Molybdenum and cadmium co-induce oxidative stress and apoptosis through mitochondria-mediated pathway in duck renal tubular epithelial cells

Journal of Hazardous Materials 383 (2020) 121157

Contents lists available at ScienceDirect

Journal of Hazardous Materials journal homepage: www.elsevier.com/locate/jhazmat

Molybdenum and cadmium co-induce oxidative stress and apoptosis through mitochondria-mediated pathway in duck renal tubular epithelial cells

T

Chang Wanga,1, Gaohui Nieb,1, Fan Yanga, Jian Chena, Yu Zhuanga, Xueyan Daia, Zhiyue Liaoa, ⁎ ⁎ Zhi Yanga, Huabin Caoa, Chenghong Xinga, Guoliang Hua, , Caiying Zhanga, a

Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, No. 1101 Zhimin Avenue, Economic and Technological Development District, Nanchang 330045, Jiangxi, PR China School of Information Technology, Jiangxi University of Finance and Economics, No. 665 Yuping West street, Economic and Technological Development District, Nanchang 330032, Jiangxi, PR China

b

GRAPHICAL ABSTRACT

ARTICLE INFO

ABSTRACT

Editor: R Teresa

High doses of molybdenum (Mo) and cadmium (Cd) cause adverse reactions on animals, but the joint toxic effects of Mo and Cd on duck renal tubular epithelial cells are not fully illustrated. To investigate the combined effects of Mo and Cd on oxidative stress and mitochondrial apoptosis in primary duck renal tubular epithelial cells, the cells were either treated with (NH4)6Mo7O24·4H2O (480, 960 μM Mo), 3CdSO4·8H2O (2.5, 5.0 μM Cd) or combination of Mo and Cd for 12 h, and then the joint cytotoxicity was evaluated. The results demonstrated that Mo or/and Cd exposure could induce release of intracellular lactate dehydrogenase, reactive oxygen species generation, acidification, increase levels of malondialdehyde and [Ca2+]i, decrease levels of glutathione, glutathione peroxidase, catalase, superoxide dismutase, total antioxidant capacity, Na+/K+-ATPase, Ca2+-ATPase, and mitochondrial membrane potential; upregulate mRNA levels of Caspase-3, Bak-1, Bax, and cytochrome C, inhibit Bcl-2 mRNA level, and induce cell apoptosis in a dosedependent manner. Furthermore, the changes of these indicators in co-treated groups were more remarkable. The results indicated that exposure to Mo or/and Cd could induce oxidative stress and apoptosis via the mitochondrial pathway in duck renal tubular epithelial cells and the two metals may have a synergistic effect.

Keywords: Molybdenum Cadmium Oxidative stress Apoptosis Duck renal tubular epithelial cells

Corresponding author at: College of Animal Science and Technology, Jiangxi Agricultural University, No. 1101 Zhimin Avenue, Economic and Technological Development District, Nanchang 330045, Jiangxi, PR China. E-mail addresses: [email protected] (G. Hu), [email protected] (C. Zhang). 1 These two are the equal first authors. ⁎

https://doi.org/10.1016/j.jhazmat.2019.121157 Received 2 August 2019; Received in revised form 3 September 2019; Accepted 3 September 2019 Available online 04 September 2019 0304-3894/ © 2019 Elsevier B.V. All rights reserved.

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al.

1. Introduction

has yet to be understood. Hence, in the study, a cultured cell model of isolated proximal tubular cells from duck kidney was established to investigate the effects of Mo and Cd co-induced apoptosis via the mitochondria-mediated caspase-dependent pathway.

Molybdenum (Mo), a biological trace element, is widely found in animals, plants, and humans (Helaly et al., 2018). It plays a significant role in the structure of enzymes and has been identified as a part of active sites of more than fifty enzymes, and involves in various redox reactions and oxygen atom transfer to promote cell function (Hille et al., 1998). Moreover, Mo has also an important application value in industry, especially mining, cast iron, industrial stainless steel, and fertilizer manufacture. Therefore, Mo content in the environment is increasing gradually with its widely industrial usage (Ema et al., 2010; Pandey and Singh, 2002). Increasingly, previous studies indicated that high doses of Mo have adverse effects on many organs, including kidney, liver, bones, spleen, and reproductive organs (Zhuang et al., 2016; Gu et al., 2015a; Dermience et al., 2015). The kidney is one of the main target organs for Mo exposure (Abramovich et al., 2011). Mo is excreted through the kidney, and it takes a few weeks to completely remove. Excessive intake of Mo can reduce antioxidant enzymes activities, increase free radical cumulation, change apoptosis-related genes expression and ultimately cause different degrees of cell oxidative damage and apoptosis in the body (Zhuang et al., 2016; Bersenyi et al., 2008). Cadmium (Cd) is a well-known occupational hazard and an environmental pollutant (Rani et al., 2014). It mainly derives from some industrial activities in the environment, such as the mining and refining of Cd, the production of batteries, plastics, pigments, and electronic products (Pavon et al., 2019; Waisberg et al., 2003). In addition, Cd has a long biological half-life in the body and accumulates in many organs including kidney, liver, spleen, and reproductive organs, which leads to damage the physical function of these organs (Samuel et al., 2011; Wallin et al., 2014; Gong et al., 2019). The kidney is the main target organ of Cd accumulation, and the proximal tubule is the main target site of Cd toxicity (Matovic et al., 2015). The toxic damage of the kidney induced by Cd can lead to acute and chronic renal failure (Pavon et al., 2019). Previous reports showed that the mechanism of Cd-induced renal injury was correlated with intracellular oxidative stress and apoptosis (Wang et al., 2017, 2019a). Previous researches indicated that oxidative stress-mediated apoptosis is one of the toxic mechanisms of Mo- or/and Cd-induced renal injury (Shi et al., 2017; Gu et al., 2015b). Mo and Cd can break the balance of the oxidant/antioxidant system and result in reactive oxygen species (ROS) accumulation, oxidative damage, and apoptosis as sources of stress (Rani et al., 2014; Erboga et al., 2016; Song et al., 2017). Mitochondria are the major source of ROS generation and the sensitive target of oxygen free radical damage (Orrenius et al., 2007). Excessive ROS can directly cause mitochondrial membrane damage, change mitochondrial membrane permeability, reduce mitochondrial membrane potential (MMP), and release apoptotic factors, thereby activating caspase and ultimately leading to apoptosis (Pavon et al., 2019; Carraro and Bernardi, 2016). Simultaneously, the increase of intracellular [Ca2+]i can elevate ROS level to inhibit Na+/K+-ATPase activity, leading to the release of cytochrome C (Cyt C) and other proapoptotic proteins (Carraro and Bernardi, 2016; Smith et al., 2018). Nowadays, most studies focused on toxic effects of individual heavy metal, whereas human beings and animals are usually simultaneously exposed to multiple heavy metals in the natural environment, which implies that combined toxicity of heavy metals is necessary. China is rich in mineral resources and contains large amounts of tungsten ore (Yang et al., 2011). In the mining and screening processes of tungsten ore, a good deal of discharges of tailings containing Mo and Cd result in long-term accumulation, which jointly pollutes the surrounding water, land, vegetation, and livestock in a large area and threats the health of animals and humans. However, the molecular mechanism of Mo and Cd co-induced nephrotoxicity remains unexplored, especially on waterfowl. In addition, whether the mitochondrial apoptosis is involved in the Mo and Cd co-induced toxicity in duck renal tubular epithelial cells

