Morphologic and GATA1 sequencing analysis of hematopoiesis in fetuses with trisomy 21

Human Pathology (2014) 45, 1003–1009

www.elsevier.com/locate/humpath

Original contribution

Morphologic and GATA1 sequencing analysis of hematopoiesis in fetuses with trisomy 21☆,☆☆ Sylvia Hoeller MD a,⁎, Michel P. Bihl PhD a , Alexandar Tzankov MD a , Rosemarie Chaffard a , Petra Hirschmann a , Peter Miny MD b , Thomas Kühne MD c , Elisabeth Bruder MD a a

Department of Pathology, Hospital of the University of Basel, Basel, Switzerland University Children's Hospital, Medical Genetics, Basel, Switzerland c Department of Paediatrics, Oncology/Hematology, University Children's Hospital, Basel, Switzerland b

Received 8 August 2013; revised 11 December 2013; accepted 16 December 2013

Keywords: Trisomy 21; Hematopoiesis; Fetal; GATA1; Megakaryoblastic leukaemia

Summary Trisomy 21 alters fetal liver hematopoiesis and, in combination with somatic globin transcription factor 1 (GATA1) mutations, leads to development of transient myeloproliferative disease in newborns. However, little is known about the morphological hematopoietic changes caused by trisomy 21 in the fetus, and to date, the exact onset of GATA1 mutations remains uncertain. Therefore, we analyzed fetal liver hematopoiesis from second trimester pregnancies in trisomy 21 and screened for GATA1 mutations. We examined 57 formalin-fixed and paraffin-embedded fetal liver specimens (49 harboring trisomy 21 and 8 controls) by immunohistochemistry for CD34, CD61, factor VIII, and glycophorin A. GATA1 exon 2 was sequenced in fetal livers and corresponding nonhematologic tissue. Cell counts of megakaryocytes (P = .022), megakaryocytic precursors (P = .021), and erythroid precursors were higher in trisomy 21 cases. CD34-positive hematopoietic blasts showed no statistically significant differences. No mutation was detected by GATA1 exon 2 sequencing in fetal livers from 12 to 25 weeks of gestation. Our results suggest that GATA1 exon 2 mutations occur late in trisomy 21 fetal hematopoiesis. However, trisomy 21 alone provides a proliferative stimulus of fetal megakaryopoiesis and erythropoiesis. CD34-positive precursor cells are not increased in trisomy 21 fetal livers. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Trisomy 21 is the most frequent numeric chromosomal aberration in newborns, occurring at an average frequency of ☆ Funding/Support: The Swiss Research Foundation “Kind und Krebs Zürich”, Zürich, Switzerland. ☆☆ Competing interest: We have no conflict of interest to declare. ⁎ Corresponding author. Institute of Pathology, University Hospital of Basel, Schoenbeinstrasse 40, 4031 Basel, Switzerland. E-mail address: [email protected] (S. Hoeller).

0046-8177/$ – see front matter © 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.humpath.2013.12.014

approximately 1 in 700 live births. Its frequency is highly dependent on the mother's age and occurs at a ratio of 1:1524 in women around 25 years old to 1:30 in women around 45 years old [1,2]. During the last 7 decades, the prognosis of children with trisomy 21 has improved significantly with better health care, and since the 1940s, life expectancy estimates have increased from 12 to nearly 60 years of age [3]. Neonates and children/infants with trisomy 21 are prone to present with hematologic disorders, including polycythemia in newborns, macrocytosis, transient myeloproliferative

1004 Table 1 Antibody CD34

S. Hoeller et al. List of antibodies used Source

Ventana 760-2927 CD61 Ventana 760-4249 F VIII Ventana 760-2642 Glycophorin Ventana A 760-4257

Dilution/ incubation

Retrieval Detection

Prediluted/32 min, automated Prediluted/32 min, automated Prediluted/32 min, automated Prediluted/32 min, automated

CC1 mild CC1 mild CC1

DAB

CC1 mild

DAB

DAB DAB

Abbreviations: F VIII, factor VIII; CC1, cell conditioning type 1 buffer from Ventana (Tucson, AZ); DAB, 3,3′-diaminobenzidine.

