Monokaryotic hyphae germinated from a single spore of the ectomycorrhizal basidiomycete Tricholoma matsutake

m y c o s c i e n c e 5 6 ( 2 0 1 5 ) 2 8 7 e2 9 2

Available online at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/myc

Note

Monokaryotic hyphae germinated from a single spore of the ectomycorrhizal basidiomycete Tricholoma matsutake Hitoshi Murata a,*, Akira Ohta b, Akiyoshi Yamada c, Yuka Horimai c, Shinichiro Katahata d, Muneyoshi Yamaguchi a, Hitoshi Neda a a

Department of Applied Microbiology and Mushroom Science, Forestry & Forest Products Research Institute, 1 Matsunosato, Tsukuba 305-8687, Japan b Shiga Forest Research Center, Yasu, Shiga 978-95, Japan c Department of Bioscience and Biotechnology, Faculty of Agriculture, Shinshu University, Minami-minowa, Nagano 399-4598, Japan d Graduate School of Science and Technology, Shizuoka University, Shizuoka, Surugaku 422-8529, Japan

article info

abstract

Article history:

We document here that monosporous isolates of the ectomycorrhizal basidiomycete Tri-

Received 28 April 2014

choloma matsutake were initially uni- or bi-nucleate. During pure culture, however, many

Received in revised form

uninucleate isolates became multinucleate. While the parent strain had two patterns of

25 August 2014

single nucleotide polymorphisms (SNPs) within its single-copy DNA, 19 of 20 monosporous

Accepted 26 August 2014

isolates exhibited one of the two parent SNPs, and an isolate that was binucleate upon

Available online 25 October 2014

germination had both, indicating the former were monokaryotic and the latter dikaryotic. Of those, two isolates carrying SNPs different from one another have been predominantly

Keywords:

uninucleate for 9 years. These isolates may be useful in genetics/breeding of “matsutake”

Breeding

mushrooms.

Karyotype

© 2014 The Mycological Society of Japan. Published by Elsevier B.V. All rights reserved.

Monokaryon Single nucleotide polymorphism (SNP) Specialty mushrooms

In homobasidiomycetes, monokaryotic basidiospores are generally produced after meiosis in the dikaryotic mycelia that result from mating between two monokaryotic mycelia or between monokaryotic and dikaryotic mycelia. This typical sexual reproduction process has been reported in model

organisms, e.g., Coprinopsis cinerea and Schizophyllum commune, and other saprophytic cultivated mushrooms, e.g., Pleurotus ostreatus and Pholiota nameko (Buller 1931; Raper 1966; Babasaki et al. 2003; Fraser et al. 2007; Lin and Heitman 2007; Raudaskoski and Kothe 2010). Based on this well-

* Corresponding author. Tel.: þ81 29 829 8279; fax: þ81 29 874 3720. E-mail address: [email protected] (H. Murata). http://dx.doi.org/10.1016/j.myc.2014.08.004 1340-3540/© 2014 The Mycological Society of Japan. Published by Elsevier B.V. All rights reserved.

288

m y c o s c i e n c e 5 6 ( 2 0 1 5 ) 2 8 7 e2 9 2

documented mating system, better cultivars of saprophytic cultivated mushrooms have been bred to produce desirable commercial qualities. Tricholoma matsutake is an ectomycorrhizal basidiomycete that associates as a symbiont with Pinaceae plants and produces the prized but yet uncultivable “matsutake” mushrooms in natural habitats (Ogawa 1975; Tominaga 1978; Yamada et al. 2010, 2014). Although genomic information is currently available (JGI; http://genome.jgi-psf.org/ Trima3/Trima3.home.html), the genetics of T. matsutake have not been well elucidated because of difficulty in mating due to the absence of “clamp connections” in the secondary mycelia (see below). In addition, the nuclear phase of the secondary mycelium has not been clarified as a result of unexplained technical difficulty in visualizing nuclei along with septa, unlike in many saprophytic mushrooms, although the species is said to be dikaryotic on the basis of the nuclear phase of the spores (Tominaga 1978). Tominaga (1978) reported that T. matsutake produces both binucleate and uninucleate spores. Hyphal regeneration from T. matsutake spores, however, had not been achieved until a unique spore germination method using organic acids as inducers was established (Ohta 1986a,b, 2006). In fact, no monokaryotic cultures of T. matsutake, which could be useful in genetics and breeding of matsutake, have been available.

