Monitoring gene expression along pear fruit development, ripening and senescence using cDNA microarrays

Plant Science 167 (2004) 457–469

Monitoring gene expression along pear fruit development, ripening and senescence using cDNA microarrays Sandra Fonseca a , László Hackler, Jr. b , Ágnes Zvara b , S´ılvia Ferreira a , Aladje Baldé a , Dénes Dudits c,∗ , Maria S. Pais a , László G. Puskás b a

c

Plant Biotechnology Laboratory, Institute for Applied Science and Technology, Ed. ICAT, Lisbon 1749-016, Portugal b Laboratory of Functional Genomics, P.O. Box 521, Szeged H-6701, Hungary Institute of Plant Biology, Biological Research Center, Hungarian Academy of Sciences, P.O. Box 521, Szeged H-6701, Hungary Received 8 December 2003; received in revised form 17 March 2004; accepted 22 March 2004 Available online 31 May 2004

Abstract In order to elucidate the molecular events associated with pear (Pyrus communis L. cv. Rocha) fruit development and climacteric ripening, high-density cDNA microarrays were constructed. cDNA clones (1364 total) were isolated from a fruit cDNA library and from a subtractive library and arrayed. The expression of these ESTs was monitored from early fruit development, through ripening, until complete fruit senescence, allowing a global coverage of the entire fruit life. A comparison was made with fruit that failed to ripe (FR) due to precocious harvesting. Based on the similarities in transcript expression profiles ESTs were grouped in different clusters. Transcripts encoding kinases and phosphatases were induced specifically during early developmental stages of pear fruit. Another set of genes was activated at the onset of the climacteric period when fruit softening rates also increased. Among these were transcripts encoding for cell wall modifications and pigment and aroma biosynthesis. Transcripts putatively involved in defence response, oxidative stress, primary and secondary metabolism, signalling and transcription regulation were also isolated. According to our results main changes in expression profiles occur in two phases: the cessation of growth and entrance in the initial maturation stages (pre-climacteric), and the entrance into the climacteric period. © 2004 Elsevier Ireland Ltd. All rights reserved. Keywords: Fruit ripening; Gene expression; Microarray; Pyrus communis; Pear

1. Introduction Fruit development and ripening are complex processes involving major changes in fruit metabolism [1]. Biochemical processes occur in a well-defined order under the control of a large set of ripening-specific genes leading to changes in texture, pigmentation, taste and aroma. Understanding the ripening process in fleshy fruit is a prerequisite for improving fruit quality and storage potential [2]. Pear fruit growth comprises an initial phase of development. When growth ceases, maturation period starts with no evident alterations (pre-climacteric period) until the onset of climacteric period. In climacteric fruit, the increase on ethylene production leads to high metabolic rates, a respiratory peak and increased softening (late ripening), ending with tissue senescence [3].

∗

Corresponding author. Tel.: +36-62-599-768; fax: +36-62-432-576. E-mail address: [email protected] (D. Dudits).

Up to now several techniques have been used to evaluate changes in mRNA level during ripening: differential screening of cDNA libraries [4], differential display [5], RNA fingerprinting [6]. Expression analysis of strawberry, a non-climacteric fruit, was performed to study achene and receptacle maturation using DNA microarray technology [7]. DNA microarrays are powerful tools for comprehensive characterisation of different processes and diverse stages of plant development at the transcription level [8]. Gene expression profiling with DNA microarrays in combination with data processing provide basis for grouping genes showing characteristic activity profiles along fruit ripening. In this study, high-density cDNA microarrays were used to provide a global picture of gene expression profiles during pear fruit development and climacteric ripening. The aim of this work is to detect which are the important processes that are changing along the entire fruit life, thus providing a platform for further investigation. Emphasis is given to the climacteric transition and to the softening process, as it is well

0168-9452/$ – see front matter © 2004 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.plantsci.2004.03.033

458

S. Fonseca et al. / Plant Science 167 (2004) 457–469

known that ethylene plays a key role on modulating gene expression programmes and that lack of firmness is a consequence of several metabolic changes. Among the isolated clones, some displayed homology to genes previously characterised as components of ripening-related cellular events in other plant species, while others showed homology with known genes that have not been related to ripening and some other had no homology with known sequences. The microarray data on transcript accumulation were corroborated with real-time quantitative RT-PCR (QRT-PCR). Fruit softening measurements were used as a physiological parameter and were compared to transcript accumulation of cell wall modification enzymes. ␤-Galactosidase activity was assayed to corroborate that high levels of accumulation of these transcripts correspond to an increase on enzymatic activity.

2. Materials and methods 2.1. Plant materials, RNA extraction Fully grown pear fruit (Pyrus communis L. cv. Rocha) of a similar size (evaluated by measuring fruit diameter) were harvested and kept in air at 23 ◦ C for 24 days to ripe. Day 0 fruit (harvesting time, 124 days after floration (DAF)) served as controls. Samples were taken every 3 days. The 21 day-old fruit were overripe and 24 days fruit were completely senescent (inedible fruit), showing deterioration. Small growing fruit were also harvested and named as “G1” (2–3 cm diameter, 60 DAF) and “G2” (4–6 cm, 90 DAF) group. Another group of fruit were collected 15 days before the harvesting day (at 109 DAF) and placed at 23 ◦ C for 28 days. These fruit failed to ripe (FR). Five to six fruit were sampled from each stage. Fruit mesocarp was frozen in liquid nitrogen, ground using mortar and pestle and stored at −80 ◦ C until RNA extraction. Total RNA was purified according to the hot-borate method [9]. The quantity and the quality of the RNA were assessed by gel electrophoresis and OD260 /OD280 ratios. Total RNA was used for microarray analysis as well as for reverse transcription quantitative PCR. mRNA was purified using PolyATtractTM mRNA Isolation System kit (Promega, Madison, WI) and was used for library construction and subtractive hybridisation.

ground pear mesocarp tissue (10 g) was homogenised in 20 ml cold 0.1 M sodium citrate buffer pH 4.6 containing 1 M NaCl, 3 mM EDTA, 10 mM ␤-mercaptoethanol and 1% (w/v) PVP-40. The supernatant was recovered by centrifugation at 4 ◦ C at 10,000 rpm for 30 min and precipitated overnight with sodium sulphate (Sigma-Aldrich, St. Louis, MO) to 80% saturation. After a 30-min centrifugation at 10,000 rpm, the pellet obtained was dissolved in 2.5 ml sodium citrate buffer and desalted on Sephadex G-25 columns (1 cm × 10 cm). Total protein quantification was performed by Bradford method using the Protein Assay kit (Bio-Rad). ␤-Galactosidase activity was determined using p-nitrophenyl-␤-d-galactopyranoside (Sigma) as substrate. The assay was performed with 200 ␮l enzyme extract, and 4 mg ml−1 substrate in sodium citrate buffer of pH 4.6. After incubation for 40 min at 30 ◦ C, the reaction was terminated by the addition of 500 ␮l of sodium carbonate. The absorbance of free p-nitrophenol was determined by measuring its absorbance at 420 nm. Data were obtained from triplicate assays for each sample. 2.4. Microarray construction

Fruit firmness was evaluated using a portable Fruit Pressure Tester (FT 327) equipped with an 8 mm diameter tip. The values presented correspond to the average of five independent measurements for each developmental or ripening stage.

