Monitoring for dynamic biological processing by intramolecular bioluminescence resonance energy transfer system using secreted luciferase

ANALYTICAL BIOCHEMISTRY Analytical Biochemistry 329 (2004) 230–237 www.elsevier.com/locate/yabio

Monitoring for dynamic biological processing by intramolecular bioluminescence resonance energy transfer system using secreted luciferase Tomomi Otsuji,a Emiko Okuda-Ashitaka,b,c,¤ Satoshi Kojima,a Hidefumi Akiyama,d Seiji Ito,b and Yoshihiro Ohmiyaa,e a

Special Division for Human Life Technology, Cell Dynamics Research Group, National Institute of AIST, Ikeda 563-8577, Japan b Department of Medical Chemistry, Kansai Medical University, Moriguchi 570-8506, Japan c Information and Cell Function, PRESTO, Japan Science and Technology Agency, Kawaguchi 332-0012, Japan d Institute for Solid State Physics, University of Tokyo, Kashiwa 277-8581, Japan e Light and Regulation, PRESTO, Japan Science and Technology Agency, Kawaguchi 332-0012, Japan Received 4 December 2003 Available online 4 May 2004

Abstract Proteolytic processing plays crucial roles in physiological and pathophysiological cellular functions such as peptide generation, cell cycle, and apoptosis. We developed a novel biophysical bioluminescence resonance energy transfer (BRET) system between a secreted Vargula luciferase (Vluc) and an enhanced yellow Xuorescent protein (EYFP) for visualization of cell biological processes. The bioluminescence spectrum of the fusion protein (Vluc–EYFP) is bimodal (
max D 460 nm (Vluc) and 525 nm (EYFP)), indicating that the excited-state energy of Vluc transfers to EYFP (in short, BRET). The BRET signal can be measured in the culture medium and pursue quantitative production of two neuropeptides, nocistatin (NST) and nociceptin/orphanin FQ (N/OFQ) in living cells. NST and N/OFQ are located in tandem on the same precursor, but NST exhibits antagonistic action against N/OFQ-induced central functions. Insertion of a portion of the NST–N/OFQ precursor (Glu-Gln-Lys-Gln-Leu-Gln-Lys-Arg-Phe-Gly-Gly-Phe-Tyr-Gly) in Vluc–EYFP makes the fusion protein cleavable at Lys-Arg in NG108-15 cells, and proprotein convertase 1 enhances this digestion. The change in BRET signals quantiWes the processing of the fusion protein. Our novel intramolecular BRET system using a secreted luciferase is useful for investigating peptide processing in living cells.  2004 Elsevier Inc. All rights reserved. Keywords: Bioluminescence resonance energy transfer; Vargula luciferase; Enhanced yellow Xuorescent protein; Neuropeptide; Protein processing; Proprotein convertase

Posttranslational modiWcation by proteolysis is an essential process exhibiting numerous cellular functions including the generation of peptides from precursor proteins and the ordered degradation involved in the cell cycle and apoptosis [1–4]. Such a process is also implicated in tumor metastasis and the pathogenesis of Alzheimer’s disease [5–7]. Proteolysis has been measured biochemically in the lysate of destroyed cells and in a cell-free system, whereas real-time and quantitative pro-

¤

Corresponding author. Fax: +81-6-6992-1781. E-mail address: [email protected] (E. Okuda-Ashitaka).

0003-2697/$ - see front matter  2004 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2004.03.010

tein processing cannot be monitored in living cells at present. Bioluminescence resonance energy transfer (BRET)1 is a naturally occurring phenomenon in numerous bioluminescent marine organisms such as the jellyWsh Aequorea and the sea pansy Renilla [8]. In this process, a

1 Abbreviations used: BRET, bioluminescence resonance energy transfer; Vluc, Vargula luciferase; EYFP, enhanced yellow Xuorescent protein; NST, nocistatin; N/OFQ, nociceptin/orphanin FQ; GFP, green Xuorescent protein; FRET, Xuorescence resonance energy transfer; Rluc, Renilla luciferase; PCR, polymerase chain reaction; PC, proprotein convertase.