2. Materials and methods 2.1. Reagents FITC Annexin V Apoptosis Detection Kit was purchased from Becton (Dickinson Company, USA). Lactate dehydrogenase (LDH), malondialdehyde (MDA), glutathione (GSH), glutathione peroxidase (GSHPx), superoxide dismutase (SOD), total antioxidant capacity (T-AOC), Na+/K+-ATPase and Ca2+-ATPase analysis kits were obtained from Jiancheng Bioengineering Institute (Nanjing, China). JC-1 Apoptosis Detection Kit, Normal/Apoptotic/Necrotic Cell Detection Kit, TPEN and MMP detection Kit were purchased from Keygen Biotech Co. Ltd (Nanjing, China). ROS Assay Kit, BCECF AM (pH fluorescent probe, 5 mM) and Fluo-4AM (calcium ion fluorescent probe, 2 mM) were purchased from Beyotime Biotechnology (Shanghai, China). RNAiso Plus, SYBR® Premix Ex TapTM II and PrimeScript RT reagent Kit with gDNAEraser were obtained from Takara (Japan). Type I collagenase, Dulbecco's Hanks (D'Hanks), dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), 0.25% trypsin and hanks balanced salt solution (HBSS) were obtained from Solarbio Biotechnology (Beijing, China). Bulbecco's modification of Eagle's medium/nutrient mixture F12 (DMEM/F12) and fetal bovine serum (FBS) were purchased from Biological Industries (Israel). Ethylene diamine tetraacetic acid (EDTA) was obtained from SigmaAldrich (USA). 2.2. Cell isolation, cell culture, and exposure conditions All animal experiments were approved by the Committee of Animal Welfare. Animal care and experimental procedures were also complied with the criteria of the Institutional Animal Care and Use Committee Guidelines at College of Animal Science and Technology, Jiangxi Agricultural University. The cells were isolated and cultured according to the previous study (Liu, 2018). Briefly, 10–15 days old Shaoxing duck (Anas platyrhyncha) are forbidden to eat and drink for 4 h before the experiment. The euthanasia ducks were soaked in 75% alcohol. The soaked ducks were transferred to the sterile fume hood and removed the feathers with a sterile surgical scissors, and then, removed the kidney from the back. The removed kidney was quickly transferred to the D’Hanks solution containing 3% double-antibody (penicillin and streptomycin). The blood vessels and connective tissue membranes of the kidney were further removed. The kidney was used the small scissors to cut the rest; the degree was broken as much as possible, then it rinsed with D’Hanks solution, 0.1% collagenase I (the amount of enzyme needs to completely cover the kidney) was added for digestion. The kidney in conical bottle was placed in 37℃ water bath and incubated for 10 min in the pot. The conical bottle was shaken gently during the incubation to allow the collagenase I to react completely with the tissue. Incubation collagenase was exchanged after 5 min. The collagenase was aspirated completely after digestion, then, the kidney was added a certain amount of D’Hanks. The D’Hanks solution was used to blow the cells more thoroughly, then the kidney containing D’Hanks was filtered with a 200-mesh screen and four layers of gauze (sterile). The filtrate was suspended in D’Hanks solution, centrifuged at 1000×g for 10 min, washed once, and then resuspended in Percoll working solution, centrifuged at 12,000×g for 30 min, and the cells were divided into upper and lower layers. The lower target cells were centrifuged for 10 min at 2500×g with D’Hanks and washed three times. Then used DMEM/F12 to centrifuge at 2500×g for 10 min to clean once. Finally, the collected cells were suspended with 10% FBS. After mixing with 0.4% trypan 2

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al.

stain and 1:1 cell, the number and ratio of viable cells were calculated using washed red cell counting plates, and inoculated into cell culture flasks and culture plates at 1 × 106 cells/mL. The cells were cultured in DMEM/F12 supplemented with 10% FBS, 100 U/mL of penicillin, and 100 μg/mL of streptomycin at 37℃ in the presence of 5% CO2. of The half-maximal inhibitory concentration (IC50) (NH4)6Mo7O24·4H2O and 3CdSO4·8H2O used on duck renal tubular epithelial cells are 1773.64 μM and 23.27 μM (data not shown), respectively. Therefore, two Mo concentrations (480, 960 μM) and two Cd concentrations (2.5, 5.0 μM) were screened according to IC50. Duck renal tubular epithelial cells were treated as following: 0 μM Mo and 0 μM Cd (Control group), 480 μM Mo (low concentration of Mo (LMo) group), 960 μM Mo (high concentration of Mo (HMo) group), 2.5 μM Cd (low concentration of Cd (LCd) group), 5.0 μM Cd (high concentration of Cd (HCd) group), 480 μM Mo+2.5 μM Cd (LMoLCd group), 960 μM Mo +5.0 μM Cd (HMoHCd group) for 12 h, respectively.

Table 1 Primers used in this study. Gene name

Accession number

Primer sequences (5’ to 3’)

Bak-1

XM_005026829.1

Bcl-2

XM_005026830.4

Caspase-3

XM_005030494.1

Bax

KY_788660.1

Cyt C

XM_027447873.1

β-Actin

EF_667345.1

Forward: GGTGAGCCAGCGTTAGAAAG Reverse: GCTCCTGTCACCATGTTCCT Forward: GGAGGGCTCTGAAAGAAAAGG Reverse: TATGATGCGATGGCACGACTG Forward: CGGACTGTCATCTCGTTCAGGCAC Reverse: GTCCTTCATCGCCATGGCTTAGC Forward: GCCATCAAGGCTCTGTTCTCGC Reverse: TCAAGGCGCTGTCCTCGCCATTTTCCA Forward: ACAAAGGAGATGGCAATGCA Reverse: CACCCCACATATGAGCAACG Forward: ATGTCGCCCTGGATTTCG Reverse: CACAGGACTCCATACCCAAGAA

Cytometry, BD, USA).

2.3. Cell viability assay

2.8. RNA isolation and real-time quantitative polymerase chain reaction analysis

Cell viability was determined by the MTT method. Primary renal tubular epithelial cells at a density of 1 × 105 cells were seeded on 96well plates and cultured to 80% confluence at 37℃. Then the cells were exposed with different concentration gradients of Mo or/and Cd for 3, 6, 12, and 24 h to calculate the cell viability.