A pear fruit cDNA library was constructed with ZAP Express cDNA synthesis and ZAP Express cDNA Gigapack III Gold cloning kits (Stratagene) and a subtracted library was constructed using the PCR-select cDNA subtraction kit (Clontech, Palo Alto, CA) (pool of mRNA from days 12 to 24 was the tester and mRNA extracted from day 0 was the driver). Randomly chosen clones were amplified by PCR and those having a length over 300 bp were selected (982 from the ZAP Express library and 382 from the subtracted library). cDNAs which expression was previously accessed by Northern blot hybridisation (␤-galactosidase, expansin and polygalacturonase; data not shown) have been also spotted as well as ␤-actin, serving as internal controls. Construction and use of microarrays were performed following the minimum information about a microarray experiment (MIAME) guidelines [11] and the detailed protocol was described in [12]. Altogether, the 1364 amplified cDNA inserts were purified with MultiScreen-PCR plate (Millipore), resuspended in 50% (v/v) dimethylsulphoxide:water, and arrayed on amino-silanized slides (Sigma-Aldrich) by using a MicroGrid Total Array System (BioRobotics, Cambridge, UK) spotter with 16 pins in a 4 × 4 format. DNA elements were deposited in duplicate. The diameter of each spot was approximately 200 ␮m. After printing, DNA was UV cross-linked to the slides (Stratagene, Stratalinker, 700 mJ). Prior to hybridisation, the slides were blocked in 1× SSC, 0.2% SDS, 1% BSA for 30 min at 42 ◦ C, rinsed with water and dried.

2.3. Measurement of β-galactosidase activity

2.5. Microarray probe preparation and hybridisation

␤-Galactosidase was extracted following a protocol based on that reported by Lazan et al. [10] for papaya. Briefly,

Total RNA of 30 ␮g from each sample was amplified by a linear antisense RNA amplification method, and labelled

2.2. Fruit firmness measurements

S. Fonseca et al. / Plant Science 167 (2004) 457–469

with Cy3 or Cy5 fluorescent dye during reverse transcription as described previously in [13]. Briefly, 2.5 ␮g of amplified RNA was labelled in a reaction, which contained 0.4 ␮M random nonamers, 0.1 mM d(G/T/A)TPs, 0.05 mM dCTP (Amersham Pharmacia Biotech, UK), 20 Unit RNAsin (Fermentas, Vilnius, Lithuania), 1× first strand buffer, 200 Units of RNAse H (−) point mutant MMLV reverse transcriptase (Fermentas), and 0.05 mM Cy3-dCTP or Cy5-dCTP (NEN Life Science Products, Inc., Boston, MA) in 20 ␮l total volume. The RNA, primer and RNasin were denatured at 80 ◦ C for 5 min and cooled on ice before adding the remaining reaction components. After 2 h of incubation at 37 ◦ C, the heteroduplexes were purified as described in [14], denatured and the mRNA was hydrolysed with NaOH for 15 min at 37 ◦ C and neutralised with MOPS (pH 6.0). The labelled cDNA was purified with a PCR purification kit (Macherey-Nagel) according to the manufacturer’s instructions. Probes generated from the control (day 0) and samples from different developmental and ripening stages were mixed, dissolved in 15 ␮l hybridisation buffer (50% formamide, 5× SSC, 0.1% SDS, 100 mg ml−1 salmon sperm DNA) and applied onto the array after denaturation by heating for 1 min at 90 ◦ C. The slide was covered by a 24 mm × 32 mm coverslip, and sealed with DPX Mountant (Fluka, Buchs, Switzerland) in order to prevent evaporation. Slides were incubated at 42 ◦ C for 20 h in a humidified hybridisation chamber. After hybridisation the mountant was removed and the arrays were washed [13]. Dye-swapping experiments were done, i.e., RNA samples were labelled reciprocally with Cy3 and Cy5 dyes, for comparing experiment reproducibility. 2.6. Scanning and data analysis Each array was scanned under a green laser (532 nm) (for Cy3 labelling) and under a red laser (660 nm) (for Cy5 labelling) by using a ScanArray Lite (GSI Lumonics, Billerica, MA) scanning confocal fluorescent scanner with 10 ␮m resolution. Image analysis was performed using the ScanAlyze2 software (available at http://www.microarrays.org/software.html). Each spot was

459

defined by manual positioning of a grid of circles over the image. Spots presenting high intensity due to dust particles or other artefacts were flagged manually. The average signal intensities of the replica spots were determined after subtraction of the local background intensities. A measure (MRAT, denotes the median of the set of background-corrected single pixel intensity ratios of the two channels for all pixels within the spot) was determined [15]. This expression ratio for all genes on the array was normalised to 1.0 applying global normalisation. For background corrections those data were calculated as negatives where the average intensity of the spot was smaller than two times of the average background of the same area. Those results were also excluded where the replicate spots from a different site of the same array or results from the replicate experiments were significantly different. From each time point a replica experiment was performed and the average ratio was used for cluster analysis. Those genes were regarded as differentially expressed, which expression showed twofold increase or decrease compared to day 0 samples. Hierarchical clustering and visualisation of plot diagrams were performed with the OmniViz v2.5 Gene-Expression software (OmniViz Inc., Maynard, MA) using complete linkage hierarchical clustering by magnitude and shape (Euclidean) similarity metric. 2.7. Real-time quantitative PCR Relative quantitative reverse transcription-PCR was performed on a RotorGene 2000 instrument (Corbett Research, Sydney, Australia) with gene-specific primers and SybrGreen detection to confirm the gene expression changes observed by microarrays. Total RNA of 20 ␮g from each pool was reverse transcribed in the presence of poly(dT) sequences in a total volume of 20 ␮l. After dilution with 80 ␮l of water, 2 ␮l of the diluted reaction mix was used as template in QRT-PCR. The 20 ␮l reaction volume contained 0.2 mM dNTP, 1× PCR reaction buffer (ABGene, Epsom, UK), 6 ␮M of each primer, 4 mM MgCl2 , 1× SYBR Green I (Molecular Probes, Eugene, OR) in final concentration, and 0.5 units of thermostart Taq DNA polymerase (ABGene). The amplification was carried out with the following cycling