disorder, acute myeloid leukemia, and acute lymphoblastic leukemia [4-6]. The incidence of transient myeloproliferative disorder is estimated between 4% and 10%, of which 20% of children will develop acute megakaryoblastic leukemia later on [7,8]. Approximately 50% of all leukemias in children with trisomy 21 are acute megakaryoblastic leukemias [2]. Almost all transient myeloproliferative disorders and a substantial proportion of acute megakaryoblastic leukemias

associated with trisomy 21 present with an acquired globin transcription factor 1 (GATA1) mutation in the leukemic blasts [8,9]. GATA1 is a gene located on the short arm of chromosome X at 11.23 (Xp11.23). It has been described as a paradigm for transcription factor function in hematopoiesis with progressive restriction of differentiation potential and establishment of lineage-specific gene expression profile [10]. GATA1 encodes for a protein regulating hematopoiesis, especially the megakaryocytic and erythrocytic lineage [11]. GATA1s, the short mutated form, lacks the N-terminal domain but is otherwise identical to full length GATA1. Little is known about the role of GATA1s in normal hematopoiesis, but the exclusive presence of GATA1s in the hematopoietic precursors of trisomy 21 newborns, mostly due to somatic exon 2 and, occasionally, exon 3 mutations of GATA1, seems to be responsible for its leukemogenic potential leading to transient myeloproliferative disorder. There is evidence that transient myeloproliferative disorder originates from fetal liver hematopoietic stem cells and that it resolves after birth when fetal hematopoiesis switches completely from liver to bone marrow [12-16]. The exact onset of transient myeloproliferative disorder and its implications on the fetal liver remain to be elucidated [17],

Fig. 1 Summary of hematopoietic changes in fetal livers with trisomy 21 over time: CD34-positive blasts and megakaryopoiesis in trisomy 21 show an increase with gestational age (13th of gestation [A], second row 17th week of gestation [D], and third row 22nd week of gestation [G]). In the 13th week of gestation, only very few CD34-positive blasts (B) and CD61-positive megakaryocytes (C) are present. At 17th week of gestation, CD34-positive blasts (E) and CD61-positive megakaryocytes (F) are already more numerous, and CD34-positive blasts (H) and CD61 = positive megakaryocytes (I) are obviously increased in the late second trimester. All pictures are taken in original magnification ×200.

Fetal hematopoiesis in trisomy 21 fetuses as do which alterations of hematopoiesis are caused by trisomy 21 per se, and which factors synergize with GATA1 mutations in its pathogenesis. Our study was triggered by a case of transient myeloproliferative disorder running a fatal clinical course and showing a very early stop codon in codon 2 exon 2 of GATA1 [18]. This index case prompted us to study fetal liver hematopoiesis in trisomy 21 and to screen for GATA1 mutations in second trimester trisomy 21 fetuses to determine the exact onset of GATA1 mutations and detail the hematopoietic changes in such fetuses.

1005 First PCR: denaturation for 15 seconds at 95°C, annealing for 10 seconds at 59°C, and elongation for 20 seconds at 72°C. Second PCR: denaturation for 15 seconds at 95°C, annealing for 10 seconds at 56°C and elongation for 20 seconds at 72°C.