T. Otsuji et al. / Analytical Biochemistry 329 (2004) 230–237

luminescent (“donor”) protein nonradiatively transfers its excited-state energy to the Xuorophore (“acceptor”) of green Xuorescent protein (GFP) without the emission of a photon [9]. This energy transfer depends on the distance between the two proteins and on the overlap of the emission spectrum of the donor and the excitation spectrum of the acceptor. In addition to Xuorescence resonance energy transfer (FRET) [10], in which energy transfer occurs between two Xuorescent proteins, BRET [11–14] with Renilla luciferase (Rluc) has recently been used for analysis of molecular interactions such as dimerization of
2-adrenergic receptors and their agonist-induced interaction with the adaptor protein
-arrestin 2 [13] and interaction between the cyanobacteria circadian clock proteins KaiA and KaiB [14]. When we initially tried the intramolecular BRET using Rluc–GFP fusion protein, the BRET signal was weak and the proteolytic processing did not occur in living cells. We took a new BRET donor protein for Vargula luciferase (Vluc), whereas donor proteins have been so far limited to Rluc or aequorin [15]. The marine ostracod crustacean, Vargula (formerly Cypridina) hilgendorWi, ejects a light-blue luminescent luciferase (Vluc) into seawater. When cDNA for Vluc was transfected into mammalian cells, the Vluc protein was secreted into the medium via a pathway through the endoplasmic reticulum and the Golgi complex and then into storage and transport vesicles [16–19]. Luciferase activity in the culture medium can be easily quantiWed as light intensity after mixing an aliquot of medium with the substrate, Vargula luciferin. We developed a new intramolecular BRET system between Vluc and enhanced yellow Xuorescent protein (EYFP). Peptidergic hormones are generally synthesized as large precursor proteins, which are posttranslationally processed to mature bioactive peptides. Although preproenkephalin, preprodynorphin, and preproopiomelanocortin all contain several bioactive peptides with similar functions, nocistatin (NST) and nociceptin/ orphanin FQ (N/OFQ) seem to have opposite central functions including pain transmission, learning, and memory [20–23]. To date, this is the Wrst such antagonistic example to be demonstrated, and peptide processing is presumably one of the regulatory mechanisms of NST and N/OFQ function. We applied a new intramolecular BRET system between Vluc and EYFP to monitoring the peptide processing of NST and N/OFQ in living cells.

Materials and methods cDNA constructs for expression studies The EYFP and Vluc constructs were ampliWed by polymerase chain reaction (PCR) using templates based

231

on pEYFP-N1 (Clontech) or pSV2-vl [16], respectively. The oligonucleotide primers including the underlined linker sequence were as follows: EYFP sense primers, 5⬘(BstXI) TACCATTGTGCTGGATGGTGAGCAAG GGCGAGGAGCTG-3⬘ (for construct of EYFP alone) and 5⬘-(HindIII–NotI–BamHI) CAAGCTTGCGGCC GCAGGATCCGTGAGCAAGGGCGAGGAGCTGT TCAC-3⬘ (without initiation codon ATG for construct of Vluc–EYFP fusion protien); EYFP antisense primer, 5⬘-(BstXI) TACCATTGTGCTGGTTACTTGTACAG CTCGTCCATGC-3⬘; Vluc sense primer, 5⬘-(HindIII– BstXI) CACAAGCTTCCATTGTGCTGGAGAAGA TAATAATTCTGTCTGTTATATTGGC-3⬘; Vluc antisense primer, 5⬘-(BamHI) TGTGGATCCTTGACAT TC AGGTGGTACTTCTAG-3⬘. The ampliWed product for EYFP alone with BstXI linkers was introduced into the expression vecter pEF–Bos. For the fusion construct Vluc–EYFP, the ampliWed product for EYFP with a HindIII–NotI–BamHI and a BstXI linker was ligated into the HindIII/BstXI site of pcDNA3.1. The ampliWed product for Vluc with a HindIII–BstXI and a BamHI linker was ligated into the HindIII/BamHI site of pcDNA3.1 containing the EYFP. The resulting product was cloned into the BstXI site of pEF–Bos to give the Vluc–EYFP construct. The Rluc–GFP was constructed using PCR products of GFP and Rluc as templates based on pGFP (Clontech) or pRL–null (Promega), respectively. The oligonucleotide primers including the underlined linker sequence were as follows: GFP sense primer, 5⬘-(HindIII–NotI–BamHI) CACAAGCTTGC GGCCGCAGGATCCAGTAAAGGAGAAGAACTT TTCACTGGAGTTGTC-3⬘ (without initiation codon ATG); GFP antisense primer, 5⬘-(XhoI–BstXI) AGA CTCGAGCCATTGTGCTGGTTATTTGTATAGTTC ATCCATGCCATGTGTAATCCCAGC-3⬘; Rluc sense primer, 5⬘-(HindIII–BstXI) CACAAGCTTCCATTGT GCTGGATGACTTCGAAAGTTTATGATCCAGA ACAAAGG-3⬘; Rluc antisense primer, 5⬘-(HindIII– XhoI–BamHI) CACAAGCTTCTCGAGGGATCCTT GTTCATTTTTGAGAACTCGCTCAACGAACG-3⬘ (without termination codon TAA). The ampliWed product for GFP with a HindIII–NotI–BamHI and a BstXI– XhoI linker was ligated into the HindIII/XhoI site of pcDNA3.1. The ampliWed product for Rluc with a HindIII–BstXI and a BamHI–XhoI–HindIII linker was ligated into the HindIII/BamHI site of pcDNA3.1 containing the GFP. The resulting product was cloned into the BstXI site of pEF–Bos to give the Rluc–GFP construct. To produce the COOH-terminal hexapeptide of NST and the NH2-terminal hexapeptide of N/OFQ construct, including Lys-Arg, we designed the following oligonucleotides: a sense oligonucleotide, 5⬘-GATCCG AGCAGAAACAGCTGCAGAAGCGGTCGGGGG CTTCACCGGGG-3⬘; and an antisense oligonucleotide, 5⬘-GATCCCCCGGTGAAGCCCCCGAACCGCTTC GCAGCTGTTTCTGCTCG-3⬘. The annealed product