The aims of the present study were to (i) isolate monosporous hyphae of T. matsutake and (ii) characterize the nuclear phases of these isolates by both microscopic examination and DNA-based analysis. The ultimate goal was to obtain monokaryons of the symbiotic mushroom. Tricholoma matsutake SF-Tm172 is an isolate from a fruit body harvested from “shiro no. 6” (¼ a rhizospheric colony of T. matsutake) growing at the Kohnan study site, Shiga Prefecture, Japan, on 18 October, 2004 (Murata et al. 2005). Twenty monosporous isolates were obtained from this isolate using a protocol described by Ohta (1986a,b, 2006; Table 1). The spore isolates have been deposited in the Forestry and Forest Products Research Institute (FFPRI) gene bank, Tsukuba, Japan (Table 1). Spores were germinated on F5þBu agar containing crude hot water extracts of P. densiflora leaves (50 g/L), butyric acid (50 mL/L), and agar (8 g/L), then transferred to a standard culture medium using a micromanipulator. Unless stated otherwise, the nuclear phases of monosporous isolates were examined using DAPI staining (1 ppm) and a fluorescence microscope; the fungal hyphae were cultured between an agar medium and a slide glass so that hyphae grew horizontally. Nuclei stained with DAPI lit up in ca. 20e40 cells of the mycelia, but not all of them, when observed at 40 magnification. At least four independent mycelial areas per specimen were examined. Note that T. matsutake barely exhibits septa

Table 1 e Tricholoma matsutake SF-Tm172 and its siblings obtained by single spore isolation. Strain

SF-Tm172 04ss50 04ss26 04ss27 04ss17 04ss24 04ss40 04ss45 04ss46 04ss48 04ss58 04ss65 04ss71 04ss142 04ss147 04ss150 04ss43 04ss54 04ss63 04ss122 04ss141 a

FFPRIa accession numbers

Sourceb

435312 435313 435314 435315 435316 435317 435318 435319 435320 435321 435322 435323 435324 435325 435326 435327 435328 435329 435330 435331 435332

P S S S S S S S S S S S S S S S S S S S S

Number of nuclei in predominant cells:c days after spore dispersal

SNP typesd

154

189

479

3100

2 2 1 1 1 1 1 1 2 1 1 1 1 1 1 1 2 2 1 1 2

2 2 1 1 2 1 2 2 N 2 2 2 1 1 1 1 N N 2 1 N

2 2 1 1 2 1/2 2 2 2 2 2 2 1 1 1 1 2 2 2 1/2 2

Ne N 1 1 N 2 2 N N N N N 2 2 2 2 2 N N 2 N

a, b a, b a b b b b b b b b b b b b b a a a a a

FFPRI, Forestry and Forest Products Research Institute; the spore isolates are available at FFPRI gene bank. P, The parent isolated from a fruit body grown in the shiro no. 6 of the Konan study site, Shiga, on October 19, 2004. S, Spore isolates derived from SF-Tm172 (see text for a protocol used for spore germination on an agar plate). c Nuclear phase was determined by microscopic analysis with DAPI fluorescent staining. d SNP, Single nucleotide polymorphisms within the 431-bp single copy DNA segment, in which a set of closely linked two SNP markers are localized at bp 238 and 278, as determined by MEGA5-based multiple alignment analysis of 12e16 PCR cloned DNA segments of each specimen (Fig. 3). a, C/C at bp 238/278. b, A/T at bp 238/278. e N, Not determined. b

m y c o s c i e n c e 5 6 ( 2 0 1 5 ) 2 8 7 e2 9 2

with nuclei under a microscope (see above). Therefore, we basically analyzed whether monosporous specimens exhibited paired nuclei like the parent at 40 magnification (Fig. 1AeC), and then confirmed whether one or more nuclei occurred between septa at 40 magnification using a modified DAPI staining as described below (Fig. 1D). The hyphae were dipped in DAPI (10 ppm) for 10 min, air dried on a slide glass, and were further treated with DAPI (1 ppm) for 1 min. Then, the specimens were placed in Fluorescent Brighter 28 (FB; 200 ppm; Sigma, St. Louis, MO, USA) 2 mM Tris HCl pH 8.0 solution, a dye that stains cell walls of viable fungi. Note that DAPI staining generally does not work with FB. This new method allowed us to detect both septa and nuclei simultaneously in the same fluorescence image (Fig. 1D). Five of those isolates were totally binucleate upon germination, seven were initially uninucleate but became totally