2. Materials and methods Forty-nine fetal livers and corresponding nonhematopoietic tissue (eg, fetal lungs) were obtained from weeks 12 to 25 (median, 17.5 weeks) aborted fetuses with trisomy 21. Twenty-six fetuses were male, and 23, female. Trisomy 21 was confirmed in all cases by classical karyotyping. There were no mosaic cases. Eight fetuses with disomy 21 were selected as controls, including 1 with trisomy 13 and 1 with trisomy 18. All 57 formalin-fixed and paraffin-embedded fetal livers were stained for CD34, CD61, factor VIII, and glycophorin A (Table 1). Positive cells were counted per 10 high-power fields. Only CD34-positive stained cells without spindled appearance and which were not in contact with CD34-positive vessels were counted. The CD61 staining results were subdivided into 2 groups. To assess the maturation of the megakaryopoiesis, in the first group, only large mature megakaryocytes were considered, and in the second group, only immature small megakaryocytes were recorded. The same 2 groups were formed from the results of factor VIII as another complementary marker of megakaryocytes. For glycophorin A, the number of positive and partly overlapping cells was too high to count separately, and thus, a semiquantitative approach with 3 levels of estimation (+, ++, +++) was chosen. DNA was extracted from all fetal livers with hematopoiesis and corresponding nonhematopoietic tissue from selected areas on paraffin slides. DNA extraction was performed according to standard protocol. A DNA segment spanning exon 2 of the GATA1 gene was amplified. Primers used for the first polymerase chain reaction (PCR) and second PCR are listed below: GATA1-forward: TCTGTCCTCGCAGGTTAATCC GATA1-reverse: TATTCTGACCTAGCCAAGGATCTC GATA1-forward nested: TCGCAGGTTAATCCCCAGA GATA1-reverse nested: ATGCCAAGACAGCCACTCAATG

Following an activation step at 95°C for 10 minutes, 45 cycles were performed under the following conditions:

Fig. 2 Immunohistochemical quantification of different hematopoietic lineages: CD34-positive blasts (A) and CD61-positive mature (B) and immature (C) megakaryocytes increase with gestational age. However, the increase of CD61-positive megakaryocytes (mature and immature) was more pronounced in trisomy 21 specimens compared with controls.

1006 Table 2

S. Hoeller et al. Summary of cell counts for stained markers

Mean Range

CD34

CD61 megakaryocytes

F VIII megakaryocytes

Mature

Immature

Mature

Immature

17 3-77

40 10-70

20 0-60

15 4-33

1.23 0-15

Sense and antisense sequencing was performed in a 10-μL reaction with the Big Dye Terminator Kit version 1.1 (Applied Biosystems, Foster City, CA). Sequences were generated by capillary electrophoresis in an ABI 3130 genetic analyzer and visualized with the Sequencing Analysis software and also with the SeqScape software version 2.5 (Applied Biosystems/Biosolutions, Athens, Greece). The study was approved by the Ethics Committee of Basel.

3. Results Hematoxylin and eosin histology alone showed no recognizable difference between trisomy 21 fetal livers and controls. However, the total cell count increased within all 3 different hematopoietic lineages of the trisomy 21 group with gestational age (Figs. 1 and 2). Immunohistochemical characterization showed that the absolute cell count varied remarkably between cases (Table 2). The cell counts of megakaryocytes (Mann-Whitney U test, P = .022), megakaryocytic precursors (P = .021), and erythroid precursors were clearly higher in the trisomy 21 group compared with controls. CD34-positive hematopoietic progenitor cell showed no statistically significant differences between the trisomy 21 and the control group, with almost identical cell counts (22 mean cell count in the trisomy 21 group and 27 mean cell count in the control group in 10 high-power fields, P = .265). GATA1 exon 2 was amplified by PCR, and fragments were subcloned. No mutation was detected by direct sequencing of the PCR product and corresponding tissues. All fetuses and placentae were reviewed to identify myeloproliferative features of the peripheral fetal blood. Three cases (umbilical vein of the umbilical cord [2 cases] and blood clots attached to fetal organs [one case]) were identified showing myeloproliferative features with increased number and size of nucleated blood cells (Fig. 3). In 1 case, megakaryocytic/megakaryoblastic cells were also identified. Paraffin-embedded tissue from 2 cases was available to sequence the blood clots, but again, no GATA1 exon 2 mutation was found.