Table 1 Primers used in QRT-PCR analysis Gene product

Forward primer

Reverse primer

␤-Actin Adenosine triphosphatase Epoxide hydrolase Endochitinase Polyphenol oxidase O-methyltransferase Thaumatin-like protein APRT PGIP Polygalacturonase Glycosyltransferase

CCAATTTATGAAGGGTATGCCC TTGGCGATGCCGGTGT TGCCTGTTCCGGCCTG GACGGCGTTGATTTCGACA CGACGACGATCCACGTAGCT TGCACTGTGTTTGACCAGCC GTCATCAGTTGCAAAAGCGC GAGGGTTTATATTTGGCCCTCC CTCCACCACAAACCGCATT GGCCAATTGAATTCTCAGGC TCGTCTGTGTTAACGGCTTGA

GTAAGATCACGACCTGCCAGG TGAGAATCAGAATCATGCCAACA CGGCATGAACTGCACGC ACCTGGCGAGCTCATCATAGA CCGTCGCAATAAGCGCA AACCCAAATTGTGGGTCGTC CGGCGGAGTGCAGCAG TTTCCTCATGGGCACAAATTT GGGATTTGGCCTGACACCT TCGGTCTTCTGATGCTTCTATGG CATGCTACCAAGTCTTGATTAAAAATCT

460

S. Fonseca et al. / Plant Science 167 (2004) 457–469

parameters: 60 s hot start, 45 cycles of denaturation at 95 ◦ C for 25 s, annealing at 58 ◦ C for 30 s and extension at 72 ◦ C for 25 s. Fluorescence detection was performed at 72 ◦ C. The PCR primers used were designed to amplify a 70–90 bp long fragment and are listed in Table 1. Relative expression ratios were normalised to ␤-actin. Harvesting day samples served as control samples. Results were calculated with delta–delta Ct method. Each QRT-PCR experiment was repeated three times and the average results of those reactions were reported, where the melting curves were single peaks.

3. Results 3.1. Microarray experimental design and clustering of differentially expressed genes Pear fruit specific cDNA microarrays containing a total of 1364 ESTs, printed in duplicate spots, were used to identify genes activated during fruit development and ripening. Of those ESTs, 982 clones were randomly selected from a fruit cDNA library prepared using fruit at different developmental and maturation stages. The remaining 382 clones were selected from a subtracted library enriched with ripening-specific cDNAs. For each time point hybridisations were made against time zero, the harvesting day. The transcript level for each cDNA was calculated as the average intensity of the two replicas in the same slide. Ratios below 1.0 were inverted and multiplied by −1 for easier data interpretation [16]. Those genes were regarded as differentially expressed, whose expression showed twofold increase or decrease compared to day 0 samples. Out of 1364 clones, 362 exhibited differential expression along development or ripening when compared to the control. After sequence analysis and homology search, 130 unique sequences, exhibiting differential changes in expression during fruit growth and ripening were clustered. To divide the gene expression dataset into groups of observations that are similar to each other, agglomerative hierarchical clustering was applied. The employed method was the group average method. Euclidian metric (root sum-of-squares of differences) was used to calculate the dissimilarities between observations [15]. Five different clusters were defined (Fig. 1). Cluster I contains genes showing decreased expression levels in all the stages (Fig 1.I). Cluster II includes genes showing high gene ex-

pression levels in growing stages. The expression is maximal at the initial growing phase (G1) decreasing to negative values during ripening stages (Fig 1.II). Cluster III contained ESTs that showed increased levels of expression in all the stages of fruit development and ripening. The expression of these ESTs increased after day 12, until day 24. Cluster IV comprise genes with expression levels increased after day 12 until day 24. The expression levels of the genes of this cluster did not change neither in growing stages nor at initial ripening stages, or in FR fruit. Genes grouped in cluster V (Fig. 1.V) presented no significant variation in their expression levels in growing fruit, decreased expression in initial maturation stages (since day 3 until day 12) and in FR fruit, but showed to be activated from day 15 until day 24. The major expression differences among clustered ESTs were observed between stage G2 and day 3 after harvesting, corresponding to the period when growth ceases and maturation starts; and between days 12 and 15, that is when ACC oxidase (ACO) transcription is activated suggesting the climacteric period started. The gene expression profiles observed in FR fruits often show similarities to that of initial maturation stages (pre-climacteric). 3.2. Data validation The β-galactosidase (β-gal), polygalacturonase (PG), expansin1 (Exp1) genes were previously characterised by Northern blotting hybridisation during the ripening process (data not shown). These genes were used as internal controls and their expression increased during ripening according to the Northern blot results. Real-time PCR was used to confirm the differential expression ratios of several genes randomly selected from different clusters. Primers used for amplification are listed in Table 1. In Fig. 2 expression data from microarray and real-time PCR were compared. For the genes analysed, a similar expression pattern was obtained along the process, although most of the real-time PCR values are higher than those obtained by microarrays, a common phenomenon when these techniques are compared. This might be due to probe saturation in the array, or to cross-hybridisation among related genes that is possible to occur in microarray but not in real-time PCR experiments. These results confirm that above the significance threshold of twofold expression change the microarray data is reliable.

Fig. 1. Hierarchical cluster analysis [15] (using OmniViz v2.5 Gene-Expression software) of transcript levels from genes differentially expressed during fruit development and ripening of pear fruit G1 and G2 are two stages of growing fruit, 3–24 correspond to days after harvesting, and FR to fruit that failed to ripe due to precocious harvesting. Each box represents the temporal expression pattern of an EST in a determined stage of fruit development or ripening; each row represents the expression profile of a single EST during the whole fruit development and ripening stages. Any colour other than yellow means a significant change in expression of an individual gene compared to the expression at time 0 (immediately after harvesting). Red boxes mean high levels of expression compared to time zero, and green boxes mean lower expression levels. Putative gene products (determined from blast homology search results using http://www.ncbi.nlm.nih.gov webpage) and accession numbers of ESTs deposited in the database are also listed. Coloured bars indicate genes, which belong to the five determined cluster (plot diagram I–V). Plot diagrams of five clusters (I–V) with average values (bold line) and standard deviation (grey area) of the expression levels of the selected genes are also presented. In these diagrams “y” axis represents gene expression ratio and “x” axis the stages of fruit development and ripening. “G1” and “G2” refer to different growth stages.