Total RNA was isolated from cell samples using Trizol reagent (Takara, Japan) according to the manufacturer’s instructions and was then reverse transcribed. And reverse transcription products (cDNA) were stored at −20℃ for real-time quantitative polymerase chain reaction (RT-qPCR). As shown in Table 1, the gene sequences and accession numbers of duck Bak-1 (XM_005026829.1), Bcl-2 (XM_ 005026830.4), Caspase-3 (XM_005030494.1), Bax (KY788660.1), Cyt C (XM_027447873.1), and β-actin (EF667345.1) were obtained from NCBI GenBank, β-actin was used as a housekeeping gene primer design was based on Primer Express 3.0 software, and synthesized by Shanghai Bioengineering Co., Ltd. The reaction was performed on an ABI Quant Studio 7 Flex PCR instrument. The reaction procedure as follows: predenaturation at 95℃ for 30 s, denaturation at 95℃ for 5 s, annealing at 60℃ for 34 s, 40 cycles. The results were analyzed using Applied Biosystems analysis software.

2.4. LDH release The cell culture medium was collected after 12 h with different concentrations of Mo or/and Cd exposure, and the cells were collected after washed three times with phosphate-buffered saline (PBS). According to the operating instructions of the LDH kit, the LDH activity in culture media and cell lysates were measured by an ultraviolet spectrophotometer; the LDH release is given as a percentage of LDH in the medium relative to total LDH. 2.5. The detection of antioxidant indices The renal tubular epithelial cells were seeded on a 6-well plate at 1 × 105 cells/well and cultured at 37℃. After the cells were grown to 80% confluence, they were treated with different concentrations of Mo or/and Cd for 12 h. The activities of T-AOC, CAT, GSH-Px, SOD, and the contents of GSH, MDA in the renal tubular epithelial cells were measured by an ultraviolet spectrophotometer using detection kits according to the manufacturer’s protocol.

2.9. Acridine orange (AO) / ethidium bromide (EB) counterstaining After the cells exposed for 12 h, the cells were collected by centrifuged with 2000×g for 4 min, and the cells were washed twice with PBS. The concentration of the cells was adjusted to approximately 1 × 106 cells/mL with PBS. The collected cells were fluorescently stained based on the detection kit instructions. It was detected using a fluorescence microscope at an excitation wavelength of 510 nm.

2.6. Determination of Na+/K+-ATPase and Ca2+-ATPase activities

2.10. Statistical analysis

The renal tubular epithelial cells were seeded on a 6-well plate at 1 × 105 cells/well and cultured at 37℃. After the cells were grown to 80% confluence, they were treated with different concentrations of Mo or/and Cd for 12 h. Then the reagent preparation and operation were strictly carried out according to the instructions of kit, and Na+/K+ATPase and Ca2+-ATPase activities of the cell membrane were accurately determined by an ultraviolet spectrophotometer.

Data are presented as mean ± standard deviation (Mean ± SD) from at least three independent experiments, each one performed in triplicate. Intergroup differences were analyzed by one-way ANOVA using SPSS17.0 software, and the multiple comparisons of the running averages by the Duncan method were performed. Finally, test data was drawn using Graph Pad Prism 5.0 software. P < 0.05 means significant difference, P < 0.01 means a very significant difference, P > 0.05 means no significant difference.

2.7. Flow cytometric analysis The duck tubular epithelial cells were seeded on a 6-well plate at a density of 1 × 105 cells/well. The cells were grown to 80% confluence at 37℃ according to experimental needs and treated with different concentrations of Mo or/and Cd for 12 h. Duck tubular epithelial cells were trypsinized and collected by centrifugation. The ROS, MMP, apoptotic rate, intracellular calcium ion [Ca2+]i, and intracellular pH were determined using the ROS kit, MMP kit, apoptotic kit, Ca2+ kit, and pH kit, respectively, according to the manufacturer's protocols. Then the cells were analyzed by flow cytometry (C6 Plus Flow

3. Results 3.1. Mo or/and Cd exposure reduce cell viability Cell viability was shown in Table 2. Compared to the control group, the cell viability of all treatment groups was significantly decreased (P < 0.01) except for LMo group at 3 h. Compared to LMo group and LCd group, the cell viability of HMo group and HCd group was 3

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al.

3.5. Mo or/and Cd exposure decrease intracellular Ca2+-ATPase and Na+/K+- ATPase activities

Table 2 Mo or/and Cd exposure reduce cell viability. Groups

Control LMo HMo LCd HCd LMoLCd HMoHCd

survival rate (%) 3h

6h

12 h

24 h

100 99.39 ± 2.02 92.65 ± 1.09a 95.81 ± 2.00b 91.37 ± 1.77a 93.34 ± 1.60a 87.23 ± 2.43a

100 95.56 ± 2.18b 87.30 ± 1.21a 91.45 ± 2.64a 88.67 ± 2.5a 88.51 ± 1.32a 82.51 ± 1.45a

100 93.87 ± 2.47a 83.19 ± 1.19a 91.12 ± 2.15a 83.23 ± 2.92a 86.22 ± 2.66a 70.21 ± 3.01a

100 92.24 ± 1.00a 78.84 ± 2.38a 89.48 ± 2.06a 78.92 ± 1.88a 74.42 ± 2.60a 62.00 ± 2.60a

The activities of Ca2+-ATPase and Na+/K+-ATPase were shown in Fig. 4. The activities of Ca2+-ATPase and Na+/K+-ATPase in all treated groups were significantly decreased (P < 0.01) compared to the control group, they were significantly reduced in HMo and HCd groups (P < 0.05 or P < 0.01) compared to LMo group and LCd group, respectively; and they were markedly decreased in combined groups (P < 0.01) than those in treated groups alone (Fig. 4A and B). 3.6. Mo or/and Cd exposure increase intracellular [Ca2+]i, apoptotic rate and ROS production; decrease intracellular pH and MMP

Cell viabilities of the control group at the destined time points were assumed as 100%, and the variations were represented as percentage. The results were expressed as mean ± SD. Comparing the exposed groups (LMo, HMo, LCd, HCd, LMoLCd and HMoHCd) with the respective control: ap＜0.01 and bp＜0.05 using one-way ANOVA.

As shown in Fig. 5, renal tubular epithelial cells treated with different concentrations of Mo or/and Cd showed stronger [Ca2+]i fluorescence intensity at 12 h in a dose-dependent manner compared to the control group (P < 0.01). The intracellular [Ca2+]i was higher in co-treated groups (P < 0.01) than that in single treated groups (Fig. 5A and B). The apoptotic rate was extremely increased (P < 0.01) in all treated groups compared to the control group and showed in a dose-dependent manner, it was higher in combined groups (P < 0.01) than that in the treated groups alone (Fig. 5C and D). ROS fluorescence intensity was enhanced with the increasing of Mo and Cd concentrations, which indirectly indicated a significant increase in ROS levels in cells exposed to Mo and Cd (P < 0.01). ROS levels of combined groups were markedly increased (P < 0.01) compared to single treated groups (Fig. 5E and F). The intracellular pH in cells was extremely decreased (P < 0.01) in all treated groups and showed in a dose-dependent manner, which suggested that Mo or/and Cd exposure led to intracellular acidification. Additionally, it was acutely reduced in joint groups (P < 0.01) compared to single treated groups (Fig. 5G and H). We found that the percentage of cells with low membrane potential increased (P < 0.01) with the increase of Mo and Cd concentrations, which showed that Mo and Cd exposure could destroy MMP, moreover, it was remarkably increased (P < 0.01) in united groups than that in single treated groups (Fig. 5I and J).