289

binucleate within 1 year of culture, and eight remained uninucleate a year after germination (Table 1). Nine years later (in 2013), we examined the nuclear phases of eight representative monosporous isolates (04ss24, 04ss26, 04ss27, 04ss71, 04ss122, 04ss142, 04ss147, and 04ss150) that had initially been uninucleate (Table 1). Of those presumed uninucleate monokaryons, 04ss24, 04ss71, 04ss122, 04ss142, 04ss147, and 04ss150 were predominantly binucleate in 2013, and only 04ss26 and 04ss27 appeared to be uninucleate (Table 1, Fig. 1AeD). At this point, the six binucleate isolates seem to be monokaryons on the basis of the fact that mating cannot occur in pure culture. Thus far, T. matsutake 04ss26 and 04ss27 have proven to be highly stable uninucleate monokaryotic matsutake strains relative to the other monosporous isolates (Table 1). Interestingly, however, detailed microscopic examination of

Fig. 1 e Differential interference Nomarski micrographs of DAPI-stained nuclei in cultured mycelia of Tricholoma matsutake SF-Tm172 and its monosporous isolates 04ss150 and 04ss27 under 40£ magnification. A: SF-Tm172 (predominant nuclear phase ¼ binucleate dikaryotic; DAPI). B: 04ss150 (binucleate monokaryotic; DAPI). C: 04ss27 (uninucleate monokaryotic; DAPI). D: 04ss27 (uninucleate monokaryotic; modified DAPI with FB). Representative paired nuclei are circled in (A). Open arrows pointing downward: uninuclei (D). Gray arrows pointing upward: septa (D). Thick open arrow pointing downward: multiple nuclei (D). Bars: 10 mm.

290

m y c o s c i e n c e 5 6 ( 2 0 1 5 ) 2 8 7 e2 9 2

Fig. 2 e Differential interference Nomarski micrographs of DAPI-stained nuclei in multinucleated cells of Tricholoma matsutake under 100£ magnification. A: 04ss27 (predominant nuclear phase ¼ uninucleate monokaryotic). B: 04ss24 (binucleate monokaryotic). Bars: 10 mm.

strains 04ss26 and 04ss27 showed that their predominantly uninucleate mycelia sporadically had individual cells with multiple nuclei; in some cases, a single cell contained three nuclei (Figs. 1D, 2A), demonstrating their ability to become multinucleate during in vitro pure culture. Such trinucleate cells have also been sporadically noted in dikaryotic strains, as well (Fig. 2B). Note that Jacobson and Miller (1994) reported that the ectomycorrhizal basidiomycete Suillus granulatus, which produces mushrooms known as “Chichiawa-take” in Japan, germinated only binucleate hyphae from single spores as a result of post-meiotic mitosis in the basidia rather than in the spores. This fact indicates that S. granulatus is secondarily homothallic, and mating could occur within binucleate hyphae. Bonello et al. (1998) documented that only binucleate spores of S. pungens, which corresponded to 1.4% of the spores produced by the fungal fruit body, germinated on agar plates. In T. matsutake, both uninucleate and binucleate spores could germinate on agar plates, but the mycelia tended to become binucleate even without mating. To determine the nuclear phases of monosporous isolates based on DNA sequences, SNP analysis was carried out (Table 1) as described by Murata et al. (2013). Briefly, genomic DNA was extracted with a lysis buffer containing cetyltrimethylammonium bromide and phenol chloroform and subjected to high-fidelity PCR with LA Taq (Takara, Otsu, Japan). PCR-amplified DNA was cloned into the vector pCR2.1 (Life Technologies, Carlsbad, CA, USA), sequenced with Big Dye Terminator FS Core Kit (Life Technologies), and aligned to other sequences with the software MEGA5 (Tamura et al. 2007). The PCR with primers SNPCTS2FW (ACCTTCCTTTGGATG TCTGATCCTTCTATAATGG [Tm ¼ 63  C]) and SNPCTS2RV (GTAGTGCGTACGTTTGTTATCGAGAAGATC [Tm ¼ 63  C])