S. Fonseca et al. / Plant Science 167 (2004) 457–469

461

462

S. Fonseca et al. / Plant Science 167 (2004) 457–469

Fig. 2. Comparison of real-time PCR and DNA-microarray analysis. Open squares (䊐) show real-time PCR and open circles (䊊) show microarray data. The values are expressed as log2 of fold change compared to day 0. Transcripts above or below the dashed lines (−2 to 2-fold regulation) represent those exhibiting significant changes in expression at a certain time point of ripening. Sample abbreviations used are the same as in Fig. 1.

3.2.1. Induction of genes involved in different metabolic processes along ripening For a clear view and a better interpretation of the results, ESTs were grouped according to their putative role in cell

metabolism taking into account functions reported for gene homologues in other systems (Table 2). Genes involved in a broad range of cellular processes showed increased expression levels either during pear fruit development or ripening processes. Among these we found genes involved

S. Fonseca et al. / Plant Science 167 (2004) 457–469

463

Table 2 Isolated transcripts are grouped according to their putative function or to the mechanism to which they have been related

Coloured bars represent expression profiles during fruit growth (G1 and G2), ripening (3–24, days after harvesting, day 24 corresponding to completely senescent fruit) and in fruit that did not ripe due to a precocious harvesting (FR).

464

S. Fonseca et al. / Plant Science 167 (2004) 457–469

in sugar and fatty acid metabolism, in pigment and aroma biosynthesis and in cell wall modifications. ACO coding transcript was isolated, providing a clue on the onset and progression of the climacteric ripening. Several transcripts that have been described as coding for enzymes that play a role in defence response against pathogen attack have also been isolated and were highly activated during the latest ripening stages (from day 15 to day 24). Genes usually classified as responsive to ABA stress [abscisic stress ripening, ABA responsive, pyrroline-5-carboxylate synthetase] to cold/drought stress [dehydrin and cold responsive protein (closest homology (AF044584))] and to oxidative stress [polyphenol oxidase and manganese superoxide dismutase] were also isolated. Other genes involved in regulatory and signalling processes were identified. Some of them have not been previously related to ripening. A total of 47 ESTs having no homology with described sequences are reported. Fruit softening occurs in parallel with ripening. Firmness measurements were used as a rapid way to access the progression of softening and to monitor concomitant fruit ripening (Fig. 3). Firmness is higher in growing fruit and decreases slightly (from 8.8 to 8.4 kg) from harvesting until day 12 (pre-climacteric period). At day 15, the firmness abruptly decreases (to 1.6 kg) presenting values close to 0 at day 18. Transcripts coding for cell wall modification enzymes were higher, especially after day 12, the period where softening rates are higher, though a temporal sequence can be seen in their induction (Fig. 3). Polygalacturonase (PG), ␤-galactosidase (␤-gal), endopolygalacturonase (endoPG), expansin (Exp), ␤-d-xylosidase (XYL), xyloglucan endo-transferase (XET) transcripts were isolated. ␤-gal activity assays showed that enzyme activity gradually increases since the harvesting day, although the higher activity level was detected at day 18 and day 21, in the latest ripening stages. Activity abruptly decreases in

Fig. 4. ␤-Galactosidase activity of proteins extracted from different stages of fruit growth (G1 and G2) and ripening (3–24) and from fruits that failed to ripe (FR).

senescent fruits (day 24) (Fig. 4). FR fruit remained hard (6.0 kg) and acquired a rubber texture. Their firmness is similar to that of fruit in initial maturation stages. The gene expression profiles of FR fruit present marked differences when compared to fruit that ripe normally. This behaviour suggests that ripening triggering did not occur in fruit harvested at a precocious developmental stage.

4. Discussion The aim of this study was to obtain a preliminary and global overview on fleshy fruit development and climacteric ripening gene expression and try to understand which processes are implicated at each stage. The advantage of the use of microarray analysis is to access, in a single experimental step, the expression of a wide range of genes involved in many different processes, in a normalised and calibrated way. Temporal gene expression profiling allows the detection of transient induction of gene expression along a process, although it has to be considered that microarray data report on relative gene expression. Therefore, the data should not be taken as a direct reflection of gene expression levels. 4.1. Ethylene on climacteric fruit ripening

Fig. 3. Firmness and expression profiles of genes coding for cell wall modification enzymes. G1, G2: growing fruit; numbers from 3 to 24 correspond to days after harvesting and FR to fruit that failed to ripe due to precocious harvesting.

Climacteric fruit ripening is characterised by a respiratory peak with concomitant ethylene production. The ethylene burst is autocatalytic and accelerates the ripening process by affecting the transcription and translation of many ripening-related genes. Many components of biochemical pathways involved in cell wall, sugar and fatty acids metabolism, pigmentation, volatile production and signal transduction have been identified as being affected by ethylene production (reviewed by Alexander and Grierson [17]). The expression profile of the gene encoding 1-aminocyclopropane-1-carboxylate oxidase (ACO), the enzyme that catalyses the last step in the ethylene biosynthesis pathway was characterised (Table 2). The gene is activated at day 15, suggesting the onset of ethylene burst and the beginning of the climacteric period, and remained active until day 24, when the fruit were in an advanced