extremely decreased (P < 0.05 or P < 0.01) at 3, 6, 12, and 24 h, respectively. It was markedly lower (P < 0.05 or P < 0.01) in the cotreatment groups than that in the treatment groups alone. 3.2. Mo or/and Cd exposure change duck renal tubular epithelial cell morphology As shown in Fig. 1, normal morphology of cells was found in control and LMo groups. In HMo group, most of the cell morphology remained intact and a small portion of the membrane was deformed. In LCd group, we found that the cells had a contracted state and a small number of round circles, and the lesions were not obvious. In HCd group, most of the cells showed nuclear pyknosis, became smaller, the color was darkly stained, the nucleus ruptured, and the cells appeared to shrink and shine. In LMoLCd and HMoHCd groups, a large number of nucleus ruptured or even disappeared, the cells were severely shrunk, the nucleolus disappeared, chromatin was concentrated under the nuclear membrane, the nucleus was ring-shaped, and the cells experienced severe pathological changes, and these changes in HMoHCd group were more serious. Therefore, these changes suggested that Mo or/and Cd exposure could cause serious damage to the cells in a dose-dependent manner and the two metals may have a synergistic effect.

3.7. Mo or/and Cd exposure induce apoptosis-related genes mRNA expression

3.3. Mo or/and Cd exposure promote the release rate of intracellular LDH

As shown in Fig. 6, the mRNA levels of Bak-1, Caspase-3, Bax and Cyt C in all treated groups were remarkably upregulated (P < 0.01) compared to the control group; they were higher in HMo group and HCd group (P < 0.01) than those in LMo group and LCd group, respectively; they were significantly increased in the joint groups (P < 0.01) compared to the treated groups alone (Fig. 6A-B, D and F). The ratio of Bcl-2 and Bax was decreased with the increase of Mo and Cd concentrations (Fig. 6E). Additionally, compared to the control group, the mRNA level of Bcl-2 was significantly downregulated (P < 0.01) in all treated groups except for LMo group; it was markedly lower in HMo group and HCd group (P < 0.01) than that in LMo group and LCd group, respectively; it was lower in co-treated groups (P < 0.01) than that in treated groups alone.

The release rate of cellular LDH was shown in Fig. 2. Compared to the control group, the intracellular and extracellular LDH activities as well as the release rate of LDH were extremely increased (P < 0.01) in all treated groups except for LMo group, they were significantly increased in HMo group and HCd group (P < 0.01) compared to LMo group and LCd group, respectively, they were higher in co-treated groups (P < 0.01) than those in treated groups alone. 3.4. Mo or/and Cd exposure break the balance of antioxidant system in duck renal tubular epithelial cells As shown in Fig. 3, compared to the control group, the levels of SOD, T-AOC, CAT, GSH, and GSH-Px were extremely declined (P < 0.01) in all treated groups except for LMo group (Fig. 3A-C); they were significantly decreased (P < 0.01) in HMo and HCd groups compared to LMo group and LCd group, respectively; they were lower in cotreated groups (P < 0.01) than those in treated groups alone (Fig. 3AE). Additionally, as shown in Fig. 3F, compared to the control group, MDA content was markedly increased (P < 0.01) in all treated groups except for LMo group, it was higher in HMo group (P < 0.01) than that in LMo group, there was no significant difference (P > 0.05) between LCd group and HCd group. Moreover, it was higher (P < 0.01) in joint treatment groups than that in single treatment groups.

3.8. Mo or/and Cd exposure increase cell apoptosis rate (AO/EB counterstaining) The results were shown in Fig. 7. The AO/EB staining of the control group was green, which showed that the cell survival rate was high, and the apoptotic rate was low. Apoptotic cells were observed in all exposed groups, and the cells were stained yellow, orange, or red. Compared to the control group, the number of survival cells in all treated groups were significantly decreased (P < 0.01); they were significantly decreased in HMo group and HCd group (P < 0.01) compared to LMo group and LCd group, respectively; they were lower in co-treated 4

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al.

Fig. 1. Mo or/and Cd exposure changed duck renal tubular epithelial cell morphology. Morphological changes of cells under an inverted phase contrast microscope (200 total magnification). In Mo or/and Cd exposed groups, a small portion of the membrane deformed and most of the cells showed nuclear pyknosis, became smaller, the color was darkly stained, the nucleus ruptured, and the cells appeared to shrink and shine.

groups (P < 0.01) than those in treated groups alone. Simultaneously, the same changes were observed in all Cd treatment groups.

activity accompanying by modulation of Bcl-2, Bak-1, Bax, Cyt C, Caspase-3 mRNA levels, and apoptotic rate. High doses of Mo and Cd could cause adverse reactions at multiple cellular aspects (Chomchan et al., 2018; Fujishiro et al., 2018). In this study, Mo or/and Cd resulted in cell shrinkage, reduced cell size, density, and viability in duck renal tubular epithelial cells; the changes were more obvious in the combined treatment groups. Increasing LDH leakage showed that Mo and Cd disrupted the cell membrane. LDH is abundantly present in tissues and organs of animals and is released from the cells only when the cell membrane is damaged (Jurisic et al., 2015). It can directly reflect the destruction of cell membrane integrity. A study reported that Cd-induced cell death was characterized by a massive release of LDH (Messner et al., 2012). ROS is composed of superoxide radical anions, hydrogen peroxide, hydroxyl radicals, and peroxides (Wang et al., 2015). Excessive ROS cause oxidative stress, which disrupt cell membranes and inactivates key cellular enzymes, leading to structural and functional changes (Wei et al., 2019). Previous studies suggested that Cd altered structure or/and function of biomolecules through promoting ROS generation, thereby resulting in oxidative stress (Huang et al., 2006; Li et al., 2010). Moreover, the intracellular antioxidant system can act against oxidative stress including different free radical scavenging antioxidant enzymes and non-enzyme

4. Discussion It is now well accepted that high doses of Mo and Cd are known as nephrotoxic toxicants, and Mo- and Cd-induced nephrotoxicity were shown to be dose dependent(Shi et al., 2017). Mo and Cd exposure can cause tubular epithelial damage, which is the major target site of kidney damage (Gu et al., 2015b; Alvarez-Barrientos et al., 2001; Xiao et al., 2011). However, little is known about the joint effects of Mo and Cd on nephrotoxicity. Primary cells culture is a perfect model of toxicity research in vitro, since the cultured cells are similar with the living tissue (Wang et al., 2009). Therefore, in the study, primary cultured duck renal tubular epithelial cells were used to investigate the Mo- or/and Cd-induced nephrotoxicity, focusing on the correlation among oxidative stress, cell homeostasis, mitochondria, and apoptosis. Primarily, events exposed to Mo or/and Cd during a 12 h period were chosen to evaluate the toxic effects. The present research indicated that the mode of cell death was apoptosis which was mediated by the ROS activated mitochondrial pathway as evidenced by the increase of ROS and intracellular [Ca2+]i, the decrease of MMP, intracellular pH and ATPase

Fig. 2. Mo or/and Cd exposure promoted the release rate of intracellular LDH. (A) Intracellular LDH activity; (B) extracellular LDH activity; (C) LDH release rate. Note: Bars represent mean ± standard deviation. With the column data, the same letters on shoulder mean the difference is not significant (P > 0.05), different small letters mean a significant difference (P < 0.05), and different capital letters for the extremely significant difference (P < 0.01). The followings present the same. 5

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al.

