¨ , T., Stuart, D., 1999. The crystal structure of coxsackievirus A9: new insights into the uncoating mechanisms of enteroviruses. Structure 7, 1527 – 1538. Hyypia¨ , T., Hovi, T., Knowles, N.J., Stanway, G., 1997. Classification of enteroviruses based on molecular and biological properties. J. Gen. Virol. 78, 1 – 11. Ku¨ nkel, U., Schreier, E., 1999. Characterization of echovirus 25 (ECV 25) in the VP1/2A gene junction region. Arch. Virol. 144, 2253 – 2258. Ku¨ nkel, U., Schreier, E., 2000. Genetic variability within the VP1 coding region of echovirus type 30 isolates. Arch. Virol. 145, 1455 – 1464.
92
U. Ku¨ nkel et al. / Virus Research 80 (2001) 87–92
Mateu, M.G., 1995. Antibody recognition of picornaviruses and escape from neutralization: a structural view. Virus Res. 38, 1 – 24. Muckelbauer, J.K., Kremer, M., Minor, I., Diana, G., Dutko, F.J., Groarke, J., Pevear, D.C., Rossmann, M.G., 1995. The structure of coxsackievirus B3 at 3.5 A, resolution. Structure 3, 653 –667. Muir, P., Ka¨ mmerer, U., Korn, K., Mulders, M.N., Po¨ yry, T., Weissbrich, B., Kandolf, R., Cleator, G.M., van Loon, A.M., 1998. Molecular typing of enteroviruses: current status and future requirements. Clin. Microbiol. Rev. 11, 202– 227. Nairn, C., Clements, G.B., 1999. A study of enterovirus isolations in Glasgow from 1977 to 1997. J. Med. Virol. 58, 304– 312.
Oberste, M.S., Maher, K., Kilpatrick, D.R., Pallansch, M.A., 1999a. Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classification. J. Virol. 73, 1941 – 1948. Oberste, M.S., Maher, K., Kilpatrick, D.R., Flemister, M.R., Brown, B.A., Pallansch, M.A., 1999b. Typing of human enteroviruses by partial sequencing of VP1. J. Clin. Microbiol. 37, 1288 – 1293. Oberste, M.S., Maher, K., Flemister, M.R., Marchetti, G., Kilpatrick, D.R., Pallansch, M.A., 2000. Comparison of classic and molecular approaches for the identifikation of untypeable enteroviruses. J. Clin. Microbiol. 38, 1170 – 1174. Page, R.D., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357 – 358.