allowed us to amplify a 431-bp DNA segment that corresponded to the upstream sequence of the short interspersed nuclear element AbaMEG1, a mobile DNA segment that may have been involved in genome evolution of the phylum Basidiomycota (Babasaki et al. 2007). This marker exists as a single copy in the T. matsutake genome, based on genomic Southern hybridization and real-time quantitative PCR analyses (Murata et al. 2013). It contains two closely-linked SNP markers at positions 238 and 278 in a multiple alignment of 16 DNA segments cloned from SF-Tm172 and 12 segments cloned from each sibling listed in Table 1 (Fig. 3). Thus far, this is the only single copy DNA segment we could identify that contains two SNP in a 1:1 ratio in SF-Tm172 (Fig. 3A). The parent SF-Tm172 and the monosporous isolate 04ss50, which has been binucleate since germination, both had two SNP patterns (Fig. 3A, B), implying that they were dikaryotic, while the most other specimens appeared to be monokaryotic, with a single SNP pattern that was presumably derived from a single parent nucleus (Table 1, Fig. 3C) [In the isolate 04ss50, two SNP patterns appeared in a 0.71:1 ratio (Fig. 2B)]. This observation may be relevant to the number of nuclei in basidiospores of ectomycorrhizal Tricholoma in general, in which many species, including close relatives of T. matsutake, e.g., “American matsutake” T. magnivelare, produce predominantly uninucleate spores and a few binucleate ones (Horton 2006). Such conclusions will, however, remain tenuous until mating system compatibility can be clarified because of uncertainty in determining homo- or heterokaryotic nuclei on the basis of mutations (Kawai et al. 2008); nuclei that appear structurally different can be derived from the same nucleus and incompatible for mating, and nuclei that appear structurally the same can be derived from different nuclei and compatible.

m y c o s c i e n c e 5 6 ( 2 0 1 5 ) 2 8 7 e2 9 2

291

Fig. 3 e Multiple alignment of the 431-bp single-copy DNA segment associated with the mobile DNA element AbaMEG1 from the Tricholoma matsutake samples listed in Table 1. Sequences between bp 200 and 300 are shown to highlight two closelylinked SNPs at bp 238 and bp 278 (arrows). A: Multiple alignment of 16 DNA sequences cloned by high-fidelity PCR from T. matsutake strain SF-Tm172. B: Multiple alignment of 12 DNA sequences cloned by high-fidelity PCR from T. matsutake strain 04ss50. C: Multiple alignment of representative DNA sequences from strains listed in Table 1. Each sequence represents 16 cloned DNAs. The blue and red vertical lines designate the SNP types as a and b, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Unlike many model mushrooms and other cultivated saprophytes that are commercially available, T. matsutake, like S. granulatus and S. pungens, does not have mycelia with tubular “clamp connections” between cells undergoing mitosis. Such connections transfer a nucleus for dikaryon reproduction and are the physical markers that differentiate monokaryons from dikaryons. Therefore, breeding in these species is difficult to identify. Kawai et al. (2008) successfully demonstrated that Rhizopogon rubescens, an ectomycorrhizal edible mushroom whose basidiospores are mostly uninucleate, has a bipolar incompatibility system by developing a mating system to induce the clamp connection upon binucleation in this pine-associated symbiont. In conclusion, T. matsutake generates both monokaryotic and dikaryotic hyphae from single spores, and the uninucleate monokaryotic hyphae can become multinucleate during the course of culture, especially prolonged growth, in vitro. After 3100 days, only a small portion of spore isolates remained uninucleate, while the majority, regardless of their initial uninucleation or dinucleation states, were multinucleate.

However, two isolates carrying different SNPs were predominantly uninucleate monokaryotic even after 3100 days (9 years). Albeit preliminary, these spore isolates characterized by both microscopic and DNA analyses may be useful in studying the genetics and breeding of this gourmet mushroom.

Acknowledgments This work was supported by a grant from the Forestry and Forest Products Research Institute, Tsukuba, Japan.

references

Babasaki K, Masuno K, Murata H, 2003. Interactions of heterologous mycelia colonized in the substrate govern fruit body production in the cultivated homobasidiomycete Pholiota