Fig. 3. Mo or/and Cd exposure broke the balance of antioxidant system in duck renal tubular epithelial cells. (A) GSH concentration; (B) SOD activity; (C) T-AOC; (D) CAT activity; (E) GSH-Px activiy; (F) MDA concentration.

antioxidants. SOD, CAT, GSH, and GSH-Px are regarded as the most vital enzymes against ROS (Chen et al., 2019). SOD converts superoxide anion to molecular oxygen and hydrogen peroxide, thereby reducing the occurrence of lipid peroxidation, and then the CAT decomposition of H2O2 to water and oxygen, it reflects the ability of the cell to remove ROS and the resistance to oxidative damage (Hao and Liu, 2019; Rengel et al., 2005; Chen et al., 2018). GSH is a highly effective free radical scavenger that removes intracellular ROS and protects the cell membrane from oxygen free radicals (Islam et al., 2017; Terpilowska and Siwicki, 2019). GSH-Px, a major enzyme for intracellular decomposition of lipid peroxidase, has the ability to remove superoxide anion radical (Anand et al., 2012). The decomposition of lipid peroxidation product MDA is generally regarded as a marker of lipid peroxidation (Klaunig et al., 2011). MDA content in the body reflects the severity of the cellular damage. T-AOC is the total capacity of various antioxidants to scavenge oxygen free radicals in both enzymatic and non-enzymatic systems (Dai et al., 2018). Many researches revealed that high doses of

Mo- or Cd-induced nephrotoxicity were associated with oxidative stress, including lipid peroxidation and ROS production (Terpilowska and Siwicki, 2019; Cao et al., 2016; Xia et al., 2015; Yang et al., 2019). In this study, the results showed that Mo or/and Cd induced a large amounts of ROS production in a dose-dependent manner, accompanied by the decrease of antioxidant enzymes activities including SOD, CAT, GSH, GSH-Px, and T-AOC and the increase of MDA content, the changes were more obvious in joint treated groups. These findings illustrated that duck renal tubular epithelial cells were severely oxidatively damaged and oxidative stress played a pivotal role in cytotoxicity induced by Mo or/and Cd. Moreover, Mo and Cd had a synergistic effect. The body produces a large amounts of ROS under the induction of heavy metals, which then causes oxidative stress, damages the body and activates apoptosis (Huang et al., 2006). Currently, most of the apoptotic signaling transduction pathways have been elucidated. However, many studies have been revealed that the apoptotic signaling pathway is mediated by mitochondria (Wang et al., 2015; Yang et al., 2019).

Fig. 4. Mo or/and Cd exposure decreased intracellular Ca2+-ATPase and Na+/K+- ATPase activities. (A) Ca2+-ATPase activity; (B) Na+/K+-ATPase activity. 6

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al.

Fig. 5. Mo or/and Cd exposure increased (A, B) intracellular [Ca2+]I; (C, D) apoptotic rate and (E, F) ROS production; decreased (G, H) intracellular pH; (I, J) MMP in duck renal tubular epithelia cells.

7

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al.

Fig. 6. Mo or/and Cd exposure induced apoptosis-related genes mRNA expression. (A) Bak-1; (B) Caspase-3; (C) Bcl-2; (D) Bax; (E) Bcl-2/Bax; (F) Cyt C.

Excessive ROS directly lead to peroxidative damage and impaired mitochondrial function (Nathan and Cunningham-Bussel, 2013; Surendran and Rajasankar, 2010), ultimately caused mitochondrial swelling and MMP collapse (Bolduc et al., 2004; Sandoval-Acuna et al., 2014). MMP is a major biomarker of apoptosis and is induced by oxidative stress. The MMP collapse disrupts the balance of the intracellular defense system, leads to intracellular acidification and changes the permeability of the mitochondrial membrane, accordingly promoting apoptosis (Pavon et al., 2019; Kalaivani et al., 2014). In this study, the

increase of ROS and the decrease of MMP in Mo or/and Cd treated groups were accompanied by the increase of apoptotic rate in duck renal tubular epithelial cells, which showed ROS accumulation in the cells could cause a breakdown of MMP. Therefore, it could be reasonably presumed that mitochondria played a pivotal role in Mo- or/and Cd-induced apoptosis of duck renal tubular epithelial cells. Apoptosis is the main mode of cell death and is regulated by many pro-apoptotic genes and anti-apoptotic genes (Jin et al., 2018; Zheng et al., 2019). Caspase-3 is an important cytoplasmic enzyme, which plays a key role

Fig. 7. Mo or/and Cd exposure increased cell apoptosis rate (AO/EB counterstaining). (A) The proportion of survival and apoptosis cells; (B) Fluorescence microscope observation results. 8

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al.