S. Fonseca et al. / Plant Science 167 (2004) 457–469

senescent stage. In FR fruit no increase in ACO expression was detected, suggesting that these fruit did not enter in the climacteric process. This result might explain the similarities between FR fruit gene expression profiles and those of fruit 3 to 9 days after harvesting, before the climacteric rise (Fig. 1). The ACO gene has been characterised as a key regulator of ripening, senescence and defence signalling processes [17]. It is not surprising that, during pear fruit ripening, the greatest changes in global gene expression are concomitant with an increased ACO expression. However, further studies are needed to differentiate which members of the ACO gene family are affected during ripening. 4.2. Primary metabolism, energy production and transfer during ripening Primary metabolism includes a broad range of vital processes for the cell maintenance as energy production and generation of metabolites that can be redirected for diverse pathways. Several genes putatively involved in energy production or transfer were induced during ripening. Adenine phosphoribosyltransferase (APRT) catalyses the conversion of adenine and cytokinin bases to the corresponding nucleotides. It has been suggested that APRT plays a role in adenine salvage in the methionine cycle in barley roots. Methionine is converted to S-adenosyl-methionine (SAM) that can be decomposed into MTA (5 -methylthioadenosine) which enters the methionine cycle for recycling the carbon of the ribosyl group, releasing adenine that can be rescued by APRT [2] (reviewed by Wang et al. [18]). The APRT gene was highly activated at day 15 and its expression slightly decreased as fruit enters senescence (Table 2). Twelve days after harvesting the gene encoding a V-type adenine triphosphatase (V-ATPase) was also activated (Fig. 1). As previously reported by other authors (reviewed by Nelson and Harvey [19]), V-ATPases have one primary function: to couple hydrolysis of ATP to H+ translocation across biological membranes. Plasma membrane V-ATPases are involved in energy transfer reactions, can energise the membrane, regulate intracellular pH, and bring about extracellular acidification or alkalinisation. As far as we know, the 4-hydroxyphenylpyruvate dioxygenase (HPPDase) gene has been isolated from fruit tissues for the first time. It shows a gradual increase in expression at the transition to the climacteric period (from day 12 to day 18) (Table 2). HPPDase catalyses a common initial step of the biosynthesis of plastoquinone and tocopherol, which are essential elements of the photosynthetic electron-transfer chain and of the antioxidative system, respectively [20]. The cytosolic isoform of ␤-phosphoglucomutase catalyses the readily reversible interconversion of Glc-1-P and Glc-6-P, providing intermediates for glycolysis and substrate for the synthesis of a variety of cellular constituents [21]. The high expression levels of ␤-phosphoglucomutase gene at the onset of the climacteric period (days 15 and 18) (Table 2) is concomitant with the

465

increased metabolism in fruit ripening tissues, revealed by an oxidative and respiratory burst. Fatty acid ␤-oxidation is responsible for the mobilisation of storage lipids that can ultimately be converted to sucrose and can also provide a respiratory substrate under carbohydrate starvation conditions. 3-Ketoacyl-CoA thiolase (thiolase) catalyses fatty acid breakdown. The thiolase gene was activated from day 12 until day 15, at the onset of the climacteric peak (Table 2). A pear gene coding for a putative jasmonic acid protein (JA2) showed an expression profile similar to that of the thiolase gene (Table 2). The induction of JA2 transcript started at day 12, before the ethylene peak. There is evidence that JA might interact with the ethylene signal transduction pathway in triggering plant defence responses [18,22]. In plants, epoxide hydrolase has been related to defence responses [23] being induced by ethylene [24]. Epoxide hydrolase gene was activated with the onset of the climacteric period and its expression was higher during the latest ripening phase (from day 15 to day 24) (Table 2). Like other genes grouped in pathogenesis related category, pear non-specific lipid transfer protein (nsLTP) gene was highly expressed markedly during the later ripening stages (Table 2). A role in defence response has also been proposed for nsLTP. nsLTP expression can be induced either by ABA or by other types of stresses [25]. 4.3. Secondary metabolism, the development of colour and aroma Cyanogenic glycosides are important compounds for nitrogen storage in plants. When hydrolysed these compounds give rise to prussic acid that is extremely toxic due to the inhibition of cytochrome oxidase in the final step of the respiratory chain. This poison can be used as an efficient defence mechanism against herbivory [26]. Amygdalin is a cyanogenic glycoside common in rosaceae family species. Amygdalin hydrolase (AH) has been detected in Prunus seeds [27], but as far as we know the gene was never isolated from fruit mesocarp. In pear, AH is induced simultaneously with the onset of the climacteric period. In FR fruit this gene presents low expression (Table 2). The high expression levels of AH from day 15 until day 24, suggest that HCN (prussic acid), as well as the derivate cyanide ion (CN− ), are being produced at very high rates. Among ripening-related secondary compounds, volatiles have been recently approached by combining microarray with gas chromatography–mass spectrometry techniques [28]. Fruit specific O-methyltransferase involved in volatile biosynthesis was isolated from strawberry and grape [29,30]. The pear gene encoding O-methyltransferase was induced from the day 12 forward (Table 2), however, the subclass of the methyltransferase gene in the multigene family was not determined. Induced alcohol dehydrogenase (ADH) gene was described in the latest stages of tomato ripening and a role in the interconversion of aldehydes and alcohols was postulated [31]. The expression of the short chain ADH

466

S. Fonseca et al. / Plant Science 167 (2004) 457–469

gene isolated from pear, increased from day 12 until day 24. Recently, it has been shown that in Arabidopsis seeds a short chain ADH catalyses the last step of ABA biosynthesis. The pear gene encoding pyruvate decarboxylase is induces strictly in the late ripening phase, with a pattern similar to the short chain ADH (Table 2). Biochemical studies showed a significant increase in pyruvate decarboxylase activity during the ripening of orange, pear and grape, concomitantly with the induction of ethanol production [32]. It is interesting to note that genes putatively involved in aroma biosynthesis during pear fruit ripening were not induced in the FR fruit which did not evolve the characteristic flavour of the ripe pear. Another class of genes, which are expected to be specifically activated during ripening, are those that control pigmentation. In pear, the gene encoding capsanthin-capsorubin synthase was induced only during ripening and the most abundant mRNA levels were detected from day 15 until day 18 after harvesting (Table 2). This gene specifically controls the red colour of the fruit [33]. 4.4. Signal transduction and regulatory genes during fruit growth and ripening Although MAP-kinase cascades are known to be involved in ethylene signal transduction pathways during fruit ripening, they regulate many other cellular processes related to cell division or cell maintenance. This might explain why, in pear, the expression of several kinase and phosphatase genes was much higher in fruit developmental stages than during fruit ripening (Table 2). This result suggests that although these genes can be active in ripening, their expression is much higher during fruit developmental stages. Among this class of genes, genes encoding a MAP-kinase-like protein, a casein kinase II, a serine/threonine protein kinase and a serine/threonine protein phosphatase have been isolated. Cell cycle progression in eukaryotes is regulated by cyclins [34]. A gene coding Cyclin a2 was induced in growing fruit in which some cells are still dividing, but not in fully developed fruits. Putative regulatory gene sequences coding for bZIP protein (basic region-leucine zipper), putative RING zinc finger protein, ABI3-interacting protein 2 and leucine-rich repeat were isolated. bZIP gene expression levels decreased during all the stages of fruit development and ripening (Table 2), while the other genes were induced in the later ripening stages. Little is known about the role of these transcription factors in fruit ripening or development although bZIP and ABI3 proteins have been considered to be involved in ABA-regulated signalling in seeds and seedlings [35]. 4.5. Defence and stress responsive genes Several mechanisms of response to biotic or abiotic stresses are part of the fruit ripening programme. Genes encoding metallothionein-like protein, polygalacturonase