4. Discussion Transient myeloproliferative disorder is a unique condition of trisomy 21, preceding acute megakaryoblastic

Glycophorin A

2.44+ 1+ to 3+

leukemia and showing clinical and morphological findings indistinguishable from acute myeloid leukemia [2]. It evolves in utero and becomes clinically evident at birth [19,20]. Almost all cases are associated with GATA1 exon 2 and, infrequently, exon 3 mutations [21-23]. Prenatal analyses of fetal hematopoiesis, particularly in patients with trisomy 21, are rare [24]. Occasional examples of fetuses with trisomy 21 and myeloproliferative disease without GATA1 mutations have been described [25]. Importantly, a significant percentage of trisomy 21 fetuses would be spontaneously lost before birth. We do not know if the genomic profile of from fetuses surviving till birth is different to those who die in utero. Therefore, the estimation of the incidence of GATA1 mutation in newborns is potentially not reflecting its global incidence in fetuses. To our best knowledge, we are not aware of a study looking for GATA1 mutation in second trimester fetuses. In the present study, we focused on detecting hematopoietic changes in fetuses with trisomy 21 at different time points of fetogenesis compared with fetuses without trisomy 21. By conventional histology, trisomy 21 fetal liver specimens were indistinguishable from controls. At the immunohistochemical level, we could demonstrate that the population of CD34-positive early precursors increased with gestational age, but independent of the presence of trisomy 21. This indicates that the blast content in fetal livers with trisomy 21 and wild-type GATA1 is not skewed toward a “preleukemic phase” per se. However, trisomy 21 itself alters the hematopoiesis, resulting in a proliferative stimulus toward hyperplasia of megakaryopoietic and eryrthropoietic precursors (Figs. 1-3). This phenomenon seems not to be restricted to the fetal liver because in 3 cases, we were also able to demonstrate small peripheral blood clots with increased nucleated blood cells that did not show the typical features of nucleated mature erythrocytes and/or granulocytes. Furthermore, in 1 case, we found megakaryocytic/megakaryoblastic cells in this blood clot (Fig. 3). These findings are also found in trisomy 21 newborns with transient myeloproliferative disorder, but much more pronounced, showing a leukemic pattern [26]. The pathogenesis of Down syndrome/trisomy 21– associated acute megakaryoblastic leukemia and transient myeloproliferative disorder in children is highly linked to the presence of GATA1 mutations. The coincidental appearance of trisomy 21 and GATA1 mutation is leukemogenic [8].

Fetal hematopoiesis in trisomy 21 fetuses Nontrisomic patients with germline GATA1 mutations analogous to those seen in transient myeloproliferative disorder and Down syndrome/trisomy 21–associated acute megakaryoblastic leukemia have no predisposition to leukemia [27]. The pathogenic GATA1 mutation was found to arise in utero, but little is known about the exact onset in fetal liver hematopoiesis [28]. In the literature, the earliest documented report of a case with such a mutation was in a trisomy 21 fetus at 21 weeks of gestation [17]. Our study aimed to detect mutations at an earlier stage of fetal liver hematopoiesis, and our collective primarily covered the early and middle second trimesters with a mean of 17.5 weeks of gestation. Only a few cases were included with a gestational age older than 21 weeks (4 cases). Taking into account that the frequency of GATA1 mutations in trisomy 21 is estimated to be between 4% and 10% in the literature [26,29], 2 to 6 GATA1 mutations would have been expected to be present in our collective if the onset was clearly earlier than 20 weeks of

1007 gestation. Therefore, our results suggest that it is more likely that the onset of GATA1 mutations is a late event in fetal hematopoiesis, not before the switch to the bone marrow has already begun [30], and does not occur until 20 weeks of gestation (Fig. 4). Mutational processes can occur at any stage of development in stem cells, differentiating cells, and in terminally differentiated somatic cells leading to a mosaicism arising due to errors during chromosome segregation or DNA replication. It is not definitively clear whether this mechanism is only present in tumor pathogenesis or if it is also important to maintain and improve normal tissue functions [31], which would be probably the case in this sensitive period of shifting the hematopoiesis from the fetal liver and spleen to the bone marrow cavity. Why GATA1 mutations appear only after 5 months of gestation remains unclear. Interestingly, the GATA1 mutational spectrum in trisomy 21 patients with predominance of small insertions, deletions, duplications, and base