232

T. Otsuji et al. / Analytical Biochemistry 329 (2004) 230–237

was ligated in-frame into the BamHI site of the Vluc– EYFP construct to give the Vluc–NST/Noc–EYFP construct. In the mutant construct, we replaced Lys-Arg (AAGCGG) with Gly-Gly (GGGGGG), and in the deletion construct, Lys-Arg (AAGCGG) was removed. The cDNAs of proprotein convertase PC1 and PC2 were obtained from mouse or rat brain, respectively, and ampliWed by reverse transcriptase PCR. The oligonucleotide primers including the underlined linker sequence were as follows: PC1 sense primer, 5⬘-(XbaI) GATCTAGACAGCCCTTCCTACTTG TGTGAGAA CAAGG-3⬘; PC1 antisense primer, 5⬘-(XbaI) GATCT AGAGAAGATTCCCAACTCAGGCAACACACTT AT-3⬘; PC2 sense primer, 5⬘-(BstXI) TACCATTGT GC TGGACCCTGCGCGCCTCGCAGCCC-3⬘; and PC2 antisense primer, 5⬘-(BstXI) TACCATTGTGCTGGAGATGGAGGCGGAAGCGTGGC-3⬘. The ampliWed products were ligated in-frame into the BstXI site (PC2) or XbaI site (PC1) of pEF–Bos. The cloned PC1 and PC2 were able to cleave the proopiomelanocortin detected by immunoblotting.

ors A.v. (JL-8) monoclonal antibody (1:3000; Clontech) or rabbit anti-Vluc IgG (0.5 g/ml) [18] for 2 h at room temperature. Living colors A.v. (JL-8) monoclonal antibody recognized EYFP protein (hereafter referred to as anti-EYFP antibody). After washing with TBST buVer, the membrane was incubated with horseradish peroxidase-conjugated sheep anti-mouse IgG (1:20,000; Amersham) or goat anti-rabbit IgG (1:20,000; BioSource International) for 1 h at room temperature. Immunodetection was performed using Amersham ECL Western blotting detection reagents. Bands were quantiWed using a Lane Analyzer (ATTO). Confocal imaging Transfected cells grown on glass coverslips were observed using a laser scanning confocal microscope (Zeiss LSM510). EYFP was excited using a 514-nm argon/krypton laser and detected with a 530-nm band pass Wlter. GFP was excited using a 488-nm argon/krypton laser and detected with a 505-nm band pass Wlter. Images were manipulated with LSM510 software.

Cell culture and transfection Measurement of luciferase activity Cos7 cells and NG108-15 cells were grown in Dulbecco’s modiWed Eagle’s medium supplemented with 10% fetal bovine serum. Transient transfection was performed on cells at 70–80% conXuency by using Lipofectamin (Invitrogen) for Cos7 cells or Lipofectamin 2000 (Invitrogen) for NG108-15 cells according to the manufacturer’s protocol. At 24 h after transfection, medium was replaced with serum-free Dulbecco’s modiWed Eagle’s medium without phenol red. Cells and media were harvested at 48 h after transfection. Immunoblotting Transfected cells were detached with phosphatebuVered saline containing 0.02% EDTA. After centrifugation, collected cells were sonicated in buVer containing 20 mM Tris–HCl (pH 7.4) and 1 mM EDTA and then centrifuged at 20,000g for 15 min. The resulting supernatant was used as cell lysate. Culture medium was concentrated with Centricon YM-10 (Millopore) according to the manufacturer’s protocol. An equal volume of 20% trichloroacetic acid was added to the concentrated culture medium of NG108-15 cells, and this mixture was incubated on ice for 20 min. After centrifugation at 20,000g for 15 min, the resulting pellet was washed with acetone, dried, and dissolved in SDS–PAGE sample buVer. Proteins were separated by 4–12% SDS–PAGE and transferred electrophoretically to a polyvinylidene diXuoride membrane. The membrane was blocked with TBST buVer (10 mM Tris–HCl at pH 7.4, 150 mM NaCl, and 0.1% Triton X-100) containing 5% skim milk for 1 h at room temperature and then incubated with living col-