inhibitor, thaumatin-like protein, ribonuclease PR-10b, ␤-1,3-glucanase, chitinase class V and endochitinase III represent another class of genes activated along fruit ripening that are usually related to the defence mechanisms triggered by pathogens (Table 2). The enhanced expression of defence genes in the later stages of ripening can be explained by the finding that promoters of these genes contain an ethylene inducible GCC-box [36]. Among the stress responsive genes two chaperonin coding genes (hsp60) were induced during pear ripening but not during fruit growth (Table 2). Previously, the expression of a small heat-shock protein has been correlated with seed maturation and fruit ripening [37] suggesting that other chaperonines might have a function in protein protection during ripening associated stresses. Ripening-specific expression was also observed for genes coding for enzymes involved in detoxification of reactive oxygen species: methionine sulphoxide reductase, polyphenol oxidase, oxidoreductase, manganese superoxide dismutase (Table 2). Three novel cDNAs related to ABA response were isolated coding for two abscisic acid induced stress proteins and an ABA responsive protein. The induction of these genes occurs during the onset of the climacteric period (Table 2). It is not known whether the activation of these genes reflect an increased ABA activity in this stage of fruit ripening, or whether these genes are induced by ethylene, as there is evidence that signalling pathways of ABA and ethylene might be interlinked [38]. The mRNA of the pyrroline-5-carboxylate synthase gene also accumulated at this stage. This enzyme controlling the rate-limiting step of glutamate-derived proline biosynthesis is induced in response to water stress and salinity, its transcription is regulated by ABA signalling [39]. Our data suggests, for the first time, the involvement of pyrroline-5-carboxylate synthase on ripening processes. Regulation of membrane vesicle trafficking by ABA is one of the early events in ABA signalling and might be linked to ion channel activities (reviewed by Rock [40]). An ABA regulated, annexin-like protein, possibly involved in plasma membrane exocytosis and endocytosis was previously characterised [41]. A high expression of a gene during the late ripening pear stages encodes for a soluble NSF attachment protein was detected (Table 2). This finding suggest a role in vesicle trafficking to the cell wall, which is very likely during strong cell wall modifications, like in the time of accelerated softening [42]. 4.6. Cell wall modifications and fruit softening Fruit softening is a result of changes in texture that are believed to result from disassembly and rearrangement of the primary cell wall. This includes modifications of the structure and composition of the constituent polysaccharides that have been correlated with the expression of a range of hydrolases and transglycosilases [43]. Genes encoding PG, ␤-gal, Exp1, XYL, XET, endoPG were found to be differ-

S. Fonseca et al. / Plant Science 167 (2004) 457–469

entially expressed in this study. Although the majority of them could be detected during all the stages of fruit development, including in FR fruit, their expression increased with the onset of the climacteric period and during later ripening stages, when fruit firmness decreases dramatically (Fig. 3). Genes encoding XET and ␤-gal are the first to be induced, still in the pre-climacteric period, before the onset of ACO induction, concomitantly with firmness decreasing. The induction of XET is lower compared to the other transcripts, although relative expression levels rise significantly from growing stages. These results are different from those reported on kiwi fruit ripening. Namely, XET is very active in young fruit, its activity decreases thereafter during early fruit maturation stages and is induced again during ripening [44]. XETs are involved in xyloglucan turnover by catalysing the cleavage and re-ligation of xyloglucan molecules [45]. ␤-gal gene is induced immediately after harvesting. Its expression levels further increase with the onset of the climacteric period. ␤-gal activity shows that there is a correlation between transcript synthesis and enzyme activity that increases during the progression of softening (Fig. 4). ␤-gal hydrolyses the terminal ␤-d-galactosyl residues from cell wall polymers, as well as from galactoproteins and galactolipids [46]. At the beginning of the climacteric period the expression of PG, XYL and Exp1 genes increased. PG expression is high until the fruit tissue is completely degraded (day 24) (Fig. 3). In tomato PG gene promoter is induced by ethylene [47]. PG is considered to be the main enzyme of pectin depolymerisation and solubilisation during ripening by catalysing the hydrolytic cleavage of galacturonide linkages. However, several studies have shown that PG is neither necessary nor sufficient for fruit softening [1,48]. ␤-d-xylosidases degrade xylan or arabinoxylan (by hydrolysing ␤-1,4-d-xylopyranosyl linkages) in hemicellulose. XYL has been previously isolated from Japanese pear [49]. Its expression pattern is similar to that of Rocha pear XYL, increasing at the climacteric and then slightly decreasing through the later stages of ripening. Expression data obtained by microarray analysis showed very low levels of Exp1 transcript accumulation during fruit growth followed by gradual induction along ripening with a peak at days 15 and 18 (Fig. 3). In in vitro assays expansins promote cell wall loosening by a reversible disruption of hydrogen bonds between hemicellulose and cellulose microfibrils suggesting that they facilitate the accessibility of non-covalently bound polymers to endogenous enzymatic degradation [50]. Our results on pear showed that several cell wall modification enzymes acting on different cell wall polymers are induced in temporally different manner along pear fruit ripening. Further investigation is needed to highlight the mechanism of regulation of these enzymes and to check whether a common regulation does exist and, in this case, if it is under ethylene action. As far as we know this is the first study surveying large-scale gene expression along all the process of fruit growth, ripening and senescence. In this study we reported on changes in the expression of genes that act at different

467

levels, such as primary metabolism, signalling, stress responses, pigmentation and aroma biosynthesis and cell wall modifications. Most of the isolated genes showed very different levels of expression between growing and ripening fruit. Several cDNAs with unknown function were isolated and their role in fruit ripening requires further investigation. The data reported provide information for a better understanding of gene expression changes during pear fruit development and ripening processes that appear to be highly coordinated. The knowledge obtained here can be extrapolated to other fruit of the Rosaceae family, which have high economic value in the overall fruit production. The genes identified here are potential targets for future research on the molecular basis of fruit ripening and may yield new traits for development of plants with higher agronomic value. Transcriptional changes listed in this study provide preliminary data on understanding the molecular changes during fruit ripening, additional techniques are needed to explore changes at other levels, such as protein expression, post-translational modification and protein–protein interaction.