in mitochondria-induced apoptosis. Once Caspase-3 is activated, the occurrence of apoptosis is irreversible (Larsen et al., 2010). The Bcl-2 anti-apoptotic gene prevents apoptosis by blocking the opening of the mitochondrial membrane pores, which results in mitochondrial membrane potential losing (Gobe and Crane, 2010). Bak-1 and Bax are proapoptotic protein and their overexpression promote apoptosis. The role of Bcl-2 is opposite to that of Bax. Therefore, the ratio of Bcl-2 to Bax has an important role in deciding whether a cell dies after it has obtained an apoptotic signal (Shi et al., 2010). Bax dimer changes the permeability of the mitochondrial membrane, promotes mitochondrial Cyt C release into the cytoplasm, and then activates caspase (Cao et al., 2016; Hu et al., 2019). In this study, Mo or/and Cd upregulated the Caspase-3, Bak-1, Bax, and Cyt C mRNA levels and inhibited the Bcl-2 mRNA level, their changes were more obvious in cells treated with different combinations of Mo and Cd. And, the ratio of Bcl-2 to Bax was significantly decreased with the increase of Mo and Cd concentrations (Fig. 6). The results implied that Mo or/and Cd could induce apoptosis via the caspase-dependent pathway in duck renal tubular epithelial cells, and its occurrence was in highly correlated with mitochondria. It is further proved that the toxic mechanism of Mo or/and Cd on duck renal tubular epithelial cells is related to oxidative stress and apoptosis induced by the mitochondrial pathway. In addition, mitochondria not only produce ROS in cells, but also alter the equilibrium state of the intracellular environment during the process of apoptosis, such as intracellular pH and Ca2+ homeostasis (Foster et al., 2006). Intracellular acidification induced by ROS was associated with mitochondria-mediated apoptosis, which promotes Cyt C-mediated caspase activation (Matsuyama et al., 2000). Moreover, reduction of cytosolic pH directly affect MMP to make it negative, which further leads to mitochondrial dysfunction (Foster et al., 2006). Mitochondria are the main site of ATP production and MMP is the driving force of ATP synthesis, the decrease of ATP caused by MMP breakdown lead to cytoplasmic Ca2+ homeostasis imbalance (Qin et al., 2008). Intracellular Ca2+ overload causes opening of the mitochondria permeability transition pore, which produces mitochondrial swelling, release of mitochondrial Ca2+ into the cytoplasm, and contributes to apoptosis (Foster et al., 2006; Nicotera and Orrenius, 1998). Previous study showed that intracellular Ca2+ overload was associated with apoptosis induced by Cd in rPT cells (Wang et al., 2009). In this study, intracellular pH decreased and intracellular [Ca2+]i increased in Mo or/and Cd treated groups, which indicated that intracellular acidification and Ca2+ overload might be the important mechanisms of apoptosis in duck renal tubular epithelial cells treated Mo or/and Cd. Intracellular [Ca2+]i is maintained by many factors. Among them, Ca2+ATPase and Na+/K+-ATPase play vital roles in intracellular Ca2+ homeostasis (Wang et al., 2019b). The decrease of Ca2+-ATPase and Na+/K+-ATPase activities impaired Ca2+ transport, and ultimately led to irreversible damage of cells (Sousa et al., 2018). Ca2+-ATPase and Na+/K+-ATPase require sufficient ATP to maintain their normal function. Ca2+-ATPase, an enzyme of the carrier protein family presenting on all cell membrane, regulates the homeostatic balance inside and outside the cell through the active transport of Ca2+ (Bogdanova et al., 2013; Brini and Carafoli, 2009). Na+/K+-ATPase is a membranebound enzyme responsible for transmembrane transport of cations (Ozcan Oruc et al., 2002). The activities of Ca2+-ATPase and Na+/K+ATPase induced by Cd led to the increase of intracellular Ca2+ concentration and promoted apoptosis. (Wang et al., 2009). In this study, Mo or/and Cd exposure significantly decreased Na+/K+-ATPase and Ca2+-ATPase activities and increased intracellular [Ca2+]i, which further confirmed Ca2+-ATPase and Na+/K+-ATPase play key roles in maintaining intracellular Ca2+ homeostasis. Meanwhile, Ca2+-ATPase and Na+/K+-ATPase are highly susceptible to oxidative damage as well as free radical attack (Qin et al., 2008). Therefore, we concluded that mitochondrial dysfunction and the decrease of ATPase activity due to ROS overproduction were involved in intracellular calcium overload.

5. Conclusion In summary, exposure to Mo or/and Cd could cause oxidative stress by excessive ROS, and induce apoptosis through the mitochondriamediated pathway in duck renal tubular epithelial cells and the two metals had a synergistic effect. Declaration of Competing Interest The authors declare that there are no conflicts of interest. Acknowledgments This study was supported by the National Natural Science Foundation of China (No. 31260625, Beijing, P.R. China). All authors thank all members of clinical veterinary medicine laboratory in the College of Animal Science and Technology, Jiangxi Agricultural University, for help in the experimental process. References Helaly, A.M., Mokhtar, N., Firgany, A.E.L., Hazem, N.M., El Morsi, E., Ghorab, D., 2018. Molybdenum bupropion combined neurotoxicity in rats. Regul. Toxicol. Pharmacol. 98, 224–230. Hille, R., Retey, J., Bartlewski-Hof, U., Reichenbecher, W., 1998. Mechanistic aspects of molybdenum-containing enzymes. FEMS Microbiol. Rev. 22, 489–501. Ema, M., Kobayashi, N., Naya, M., Hanai, S., Nakanishi, J., 2010. Reproductive and developmental toxicity studies of manufactured nanomaterials. Reprod. Toxicol. 30, 343–352. Pandey, R., Singh, S.P., 2002. Effects of molybdenum on fertility of male rats. Biometals 15, 65–72. Zhuang, Y., Liu, P., Wang, L., Luo, J., Zhang, C., Guo, X., Hu, G., Cao, H., 2016. Mitochondrial oxidative stress-induced hepatocyte apoptosis reflects increased molybdenum intake in caprine. Biol. Trace Elem. Res. 170, 106–114. Gu, X., Chen, R., Hu, G., Zhuang, Y., Luo, J., Zhang, C., Guo, X., Huang, A., Cao, H., 2015a. Cell apoptosis of caprine spleen induced by toxicity of cadmium with different levels of molybdenum. Environ. Toxicol. Pharmacol. 40, 49–56. Dermience, M., Lognay, G., Mathieu, F., Goyens, P., 2015. Effects of thirty elements on bone metabolism. J. Trace Elem. Med. Biol. 32, 86–106. Abramovich, M., Miller, A., Yang, H., Friel, J.K., 2011. Molybdenum content of Canadian and US infant formulas. Biol. Trace Elem. Res. 143, 844–853. Bersenyi, A., Berta, E., Kadar, I., Glavits, R., Szilagyi, M., Fekete, S.G., 2008. Effects of high dietary molybdenum in rabbits. Acta Vet. Hung. 56, 41–55. Rani, A., Kumar, A., Lal, A., Pant, M., 2014. Cellular mechanisms of cadmium-induced toxicity: a review. Int. J. Environ. Health Res. 24, 378–399. Pavon, N., Buelna-Chontal, M., Macias-Lopez, A., Correa, F., Uribe-Alvarez, C., Hernandez-Esquivel, L., Chavez, E., 2019. On the oxidative damage by cadmium to kidney mitochondrial functions. Biochem. Cell Biol. 97, 187–192. Waisberg, M., Joseph, P., Hale, B., Beyersmann, D., 2003. Molecular and cellular mechanisms of cadmium carcinogenesis. Toxicology 192, 95–117. Samuel, J.B., Stanley, J.A., Princess, R.A., Shanthi, P., Sebastian, M.S., 2011. Gestational cadmium exposure-induced ovotoxicity delays puberty through oxidative stress and impaired steroid hormone levels. J. Med. Toxicol. 7, 195–204. Wallin, M., Sallsten, G., Lundh, T., Barregard, L., 2014. Low-level cadmium exposure and effects on kidney function. Occup. Environ. Med. 71, 848–854. Gong, Z.G., Wang, X.Y., Wang, J.H., Fan, R.F., Wang, L., 2019. Trehalose prevents cadmium-induced hepatotoxicity by blocking Nrf2 pathway, restoring autophagy and inhibiting apoptosis. J. Inorg. Biochem. 192, 62–71. Matovic, V., Buha, A., Ethukic-Cosic, D., Bulat, Z., 2015. Insight into the oxidative stress induced by lead and/or cadmium in blood, liver and kidneys. Food Chem. Toxicol. 78, 130–140. Wang, X.Y., Yang, H., Wang, M.G., Yang, D.B., Wang, Z.Y., Wang, L., 2017. Trehalose protects against cadmium-induced cytotoxicity in primary rat proximal tubular cells via inhibiting apoptosis and restoring autophagic flux. Cell Death Dis. 8, e3099. Wang, L.Y., Fan, R.F., Yang, D.B., Zhang, D., Wang, L., 2019a. Puerarin reverses cadmium-induced lysosomal dysfunction in primary rat proximal tubular cells via inhibiting Nrf2 pathway. Biochem. Pharmacol. 162, 132–141. Shi, L., Cao, H., Luo, J., Liu, P., Wang, T., Hu, G., Zhang, C., 2017. Effects of molybdenum and cadmium on the oxidative damage and kidney apoptosis in Duck. Ecotoxicol. Environ. Saf. 145, 24–31. Gu, X., Ali, T., Chen, R., Hu, G., Zhuang, Y., Luo, J., Cao, H., Han, B., 2015b. In vivo studies of molybdenum-induced apoptosis in kidney cells of caprine. Biol. Trace Elem. Res. 165, 51–58. Erboga, M., Kanter, M., Aktas, C., Sener, U., Fidanol Erboga, Z., Bozdemir Donmez, Y., Gurel, A., 2016. Thymoquinone ameliorates cadmium-induced nephrotoxicity,apoptosis, and oxidative stress in rats is based on its anti-apoptotic and anti-oxidant properties. Biol. Trace Elem. Res. 170, 165–172. Song, X.B., Liu, G., Liu, F., Yan, Z.G., Wang, Z.Y., Liu, Z.P., Wang, L., 2017. Autophagy blockade and lysosomal membrane permeabilization contribute to lead-induced