Cell lysate in 20 mM Tris–HCl (pH 7.4) and culture medium of transfected cells (50 l) were treated with a saturating concentration of Vargula luciferin [19] (1 l of 0.5 M luciferin) for Vluc or DeepBlueC (1 l of 25 M DeepBlueC (Packard)) for Rluc and then measured with a Lumat Model AB-2200 photometer (ATTO) for 20 s. Bioluminescence and Xuorescence assays Bioluminescence and Xuorescence measurements were performed with an AB1850 spectroXuorometer (ATTO) equipped with a back-illuminated LN/CCD512TKB (Princeton Instruments). Culture medium was collected and concentrated using Centricon YM-10 to make luciferase activity more than 2 £ 104 RLU/l; 20 l of the concentrated medium was used for the measurement of spectra. For bioluminescent spectra for Vluc, the substrate luciferin was added to the culture medium of transfected cells to a Wnal concentration of 100 nM and the spectrum for 120 s (slit width 0.5 mm, spectral resolution 20 nm) was collected. For bioluminescent spectra for Rluc, the substrate DeepBlueC was added to the cell extract of transfected cells to a Wnal concentration of 7 M and the spectrum for 180 s was collected. On the measurement of Xuorescence, excitation was induced at 477 nm for EYFP and at 458 nm for GFP from an argon ion laser (0.4 mW), and Xuorescence was measured via a colored glass Wlter, which cut wavelengths shorter than 500 nm for EYFP and 480 nm for GFP. All spectra were corrected for the photosensitivity of the equipment.

T. Otsuji et al. / Analytical Biochemistry 329 (2004) 230–237

Results and discussion We chose Vluc as the donor luciferase. To examine whether Vluc and EYFP could be partner proteins for BRET and compare with BRET using Rluc as luciferase, we used a fusion construct directly linking Vluc to EYFP (Vluc–EYFP) or Rluc to GFP (Rluc–GFP), as shown in Fig. 1A. When these fusion constructs were transfected into Cos7 cells, Xuorescent proteins were uniformly distributed in the cells expressing Rluc–GFP or EYFP. The distribution of Vluc–EYFP was diVerent from the distri-

233

bution of Rluc–GFP and EYFP. When localization of the expressed proteins in the cells and culture medium was assessed by their luciferase activities, Rluc–GFP was detected only in the cell (cell, 4.8 £ 106 RLU; medium, not detected). On the other hand, 83% of total luciferase acticity was detected in the culture medium of Vluc– EYFP-transfected cells (cell, 7.3 £ 104 RLU; medium, 44.0 £ 104 RLU), and a similar result was observed with Vluc alone (cell, 6.6 £ 105 RLU; medium, 31.0 £ 105 RLU). The speciWc activity (RLU/mg) of secreted Vluc–EYFP was approximately 70% of that of Vluc

Fig. 1. Biological activity and BRET of Vluc–EYFP fusion protein in Cos7 cells. (A) Diagrams of expression cassettes of Vluc, EYFP, Vluc–EYFP, and Rluc–GFP. The intergenic linker sequence of two amino acid residues is also shown. Right panels show confocal images of cells expressing Vluc, EYFP, Vluc–EYFP, and Rluc–GFP. (B) Luciferase activity of the secreted Vluc–EYFP fusion protein. Luciferase activity in culture medium is corrected by the amount of protein based on the intensity of immunoblotting analysis, as shown in (C). SpeciWc activity of Vluc is taken as 100%. (C) Immunoblots of culture medium in Cos7 cells expressing Vluc–EYFP fusion protein using anti-Vluc and anti-EYFP antibodies. (D) BRET in Cos7 cells expressing Vluc–EYFP (left) and Rluc–GFP (right) fusion proteins. Plots in left panel are luminescence emission spectra, which show transfected cells expressing Vluc protein (dark blue), Vluc–EYFP fusion protein (green), and coexpression of Vluc and EYFP as nonfusion protein (light blue). Both spectra were normalized at 460 nm. Fluorescence emission spectrum of EYFP was observed by excitation at 477 nm (red) and was normalized at 525 nm. Plots in right panel are luminescence emission spectra, which show transfected cells expressing Rluc protein (blue) and Rluc–GFP fusion protein (green). Both spectra were normalized at 395 nm. Fluorescence emission spectrum of GFP was observed by excitation at 458 nm (red) and was normalized at 510 nm.