Acknowledgements The authors wish to acknowledge the expert technical assistance of Eng. Teixeira de Sousa in the evaluation of the optimal stage for pear collection. This work was mainly supported by the Portuguese Science and Technology Foundation under the Ph.D. fellowship of PRAXIS XXI, SFRH/BD/833/2000 and partly supported by Hungarian National Scientific Research Foundation (OTKA) Grant F034637. References [1] R.L. Fischer, A.B. Bennett, Role of cell wall hydrolases in fruit ripening, Annu. Rev. Plant Physiol. Plant Mol. Biol. 42 (1991) 675– 703. [2] A. Itai, K. Tanabe, F. Tamura, T. Tanaka, Isolation of cDNA clones corresponding to genes expressed during fruit ripening in Japanese pear (Pyrus pyrifolia Nakai): involvement of the ethylene signal transduction pathway in their expression, J. Exp. Bot. 51 (2000) 1163–1166. [3] C.J. Brady, Fruit ripening, Annu. Rev. Plant Physiol. 38 (1987) 155– 178. [4] Y.W. Nam, L. Tichit, M. Leperlier, B. Cuerq, I. Marty, J.M. Lelievre, Isolation and characterization of mRNAs differentially expressed during ripening of wild strawberry (Fragaria vesca L.) fruit, Plant Mol. Biol. 39 (1999) 629–636. [5] H. Zegzouti, B. Jones, P. Frasse, C. Marty, B. Maitre, A. Latch, J.C. Pech, M. Bouzayen, Ethylene-regulated gene expression in tomato fruit: characterization of novel ethylene-responsive and ripening-related genes isolated by differential display, Plant J. 18 (1999) 560–589. [6] C.S. Jones, H.V. Davies, M.A. Taylor, Profiling of changes in gene expression during raspberry (Rubus idaeus) fruit ripening by application of RNA fingerprinting techniques, Planta 211 (2000) 708– 714.

468

S. Fonseca et al. / Plant Science 167 (2004) 457–469

[7] A. Aharoni, A.P. O’Connell, Gene expression analysis of strawberry achene and receptacle maturation using DNA microarrays, J. Exp. Bot. 53 (2002) 2073–2087. [8] A. Aharoni, O. Vorst, DNA microarrays for functional plant genomics, Plant Mol. Biol. 48 (2002) 99–118. [9] C.Y. Wan, T.A. Wilkins, A modified hot borate method significantly enhances the yield of high-quality RNA from cotton (Gossypium hirsutum), Anal. Biochem. 223 (1994) 7–12. [10] H. Lazan, M.K. Selamat, Z.M. Ali, Beta-galactosidase, polygalacturonase and pectinesterase in differential softening and cell wall modification during papaya fruit ripening, Physiol. Plant. 95 (1995) 106–112. [11] A. Brazma, P. Hingamp, J. Quackenbush, G. Sherlock, P. Spellman, C. Stoeckert, J. Aach, W. Ansorge, C.A. Ball, H.C. Causton, T. Gaasterland, P. Glenisson, F.C. Holstege, I.F. Kim, V. Markowitz, J.C. Matesse, H. Parkinson, A. Robinson, U. Sarkans, S. Schulze-Kremer, J. Stewart, R. Taylor, J. Vilo, M. Vingron, Minimum information about a microarray experiment (MIAME)-towards standards for microarray data, Nat. Genet. 29 (2001) 365–371. [12] K. Kitajka, L.G. Puskas, A. Zvara, L. Hackler Jr., G. Barcelo-Coblijn, Y.K. Yeo, T. Farkas, The role of n-3 polyunsaturated fatty acids in brain: modulation of rat brain gene expression by dietary n-3 fatty acids, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 2619–2624. [13] L.G. Puskas, A. Zvara, L. Hackler Jr., P. van Hummelen, RNA amplification results in reproducible microarray data with slight ratio bias, Biotechniques 32 (2002) 1330–1340. [14] L.G. Puskas, L. Hackler Jr., G. Kovacs, Z. Kupihar, A. Zvara, T. Micsik, P. van Hummelen, Recovery of cyanine-dye nucleotide triphosphates, Anal. Biochem. 305 (2002) 279–281. [15] M.B. Eisen, P.T. Spellman, P.O. Brown, D. Botstein, Cluster analysis and display of genome-wide expression patterns, Proc. Natl. Acad. Sci. U.S.A. 95 (1998) 14863–14868. [16] T. Girke, J. Todd, S. Ruuska, J. White, C. Benning, J. Ohlrogge, Microarray analysis of developing Arabidopsis seeds, Plant Physiol. 124 (2000) 1570–1581. [17] L. Alexander, D. Grierson, Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening, J. Exp. Bot. 53 (2002) 2039–2055. [18] K.L. Wang, H. Li, J. Ecker, Ethylene biosynthesis and signaling networks, Plant Cell 14 (2002) S131–S151. [19] N. Nelson, H.R. Harvey, Vacuolar and plasma membrane proton adenosinetriphosphatases, Physiol. Rev. 79 (1999) 361–385. [20] I. Garcia, M. Rodgers, C. Lenne, A. Rolland, A. Sailland, M. Matringe, Subcellular localization and purification of a p-hydroxyphenylpyruvate dioxygenase from cultured carrot cells and characterization of the corresponding cDNA, Biochem. J. 325 (1997) 761–769. [21] C. Periappuram, L. Steinhauer, D.L. Barton, D.C. Taylor, B. Chatson, J. Zou, The plastidic phosphoglucomutase from Arabidopsis. A reversible enzyme reaction with an important role in metabolic control, Plant Physiol. 122 (2000) 1193–1199. [22] P.J. Eastmond, I.A. Graham, The multifunctional protein AtMFP2 is co-ordinately expressed with other genes of fatty acid ␤-oxidation during seed germination in Arabidopsis thaliana (L.) Heynh, Biochem. Soc. Trans. 28 (2000) 95–99. [23] S. Bellevik, J. Zhang, J. Meijer, Brassica napus soluble epoxide hydrolase (BNSEH1), Eur. J. Biochem. 269 (2002) 5295– 5302. [24] M. Arahira, V.H. Nong, K. Udaka, C. Fukazawa, Purification, molecular cloning and ethylene-inducible expression of a soluble-type epoxide hydrolase from soybean (Glycine max [L.] Merr.), Eur. J. Biochem. 267 (2000) 2649–2657. [25] M.B. Trevino, M.A. O’Connell, Three drought-responsive members of the nonspecific lipid-transfer protein gene family in Lycopersicon pennellii show different developmental patterns of expression, Plant Physiol. 116 (1998) 1461–1468.