9

Journal of Hazardous Materials 383 (2020) 121157

C. Wang, et al. nephrotoxicity in primary rat proximal tubular cells. Cell Death Dis. 8, e2863. Orrenius, S., Gogvadze, V., Zhivotovsky, B., 2007. Mitochondrial oxidative stress: implications for cell death. Annu. Rev. Pharmacol. Toxicol. 47, 143–183. Carraro, M., Bernardi, P., 2016. Calcium and reactive oxygen species in regulation of the mitochondrial permeability transition and of programmed cell death in yeast. Cell Calcium 60, 102–107. Smith, N.A., Kress, B.T., Lu, Y., Chandler-Militello, D., Benraiss, A., Nedergaard, M., 2018. Fluorescent Ca2+ indicators directly inhibit the Na+,K+-ATPase and disrupt cellular functions. Sci. Signal. 11. Yang, F., Cui, H., Xiao, J., Peng, X., Deng, J., Zuo, Z., 2011. Increased apoptotic lymphocyte population in the spleen of young chickens fed on diets high in molybdenum. Biol. Trace Elem. Res. 140, 308–316. Liu, W., 2018. Changes of antioxidant function and the mRNA expression levels of xanthine oxidase in primary chick kidney cell culture caused by nephropathogenic infectious bronchitis virus infection. Pak. Vet. J. 38, 51–55. Alvarez-Barrientos, A., O’Connor, J.E., Castillo, R.N., Moreno, A.B.M., Prieto, P., 2001. Use of flow cytometry and confocal microscopy techniques to investigate early CdCl2induced nephrotoxicity in vitro. Toxicol. in Vitro 15, 407–412. Xiao, J., Cui, H.M., Yang, F., Peng, X., Cui, Y., 2011. Effect of dietary high molybdenum on the cell cycle and apoptosis of kidney in broilers. Biol. Trace Elem. Res. 142, 523–531. Wang, L., Cao, J., Chen, D., Liu, X., Lu, H., Liu, Z., 2009. Role of oxidative stress, apoptosis, and intracellular homeostasis in primary cultures of rat proximal tubular cells exposed to cadmium. Biol. Trace Elem. Res. 127, 53–68. Chomchan, R., Siripongvutikorn, S., Maliyam, P., Saibandith, B., Puttarak, P., 2018. Protective effect of selenium-enriched ricegrass juice against cadmium-induced toxicity and DNA damage in HEK293 kidney cells. Foods 7. Fujishiro, H., Liu, Y., Ahmadi, B., Templeton, D.M., 2018. Protective effect of cadmiuminduced autophagy in rat renal mesangial cells. Arch. Toxicol. 92, 619–631. Jurisic, V., Radenkovic, S., Konjevic, G., 2015. The actual role of LDH as tumor marker, biochemical and clinical aspects. Adv. Exp. Med. Biol. 867, 115–124. Messner, B., Ploner, C., Laufer, G., Bernhard, D., 2012. Cadmium activates a programmed, lysosomal membrane permeabilization-dependent necrosis pathway. Toxicol. Lett. 212, 268–275. Wang, Z., Li, S., Ren, R., Li, J., Cui, X., 2015. Recombinant buckwheat trypsin inhibitor induces mitophagy by directly targeting mitochondria and causes mitochondrial dysfunction in Hep G2 cells. J. Agric. Food Chem. 63, 7795–7804. Wei, W., Lan, X.B., Liu, N., Yang, J.M., Du, J., Ma, L., Zhang, W.J., Niu, J.G., Sun, T., Yu, J.Q., 2019. Echinacoside alleviates hypoxic-ischemic brain injury in neonatal rat by enhancing antioxidant capacity and inhibiting apoptosis. Neurochem. Res. 44, 1582–1592. Huang, Y.H., Shih, C.M., Huang, C.J., Lin, C.M., Chou, C.M., Tsai, M.L., Liu, T.P., Chiu, J.F., Chen, C.T., 2006. Effects of cadmium on structure and enzymatic activity of Cu,Zn-SOD and oxidative status in neural cells. J. Cell. Biochem. 98, 577–589. Li, J.L., Li, S., Tang, Z.X., Xu, S.W., 2010. Oxidative stress-mediated cytotoxicity of cadmium in chicken splenic lymphocytes. Toxicol. Lett. 196 S122-S122. Chen, M., Li, X., Shi, Q., Zhang, Z., Xu, S., 2019. Hydrogen sulfide exposure triggers chicken trachea inflammatory injury through oxidative stress-mediated FOS/IL8 signaling. J. Hazard. Mater. 368, 243–254. Hao, M., Liu, R., 2019. Molecular mechanism of CAT and SOD activity change under MPA-CdTe quantum dots induced oxidative stress in the mouse primary hepatocytes. Spectrochim. Acta A. Mol. Biomol. Spectrosc. 220, 117104. Rengel, R.G., Filipovic-Grcic, J., Cepelak, I., Zanic-Grubisic, T., Barisic, K., 2005. The effect of liposomes with superoxide dismutase on A2182 cells. Eur. J. Pharm. Biopharm. 60, 47–51. Chen, L., Zhang, J., Zhu, Y., Zhang, Y., 2018. Interaction of chromium(III) or chromium (VI) with catalase and its effect on the structure and function of catalase: an in vitro study. Food Chem. 244, 378–385. Islam, M.A., Al Mamun, M.A., Faruk, M., Ul Islam, M.T., Rahman, M.M., Alam, M.N., Afmt, R., Reza, H.M., Alam, M.A., 2017. Astaxanthin ameliorates hepatic damage and oxidative stress in carbon tetrachloride-administered rats. Pharmacognosy Res. 9, S84–S91. Terpilowska, S., Siwicki, A.K., 2019. Cell cycle and transmembrane mitochondrial potential analysis after treatment with chromium(iii), iron(iii), molybdenum(iii) or nickel(ii) and their mixtures. Toxicol. Res. (Camb) 8, 188–195. Anand, K.V., Mohamed Jaabir, M.S., Thomas, P.A., Geraldine, P., 2012. Protective role of chrysin against oxidative stress in d-galactose-induced aging in an experimental rat model. Geriatr. Gerontol. Int. 12, 741–750. Klaunig, J.E., Wang, Z., Pu, X., Zhou, S., 2011. Oxidative stress and oxidative damage in