234

T. Otsuji et al. / Analytical Biochemistry 329 (2004) 230–237

(Fig. 1B). Immunoblot analysis of Vluc–EYFP in culture medium with anti-Vluc and anti-EYFP antibodies demonstrated a protein band with molecular mass of approximately 95 kDa, which was consistent with the expected size of the fusion protein Vluc–EYFP, since Vluc and EYFP protein bands were observed at masses of approximately 68 and 27 kDa, respectively (Fig. 1C). Taken together, these results indicate that the fusion protein Vluc–EYFP possesses both the biological activity of Vluc (secretion and luciferase activity) and the Xuorescence of EYFP. To examine whether BRET occurred in the fusion protein Vluc–EYFP, we measured the bioluminescence spectrum of the culture medium of Cos7 cells expressing Vluc–EYFP (Fig. 1D). Bioluminescence of Vluc was observed with a peak at 460 nm. The luminescence proWle of the Cos7 cells expressing Vluc–EYFP yielded a bimodal spectrum, with one peak at 460 nm (for Vluc), and a second peak at 525 nm. This peak was identical to the observed Xuorescence emission peak of EYFP after excitation at 477 nm, suggesting that a signiWcant proportion of the excited-state energy of Vluc was trans-

ferred to EYFP. However, this BRET did not occur with coexpression of Vluc and EYFP as nonfusion proteins (Fig. 1D) or with mixture of separately expressed Vluc and EYFP (data not shown), indicating physical proximity between Vluc and EYFP appropriate for BRET in the fusion protein. In the cell expressing Rluc–GFP, the luminescence spectrum has two peaks, with a major peak at 395 nm (for Rluc) and a minor peak at 500 nm (for GFP) using DeepBlueC as a substrate, showing BRET between Rluc and GFP. The luminescence ratio of 525 nm/460 nm for Vluc–EYFP was 1.00, whereas the luminescence ratio of 500 nm/395 nm for Rluc–GFP was low (0.14), as previously reported by Jensen et al. [24] with a similar fusion protein. The present study demonstrates that Vluc and EYFP can act as good intramolecular BRET partners, superior to Rluc–GFP in eYciency of BRET and secretion in culture medium. To apply the BRET system for monitoring dynamic biological processes in living mammalian cells, we tried Vluc–EYFP as BRET probe. We inserted constructs of the COOH-terminal hexapeptide of NST (Glu-Gln-LysGln-Leu-Gln) and the NH2-terminal hexapeptide of

Fig. 2. Cleavage of Vluc–NST/Noc–EYFP fusion protein in NG108-15 cells. (A) Diagrams of expression cassettes of Vluc–NST/Noc–EYFP, mut– Vluc–NST/Noc–EYFP, and del–Vluc–NST/Noc–EYFP. (B) Immunoblots of culture medium of NG108-15 cells expressing Vluc–NST/Noc–EYFP fusion proteins using anti-Vluc (left) and anti-EYFP (right) antibodies. (C) Each lane shows cotransfection of the Vluc–NST/Noc–EYFP fusion proteins with PC1 or PC2.

T. Otsuji et al. / Analytical Biochemistry 329 (2004) 230–237

N/OFQ (Phe-Gly-Gly-Phe-Thr-Gly) containing a proteolytic cleavage motif (Lys-Arg) within Vluc–EYFP (Vluc–NST/Noc–EYFP), as shown in Fig. 2A. The Vluc–NST/Noc–EYFP construct was transfected into neuroblastoma cell line NG108-15 cells that produce both peptides N/OFQ and NST (E. Okuda.–Ashitaka, unpublished observation). Immunoblot analysis using anti-Vluc antibody revealed strong 95-kDa and faint 68kDa protein bands in the culture medium of NG108-15 cells expressing the Vluc–NST/Noc–EYFP (Fig. 2B). The 95-kDa protein band agreed with the expected size of Vluc–NST/Noc–EYFP. In addition to the 95-kDa protein band, a 27-kDa protein band was detected in the culture medium of NG108-15 cells expressing the Vluc– NST/Noc–EYFP by anti-EYFP antibody. The 68-kDa protein band by anti-Vluc antibody and the 27-kDa