292

m y c o s c i e n c e 5 6 ( 2 0 1 5 ) 2 8 7 e2 9 2

nameko. Bioscience, Biotechnology, and Biochemistry 67: 100e106; http://dx.doi.org/10.1271/bbb.67.100. Babasaki K, Neda H, Murata H, 2007. megB1, a novel macroevolutionary genomic marker of the fungal phylum Basidiomycota. Bioscience, Biotechnology, and Biochemistry 71: 1927e1939; http://dx.doi.org/10.1271/bbb.70144. Bonello P, Bruns TD, Gardes M, 1998. Genetic structure of a natural population of the ectomycorrhizal fungus Suillus pungens. New Phytologist 138: 533e542; http://dx.doi.org/ 10.1046/j.1469-8137.1998.00122.x. Buller AHR, 1931. Researches on fungi, vol IV. Longmans, Green and Co, London. Fraser JA, Hsueh Y-P, Heitman J, 2007. Evolution of the matingtype locus: the basidiomycetes. In: Heitman J, Kronstad JW, Taylor JW, Casselton L (eds), Sex in fungi: molecular determination and evolutionary implications. ASM Press, Washington DC, pp 19e33. Horton TR, 2006. The number of nuclei in basidiospores of 63 species of ectomycorrhizal Homobasdiomycetes. Mycologia 98: 233e238; http://dx.doi.org/10.3852/mycologia.98.2.233. Jacobson KM, Miller OK, 1994. Postmeiotic mitosis in the basidia of Suillus granulatus: implications for population structure and dispersal biology. Mycologia 86: 511e516; http://dx.doi.org/ 10.3852/mycologia.98.2.233. Kawai M, Yamahara M, Ohta A, 2008. Bipolar incompatibility system of an ectomycorrhizal basidiomycete, Rhizopogon rubescens. Mycorrhiza 18: 205e210; http://dx.doi.org/10.1007/ s00572-008-0167-4. Lin X, Heitman J, 2007. Mechanisms of homothallism in fungi and transitions between heterothallism and homothallism. In: Heitman J, Kronstad JW, Taylor JW, Casselton L (eds), Sex in fungi: molecular determination and evolutionary implications. ASM Press, Washington DC, pp 35e57. Murata H, Ohta A, Yamada A, Narimatsu M, Futamura N, 2005. Genetic mosaics in the massive persisting rhizosphere colony “shiro” of the ectomycorrhizal basidiomycete Tricholoma matsutake. Mycorrhiza 15: 505e512; http://dx.doi.org/10.1007/ s00572-005-0358-1. Murata H, Ota Y, Yamaguchi M, Yamada A, Katahata S, Ohtsuka Y, Babasaki K, Neda H, 2013. Mobile DNA distributions refine the phylogeny of “matsutake”

mushrooms, Tricholoma sect. Caligata. Mycorrhiza 23: 447e461; http://dx.doi.org/10.1007/s00572-013-0487-x. Ogawa M, 1975. Microbial ecology of mycorrhizal fungus, Tricholoma matsutake Ito et Imai (Sing.) in pine forest I e fungal colony (‘shiro’) of Tricholoma matsutake. Bulletin of the Government Forest Experiment Station 272: 79e121. Ohta A, 1986a. Basidiospore germination of Tricholoma matsutake (I). Effects of organic acids on swelling and germination of the basidiospores. Transaction of the Mycological Society in Japan 27: 167e173. Ohta A, 1986b. Basidiospore germination of Tricholoma matsutake (II). Evaluations of germination conditions and microscopic observations of germination stages. Transaction of the Mycological Society in Japan 27: 473e480. Ohta A, 2006. Number of nuclei in the mycelia isolated from an agar plate inoculated with Tricholoma matsutake spores. Bulletin of Shiga Forestry Research Center 38: 29e32. Raper JR, 1966. Genetics of sexuality in higher fungi. The Ronald Press, New York. Raudaskoski M, Kothe E, 2010. Basidiomycete mating type genes and pheromone signaling. Eukaryotic Cell 9: 847e859; http:// dx.doi.org/10.1128/EC.00319-09. Tamura K, Dudley J, Nei M, Kumar S, 2007. MEGA4: molecular evolutionary genetic analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596e1599; http://dx.doi.org/ 10.1093/molbev/msm092. Tominaga Y, 1978. Tricholoma matsutake. In: Chang ST, Hayes WA (eds), The biology and cultivation of edible mushrooms. Academic Press, London, pp 683e697. Yamada A, Endo N, Murata H, Ohta A, Fukuda M, 2014. Tricholoma matsutake Y1 strain associated with Pinus densiflora shows a gradient of in vitro ectomycorrhizal specificity with Pinaceae and oak hosts. Mycoscience 55: 27e34; http://dx.doi.org/10.1016/ j.myc.2013.05.004. Yamada A, Kobayashi H, Murata H, Kalmis‚ E, Kalyoncu F, Fukuda M, 2010. In vitro ectomycorrhizal specificity between the Asian red pine Pinus densiflora and Tricholoma matsutake and allied species from worldwide Pinaceae and Fagaceae forests. Mycorrhiza 20: 333e339; http://dx.doi.org/10.1007/ s00572-009-0286-6.