Fig. 3 Fetal peripheral blood and liver megakaryopoiesis: conventional hematoxylin and eosin morphology demonstrated an increase in immature precursors in the peripheral blood in 3 fetuses. Blood clots in umbilical vein (D and G) and attached to fetal liver (A). B, Primarily erythropoietic precursors, but also elements of the megakaryopoiesis (see arrow), could be detected. Increased number of peripheral nucleated blood cells from cases shown in panels D and G is demonstrated more in detail on panels E and H. C and F, Corresponding fetal liver megakaryopoiesis (CD61 staining) is shown in the third column. A case with normal content of nucleated blood cells is shown on panel I for comparison. Despite the increase in immature leukocytes in the peripheral blood, no GATA1 exon 2 mutation could be demonstrated in these separately analyzed blood clots. Original magnification: A, D, G, and I, ×100; C and F, ×200; B, E, and H, ×400.

1008

S. Hoeller et al. GATA1 mutation

[6] 4-5th week of gestation

18-21th week of gestation

TMD

[7]

[8] Start of liver heamtopoiesis

Switch of hematopoiesis from fetal liver to bone marrow

Birth

Fig. 4 Time table of early hematopoiesis: between 4 and 5 weeks of gestation after the onset of circulation erythropoiesis begins in the liver. In the late second trimester, however (between 18 and 21 weeks of gestation), hematopoiesis in the liver diminishes and the bone marrow becomes primary site of erythropoiesis, but the liver remains an erythropoietic organ until term [30]. The earliest onset of GATA1 mutation was found in the 21th week of gestation [17]; also, our data suggest that the onset is not earlier than this, pointing to a possible causative connection between the shift of hematopoiesis to the bone marrow/the different microenvironment and the onset of GATA1 mutations.

substitutions suggested potential oxidative stress and aberrant folate metabolism as potential mutational cause in one study [32]. Moreover, impaired DNA repair capacity and a compromised base excision repair pathway have been implicated in leukemogenesis of trisomy 21 patients [32]. However, at 5 months of gestation, fetal hematopoiesis begins to shift from the liver to the bone marrow [33,34], with the latter becoming the major site of hematopoiesis after 24 weeks of gestation. It remains to be elucidated whether the appearance of GATA1 mutations might be linked to a switch in signaling and expression of different genes such as the chemokine receptor 4/ chemokine ligand 12 (CXCR4/SDF-1) pathway required for appropriate homing of hematopoietic stem cells to the bone marrow niche [35].

References [1] Canfield MA, Honein MA, Yuskiv N, et al. National estimates and race/ethnic-specific variation of selected birth defects in the United States, 1999-2001. Birth defects research Part A. Clin Mol Teratol 2006;76:747-56. [2] Swerdlow SH, Campo E, Nancy LH, et al, editors. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon: IARC; 2008. [3] Bittles AH, Bower C, Hussain R, Glasson EJ. The four ages of Down syndrome. Eur J Public Health 2007;17:221-5. [4] Roizen NJ, Patterson D. Down's syndrome. Lancet 2003;361: 1281-9. [5] Roy A, Roberts I, Norton A, Vyas P. Acute megakaryoblastic leukaemia (AMKL) and transient myeloproliferative disorder (TMD)

[9] [10]

[11]

[12]

[13] [14]

[15]

[16]

[17]

[18]

[19]

[20] [21]

[22]

[23]

[24]

[25]

[26]