235

protein band by anti-EYFP antibody were not detected with a mutation construct containing Gly-Gly instead of Lys-Arg or a deletion mutant lacking Lys-Arg. These results indicate that Vluc–NST/Noc–EYFP was cleaved at Lys-Arg, and both Vluc tagged with the COOH-terminal hexapeptide of NST (Vluc–NST) and EYFP tagged with the NH2-terminal hexapeptide of N/OFQ (Noc–EYFP) were secreted into the culture medium as 68- and 27-kDa proteins, respectively. When we used Rluc–GFP or Rluc–EYFP as BRET partner instead of Vluc–NST/Noc–EYFP, the Lys-Arg between NST and N/OFQ was not cleaved in the cells (data not shown), although the eYciency of BRET of Vluc–EYFP was superior to that of Rluc–GFP (Fig. 1D) and similar to that of Rluc–EYFP (data not shown). These results suggest that the biological properties of Vluc such as

Fig. 3. Application of BRET in NG108-15 cells expressing Vluc–NST/Noc–EYFP fusion protein for peptide processing. (A) BRET in NG108-15 cells expressing Vluc–NST/Noc–EYFP fusion protein. Plots are luminescence emission spectra, which show transfected cells expressing Vluc protein (blue), Vluc–NST/Noc–EYFP fusion protein (green), Vluc–NST/Noc–EYFP+PC1 (red), or Vluc–NST/Noc–EYFP+PC2 (black). All spectra were normalized at 460 nm. The inset shows the relative spectral intensities, which were calculated as BRET spectrum of Vluc–NST/Noc–EYFP minus that of Vluc. (B, C, D) Correlation of BRET signal and peptide processing. BRET signal (B) was calculated from inset in (A). Area of the relative Vluc–NST/Noc–EYFP BRET spectrum was taken as 100%. The % of fusion protein (C) was calculated by intensity of intact protein/(intact protein + cleaved protein) in Fig. 2 (B). (D) NG108-15 cells cotransfected with a constant amount of Vluc–NST/Noc–EYFP fusion protein and increasing amounts of PC1 (Vluc–NST/Noc–EYFP:PC1 molar ratio D 1:0, 1:0.025, 1:0.05, 1:0.075, 1:0.25, 1:0.5, respectively) were used to calculate both BRET signal and % of fusion protein.

236

T. Otsuji et al. / Analytical Biochemistry 329 (2004) 230–237

secretion might be essential for monitoring the proteolytic processing. PC1 (also known as PC3) and PC2 are involved in the processing of several neuropeptide precursors such as proinsulin, proenkephalin, and proopiomelanocortin [1,25]. To study whether PC1 and/or PC2 are implicated in the cleavage of the Lys-Arg between NST and N/ OFQ, we cotransfected Vluc–NST/Noc–EYFP with PC1 or PC2 in NG108-15 cells. As shown in Fig. 2C, immunoblotting revealed that cotransfection with PC1 and Vluc–NST/Noc–EYFP markedly increased both the 68-kDa Vluc–NST and the 27-kDa Noc–EYFP protein bands. These bands were hardly observed in NG108-15 cells coexpressing it with PC2 or expressing Vluc–NST/ Noc–EYFP protein lacking Lys-Arg. Total protein (unprocessed and processed proteins) of Vluc–NST/ Noc–EYFP in the medium cotransfected with PC1 was similar to that of Vluc–NST/Noc–EYFP with PC2. PC1 did not aVect the luciferase activity of secreted Vluc– NST/Noc–EYFP into medium signiWcantly (data not shown). PC1 aVects neither the secretion rate nor the half-life of Vluc–NST/Noc–EYFP. These results demonstrated that PC1 was involved in the cleavage of Lys-Arg between NST and N/OFQ. Allen et al. [26] recently reported that PC2 is involved in the formation of N/ OFQ in a study using PC2-deWcient mice. Since the production of N/OFQ is dependent on digestion of both sides of N/OFQ, PC2 may be responsible only for cleaving the distal site. PC1 is localized to the trans-Golgi network and secretory granules, whereas PC2 acts in a post-Golgi compartment or in secretory granules [27]. The appropriate subcellular localization may be also required for exhibiting activities of PC1 and PC2. As shown in Fig. 3A, expression of Vluc–NST/Noc– EYFP in NG108-15 cells resulted in the appearance of peaks both at 460 nm and at 525 nm, indicating that BRET occurred in Vluc–NST/Noc–EYFP-expressing cells. The intensity at 525 nm in NG108-15 cells expressing Vluc–NST/Noc–EYFP was approximately 60% of that observed in the fusion protein Vluc–EYFP. An intense BRET signal for Vluc–NST/Noc–EYFP was similarly detected in NG108-15 cells expressing the GlyGly mutant or the deletion mutant of Vluc–NST/Noc– EYFP (data not shown). The 40% diVerence in BRET signal between Vluc–NST/Noc–EYFP and Vluc–EYFP may be ascribed to changes in distance and orientation between Vluc and EYFP. The BRET signal for Vluc–NST/Noc–EYFP was dramatically reduced in NG108-15 cells cotransfected with PC1 but not with PC2 (Fig. 3A). Furthermore, to investigate the correlation between BRET signal and peptide processing, we quantiWed areas of the relative BRET spectra (Fig. 3A, inset) and fusion protein levels based on intensity after immunoblotting (Figs. 2B and C). Cotransfection of PC1 reduced the BRET signal for Vluc–NST/Noc–EYFP to 31% and the fusion protein