chemical carcinogenesis. Toxicol. Appl. Pharmacol. 254, 86–99. Dai, X., Xing, C., Cao, H., Luo, J., Wang, T., Liu, P., Guo, X., Hu, G., Zhang, C., 2018. Alterations of mitochondrial antioxidant indexes and apoptosis in duck livers caused by Molybdenum or/and cadmium. Chemosphere 193, 574–580. Cao, H., Xia, B., Zhang, M., Liao, Y., Yang, Z., Hu, G., Zhang, C., 2016. Changes of antioxidant function and the mRNA expression levels of apoptosis genes in duck ovaries caused by molybdenum or/and cadmium. Biol. Trace Elem. Res. 171, 410–418. Xia, B., Cao, H., Luo, J., Liu, P., Guo, X., Hu, G., Zhang, C., 2015. The co-induced effects of molybdenum and cadmium on antioxidants and heat shock proteins in duck kidneys. Biol. Trace Elem. Res. 168, 261–268. Yang, F., Pei, R., Zhang, Z., Liao, J., Yu, W., Qiao, N., Han, Q., Li, Y., Hu, L., Guo, J., Pan, J., Tang, Z., 2019. Copper induces oxidative stress and apoptosis through mitochondria-mediated pathway in chicken hepatocytes. Toxicol. In Vitro 54, 310–316. Nathan, C., Cunningham-Bussel, A., 2013. Beyond oxidative stress: an immunologist’s guide to reactive oxygen species. Nat. Rev. Immunol. 13, 349–361. Surendran, S., Rajasankar, S., 2010. Parkinson’s disease: oxidative stress and therapeutic approaches. Neurol. Sci. 31, 531–540. Bolduc, J.S., Denizeau, F., Jumarie, C., 2004. Cadmium-induced mitochondrial membrane-potential dissipation does not necessarily require cytosolic oxidative stress: studies using rhodamine-123 fluorescence unquenching. Toxicol. Sci. 77, 299–306. Sandoval-Acuna, C., Ferreira, J., Speisky, H., 2014. Polyphenols and mitochondria: an update on their increasingly emerging ROS-scavenging independent actions. Arch. Biochem. Biophys. 559, 75–90. Kalaivani, P., Saranya, S., Poornima, P., Prabhakaran, R., Dallemer, F., Vijaya Padma, V., Natarajan, K., 2014. Biological evaluation of new nickel(II) metallates: synthesis, DNA/protein binding and mitochondrial mediated apoptosis in human lung cancer cells (A549) via ROS hypergeneration and depletion of cellular antioxidant pool. Eur. J. Med. Chem. 82, 584–599. Jin, X., Jia, T., Liu, R., Xu, S., 2018. The antagonistic effect of selenium on cadmiuminduced apoptosis via PPAR- γ/PI3K/Akt pathway in chicken pancreas. J. Hazard. Mater. 357, 355–362. Zheng, S., Jin, X., Chen, M., Shi, Q., Zhang, H., Xu, S., 2019. Hydrogen sulfide exposure induces jejunum injury via CYP450s/ROS pathway in broilers. Chemosphere 214, 25–34. Larsen, B.D., Rampalli, S., Burns, L.E., Brunette, S., Dilworth, F.J., Megeney, L.A., 2010. Caspase 3/caspase-activated DNase promote cell differentiation by inducing DNA strand breaks. Proc. Natl. Acad. Sci. U. S. A. 107, 4230–4235. Gobe, G., Crane, D., 2010. Mitochondria, reactive oxygen species and cadmium toxicity in the kidney. Toxicol. Lett. 198, 49–55. Shi, L., Chen, J., Yang, J., Pan, T., Zhang, S., Wang, Z., 2010. MiR-21 protected human glioblastoma U87MG cells from chemotherapeutic drug temozolomide induced apoptosis by decreasing Bax/Bcl-2 ratio and caspase-3 activity. Brain Res. 1352, 255–264. Hu, X., Chi, Q., Liu, Q., Wang, D., Zhang, Y., Li, S., 2019. Atmospheric H2S triggers immune damage by activating the TLR-7/MyD88/NF-κB pathway and NLRP3 inflammasome in broiler thymus. Chemosphere 237, 124427. Foster, K.A., Galeffi, F., Gerich, F.J., Turner, D.A., Muller, M., 2006. Optical and pharmacological tools to investigate the role of mitochondria during oxidative stress and neurodegeneration. Prog. Neurobiol. 79, 136–171. Matsuyama, S., Llopis, J., Deveraux, Q.L., Tsien, R.Y., Reed, J.C., 2000. Changes in intramitochondrial and cytosolic pH: early events that modulate caspase activation during apoptosis. Nat. Cell Biol. 2, 318–325. Qin, X.J., Li, Y.N., Liang, X., Wang, P., Hai, C.X., 2008. The dysfunction of ATPases due to impaired mitochondrial respiration in phosgene-induced pulmonary edema. Biochem. Biophys. Res. Commun. 367, 150–155. Nicotera, P., Orrenius, S., 1998. The role of calcium in apoptosis. Cell Calcium 23, 173–180. Wang, S., Chi, Q., Hu, X., Cong, Y., Li, S., 2019b. Hydrogen sulfide-induced oxidative stress leads to excessive mitochondrial fission to activate apoptosis in broiler myocardia. Ecotox Environ Saf. 183, 109578. Sousa, L., Pessoa, M.T.C., Costa, T.G.F., Cortes, V.F., Santos, H.L., Barbosa, L.A., 2018. Iron overload impact on P-ATPases. Ann. Hematol. 97, 377–385. Bogdanova, A., Makhro, A., Wang, J., Lipp, P., Kaestner, L., 2013. Calcium in red blood cells-a perilous balance. Int. J. Mol. Sci. 14, 9848–9872. Brini, M., Carafoli, E., 2009. Calcium pumps in health and disease. Physiol. Rev. 89, 1341–1378. Ozcan Oruc, E., Uner, N., Tamer, L., 2002. Comparison of Na+,K+-ATPase activities and malondialdehyde contents in liver tissue for three fish species exposed to azinphosmethyl. Bull. Environ. Contam. Toxicol. 69, 271–277.

10