[26] H.-W. Heldt, The function of secondary metabolites in plants, in: Plant Biochemistry and Molecular Biology, Oxford University Press, 1997, 353 pp. [27] J.E. Poulton, C.P. Li, Tissue level compartmentation of (R)-amygdalin and amygdalin hydrolase prevents large-scale cyanogenesis in undamaged Prunus seeds, Plant Physiol. 4 (1994) 29–35. [28] A. Aharoni, L.C. Keizer, H.J. Bouwmeester, Z. Sun, M. AlvarezHuerta, H.A. Verhoeven, J. Blaas, A.M. van Houwelingen, R.C. De Vos, H. van der Voet, R.C. Jansen, M. Guis, J. Mol, R.W. Davis, M. Schena, A.J. van Tunen, A.P. O’Connell, Identification of the SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays, Plant Cell 12 (2000) 647–662. [29] M. Wein, N. Lavid, S. Lunkenbein, E. Lewinsohn, W. Schwab, R. Kaldenhoff, Isolation, cloning and expression of a multifunctional O-methyltransferase capable of forming 2,5-dimethyl-4-methoxy3(2H)-furanone, one of the key aroma compounds in strawberry fruit, Plant J. 31 (2002) 755–765. [30] K. Hashizume, K. Tozawa, M. Endo, I. Aramaki, S-Adenosyl-lmethionine-dependent O-methylation of 2-hydroxy-3-alkylpyrazine in wine grapes: a putative final step of methoxypyrazine biosynthesis, Biosci. Biotechnol. Biochem. 65 (2001) 795–801. [31] J. Speirs, E. Lee, K. Holt, K. Yong-Duk, N.S. Scott, B. Loveys, W. Schuch, Genetic manipulation of alcohol dehydrogenase levels in ripening tomato fruit affects the balance of some flavor aldehydes and alcohols, Plant Physiol. 117 (1998) 1047–1058. [32] E. Or, J. Baybik, A. Sadka, A. Ogrodovitch, Fermentative metabolism in grape berries: isolation and characterization of pyruvate decarboxylase cDNA and analysis of its expression throughout berry development, Plant Sci. 156 (2000) 151–158. [33] V. Lefebvre, M. Kuntz, B. Camara, A. Palloix, The capsanthincapsorubin synthase gene: a candidate gene for the y locus controlling the red fruit colour in pepper, Plant Mol. Biol. 36 (1998) 785–789. [34] W.L. Hsieh, S.M. Wolniak, Isolation and characterization of a functional A-type cyclin from maize, Plant Mol. Biol. 37 (1998) 121–129. [35] R.R. Finkelstein, S.L. Gampala, C.D. Rock, Abscisic acid signaling in seeds and seedlings, Plant Cell 14 (2002) S15–S45. [36] G. Sessa, Y. Meller, R. Fluhr, A GCC element and a G-box motif participate in ethylene-induced expression of the PRB-1b gene, Plant Mol. Biol. 28 (1995) 145–153. [37] N. Medina-Escobar, J. Cardenas, J. Munoz-Blanco, J.L. Caballero, Cloning and molecular characterization of a strawberry fruit ripeningrelated cDNA corresponding a mRNA for a low-molecular-weight heat-shock protein, Plant Mol. Biol. 36 (1998) 33–42. [38] M. Ghassemian, E. Nambara, S. Cutler, H. Kawaide, Y. Kamiya, P. McCourt, Regulation of abscisic acid signaling by the ethylene response pathway in Arabidopsis, Plant Cell 12 (2000) 1117–1126. [39] N. Strizhov, E. Abraham, L. Okresz, S. Blickling, A. Zilberstein, J. Schell, C. Koncz, L. Szabados, Differential expression of two P5CS genes controlling proline accumulation during salt-stress requires ABA and is regulated by ABA1, ABI1 and AXR2 in Arabidopsis, Plant J. 12 (1997) 557–569. [40] C.D. Rock, Pathways to abscisic acid-regulated gene expression, New Phytol. 148 (2000) 357–396. [41] I. Kovacs, F. Ayaydin, A. Oberschall, I. Ipacs, S. Bottka, S. Pongor, D. Dudits, E.C. Toth, Immunolocalization of a novel annexin-like protein encoded by a stress and abscisic acid responsive gene in alfafa, Plant J. 15 (1998) 185–197. [42] N. Carpita, M. McCann, L.R. Griffing, The plant extracellular matrix: news from the cell’s frontier, Plant Cell 8 (1996) 1451–1463. [43] J. Rose, K.A. Hadfield, J.M. Labavitch, A.B. Bennett, Temporal sequence of cell wall disassembly in rapidly ripening melon fruit, Plant Physiol. 117 (1998) 345–361. [44] A.E. Percy, I.E.W. O’Brien, P.E. Jameson, L.D. Mehon, E.A. MacRae, R. Redgwell, Xyloglucan endotransglycosylase activity during fruit development and ripening of apple and kiwifruit, Physiol. Plant. 96 (1996) 43–50.

S. Fonseca et al. / Plant Science 167 (2004) 457–469 [45] J. Rose, A.B. Bennett, Cooperative disassembly of the cellulosexyloglucan network of plant cell walls: parallels between cell expansion and fruit ripening, Trends Plant Sci. 4 (1999) 176–183. [46] K.C. Gross, C.E. Sams, Changes in cell wall neutral sugar composition during fruit ripening: a species survey, Phytochemistry 23 (1984) 2457–2461. [47] F.J. Nicholass, C.J. Smith, W. Schuch, C.R. Bird, D. Grierson, High levels of ripening-specific reporter gene expression directed by tomato fruit polygalacturonase gene-flanking regions, Plant Mol. Biol. 28 (1995) 423–435.

469

[48] K.A. Hadfield, T. Dang, M. Guis, J.C. Pech, M. Bouzayen, A.B. Bennett, Characterization of ripening-regulated cDNAs and their expression in ethylene-suppressed charentais melon fruit, Plant Physiol. 122 (2000) 977–983. [49] A. Itai, K. Yoshida, K. Tanabe, F. Tamura, A ␤-d-Xylosidase-like gene is expressed during fruit ripening in Japanese pear (Pyrus pyrifolia Nakai), J. Exp. Bot. 50 (1999) 877–878. [50] S. McQueen-Mason, D.M. Durachko, D.J. Cosgrove, Two endogenous proteins that induce cell wall extension in plants, Plant Cell 4 (1992) 1425–1433.