level to 30% at an equimolar ratio (Figs. 3B and C). Changes in neither the BRET signal nor the protein level for Vluc–NST/Noc–EYFP were observed with cotransfection of PC2. Furthermore, when Vluc–NST/ Noc–EYFP was cotransfected to NG108-15 cells with increasing amounts of PC1, BRET signals and fusion protein levels for Vluc–NST/Noc–EYFP were reduced in a dose-dependent manner. As shown in Fig. 3D, BRET signals increased linearly with increasing amounts of fusion proteins and they were well correlated (r2 D 0.968). Thus the amount of processed protein can be quantitatively measured by the decrease in BRET signal. In the present study, we have demonstrated intramolecular BRET occurring between the secreted luciferase Vluc and the EYFP that has proWles suitable for monitoring dynamic biological processes in living cells. In comparison with the FRET system and previous intermolecular BRET system with Rluc–GFP, the BRET system with Vluc–EYFP shown here has the following advantages: (1) the BRET signal can be easily measured using an aliquot of medium, (2) the BRET signal is capable of pursuing repetitive and quantitative biological processes in living cells without destruction, and (3) the RET signal is particularly eVective in studies of posttranslational modiWcation and biological processing in intact cells. Acknowledgments We thank W. J. Hastings for helpful suggestions and H. Kubota and T. Enomoto for technical assistance with bioluminescence and Xuorescence assays. This work was supported in part by Grants-in-Aid for scientiWc research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan and by grants from the Japan Private School Promotion Foundation, the Naito Foundation, the Mochida Memorial Foundation for Medical and Pharmaceutical Research, and the Uehara Memorial Foundation. References [1] N.G. Seidah, M. Chrétien, Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypeptides, Brain Res. 848 (1999) 45–62. [2] D.M. Koepp, J.W. Harper, S.J. Elledge, How the cyclin became a cyclin: regulated proteolysis in the cell cycle, Cell 97 (1999) 431–434. [3] G.S. Salvesen, V.M. Dixit, Caspases: intracellular signaling by proteolysis, Cell 91 (1997) 443–446. [4] A. Strasser, L. O’Connor, V.M. Dixit, Apoptosis signaling, Annu. Rev. Biochem. 69 (2000) 217–245. [5] L.M. Coussens, B. Fingleton, L.M. Matrisian, Matrix metalloproteinase inhibitors and cancer: trials and tribulations, Science 295 (2002) 2387–2392. [6] A.-M. Khatib, G. Siegfried, M. Chrétien, P. Metrakos, N.G. Seidah, Proprotein convertases in tumor progression and malignancy novel targets in cancer therapy, Am. J. Pathol. 160 (2002) 1921–1935.

T. Otsuji et al. / Analytical Biochemistry 329 (2004) 230–237 [7] J. Hardy, D.J. Selkoe, The Amyloid Hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics, Science 297 (2002) 353–356. [8] Y. Ohmiya, T. Hirano, Shining the light: the mechanism of the bioluminescence reaction of calcium-binding photoproteins, Chem. Biol. 3 (1996) 333–347. [9] J.G. Morin, J.W. Hastings, Energy transfer in a bioluminescent system, J. Cell. Physiol. 77 (1971) 313–318. [10] A. Miyawaki, J. Llopis, R. Heim, J.M. McCaVery, J.A. Adams, M. Ikura, R.Y. Tsien, Fluorescent indicators for Ca2+based on green Xuorescent proteins and calmodulin, Nature 388 (1997) 882–887. [11] M. McVey, D. Ramsay, E. Kellett, S. Rees, S. Wilson, A.J. Pope, G. Milligan, Monitoring receptor oligomerization using timeresolved Xuorescence resonance energy transfer and bioluminescence resonance energy transfer, J. Biol. Chem. 276 (2001) 14092–14099. [12] Z.-J. Cheng, L.J. Miller, Agonist-dependent dissociation of oligomeric complexes of protein-coupled cholecystokinin receptors demonstrated in living cells using bioluminescence resonance energy transfer, J. Biol. Chem. 276 (2001) 48040–48047. [13] S. Angers, A. Salahpour, E. Joly, S. Hilairet, D. Chelsky, M. Dennis, M. Bouvier, Detection of 2-adrenergic receptor dimerization in living cells using bioluminescence resonance energy transfer (BRET), Proc. Natl. Acad. Sci. USA 97 (2000) 3684–3689. [14] Y. Xu, D.W. Piston, C.H. Johnson, A bioluminescence resonance energy transfer (BRET) system: application to interacting circadian clock proteins, Proc. Natl. Acad. Sci. USA 96 (1999) 151–156. [15] V. Baubet, H.L. Mouellic, A.K. Campbell, E. Lucas-Meunier, P. Fossier, P. Brûlet, Chimeric green Xuorescent protein-aequorin as bioluminescent Ca2+ reporters at the single-cell level, Proc. Natl. Acad. Sci. USA 97 (2000) 7260–7265. [16] E.M. Thompson, S. Nagata, F.I. Tsuji, Cloning and expression of cDNA for the luciferase from the marine ostracod Vargula hilgendorWi, Proc. Natl. Acad. Sci. USA 86 (1989) 6567–6571. [17] E.M. Thompson, S. Nagata, F.I. Tsuji, Vargula hilgendorWi luciferase: a secreted reporter enzyme for monitoring gene expression in mammalian cells, Gene 96 (1990) 257–262.

237

[18] S. Inouye, Y. Ohmiya, Y. Toya, F.I. Tsuji, Imaging of luciferase secretion from transformed Chinese hamster ovary cells, Proc. Natl. Acad. Sci. USA 89 (1992) 9584–9587. [19] Y. Tanahashi, Y. Ohmiya, S. Honma, Y. Katsuno, H. Ohta, H. Nakamura, K. Honma, Continuous measurement of targeted promoter activity by a secreted bioluminescence reporter, Vargula hilgendorWi luciferase, Anal. Biochem. 289 (2001) 260– 266. [20] J.-C. Meunier, Nociceptin/orphanin FQ and the opioid receptorlike ORL1 receptor, Eur. J. Pharmacol. 340 (1997) 1–15. [21] S. Ito, E. Okuda-Ashitaka, T. Imanishi, T. Minami, Central roles of nociceptin/orphanin FQ and nocistatin: allodynia as a model of neural plasticity, Prog. Brain Res. 129 (2000) 205–218. [22] E. Okuda-Ashitaka, T. Minami, S. Tachibana, Y. Yoshihara, Y. Nishiuchi, T. Kimura, S. Ito, Nocistatin, a peptide that blocks nociceptin action in pain transmission, Nature 392 (1998) 286– 289. [23] E. Okuda-Ashitaka, S. Ito, Nocistatin: a novel neuropeptide encoded by the gene for the nociceptin/orphanin FQ precursor, Peptides 21 (2000) 1101–1109. [24] A.A. Jensen, J.L. Hansen, S.P. Sheikh, H. Bräuner-Osborne, Probing intermolecular protein–protein interactions in the calcium-sensing receptor homodimer using bioluminescence resonance energy transfer (BRET), Eur. J. Biochem. 269 (2002) 5076–5087. [25] N.A. Taylor, W.J.M. Vandeven, J.W.M. Creemers, Curbing activation: proprotein convertases in homeostasis and pathology, FASEB J. 17 (2003) 1215–1227. [26] R.G. Allen, B. Peng, M.J. Pellegrino, E.D. Miller, D.K. Grandy, J.R. Lundblad, C.L. Washburn, J.E. Pintar, Altered processing of pro-orphanin FQ/nociceptin and pro-opiomelanocortin-derived peptides in the brains of mice expressing defective prohormone convertase 2, J. Neurosci. 21 (2001) 5864–5870. [27] A. Zhou, R.E. Mains, Endoproteolytic processing of proopiomelanocortin and prohormone convertases 1 and 2 in neuroendocrine cells overexpressing prohormone convertases 1 or 2, J. Biol. Chem. 269 (1994) 17440–17447.