in Down syndrome: a multi-step model of myeloid leukaemogenesis. Br J Haematol 2009;147:3-12. Maloney KW. Acute lymphoblastic leukaemia in children with Down syndrome: an updated review. Br J Haematol 2011;155: 420-5. Malinge S, Chlon T, Dore LC, et al. Development of acute megakaryoblastic leukemia in Down syndrome is associated with sequential epigenetic changes. Blood 2013;122:e33-43. Malinge S, Izraeli S, Crispino JD. Insights into the manifestations, outcomes, and mechanisms of leukemogenesis in Down syndrome. Blood 2009;113:2619-28. Ahmed M, Sternberg A, Hall G, et al. Natural history of GATA1 mutations in Down syndrome. Blood 2004;103:2480-9. Ferreira R, Ohneda K, Yamamoto M, Philipsen S. GATA1 function, a paradigm for transcription factors in hematopoiesis. Mol Cell Biol 2005;25:1215-27. Mancini E, Sanjuan-Pla A, Luciani L, et al. FOG-1 and GATA-1 act sequentially to specify definitive megakaryocytic and erythroid progenitors. EMBO J 2012;31:351-65. Roy A, Roberts I, Vyas P. Biology and management of transient abnormal myelopoiesis (TAM) in children with Down syndrome. Semin Fetal Neonatal Med 2012;17:196-201. Zipursky A. Transient leukaemia—a benign form of leukaemia in newborn infants with trisomy 21. Br J Haematol 2003;120:930-8. Klusmann JH, Creutzig U, Zimmermann M, et al. Treatment and prognostic impact of transient leukemia in neonates with Down syndrome. Blood 2008;111:2991-8. Massey GV, Zipursky A, Chang MN, et al. A prospective study of the natural history of transient leukemia (TL) in neonates with Down syndrome (DS): Children's Oncology Group (COG) study POG-9481. Blood 2006;107:4606-13. Muramatsu H, Kato K, Watanabe N, et al. Risk factors for early death in neonates with Down syndrome and transient leukaemia. Br J Haematol 2008;142:610-5. Taub JW, Mundschau G, Ge Y, et al. Prenatal origin of GATA1 mutations may be an initiating step in the development of megakaryocytic leukemia in Down syndrome. Blood 2004;104: 1588-9. Hoeller S, Bihl MP, Tzankov A, Kuehne T, Potthoff C, Bruder E. New GATA1 mutation in codon 2 leads to the earliest known premature stop codon in transient myeloproliferative disorder. Blood 2009;114: 3717-8. Lange B. The management of neoplastic disorders of haematopoiesis in children with Down's syndrome. Br J Haematol 2000;110: 512-24. Hitzler JK, Zipursky A. Origins of leukaemia in children with Down syndrome. Nat Rev Cancer 2005;5:11-20. Alford KA, Reinhardt K, Garnett C, et al. International Myeloid Leukemia-Down Syndrome Study G. Analysis of GATA1 mutations in Down syndrome transient myeloproliferative disorder and myeloid leukemia. Blood 2011;118:2222-38. Wechsler J, Greene M, McDevitt MA, et al. Acquired mutations in GATA1 in the megakaryoblastic leukemia of Down syndrome. Nat Genet 2002;32:148-52. Hitzler JK, Cheung J, Li Y, Scherer SW, Zipursky A. GATA1 mutations in transient leukemia and acute megakaryoblastic leukemia of Down syndrome. Blood 2003;101:4301-4. Stallmach T, Karolyi L. Augmentation of fetal granulopoiesis with chorioamnionitis during the second trimester of gestation. HUM PATHOL 1994;25:244-7. Rougemont AL, Makrythanasis P, Finci V, et al. Myeloid proliferation without GATA1 mutations in a fetus with Down syndrome presenting in utero as a pericardial effusion. Pediatr Dev Pathol 2010;13:423-6. Brink DS. Transient leukemia (transient myeloproliferative disorder, transient abnormal myelopoiesis) of Down syndrome. Adv Anat Pathol 2006;13:256-62.

Fetal hematopoiesis in trisomy 21 fetuses [27] Hollanda LM, Lima CS, Cunha AF, et al. An inherited mutation leading to production of only the short isoform of GATA-1 is associated with impaired erythropoiesis. Nat Genet 2006;38:807-12. [28] Khan I, Malinge S, Crispino J. Myeloid leukemia in Down syndrome. Crit Rev Oncog 2011;16:25-36. [29] Malinge S, Bliss-Moreau M, Kirsammer G, et al. Increased dosage of the chromosome 21 ortholog Dyrk1a promotes megakaryoblastic leukemia in a murine model of Down syndrome. J Clin Invest 2012;122:948-62. [30] Dame C, Juul SE. The switch from fetal to adult erythropoiesis. Clin Perinatol 2000;27:507-26.

1009 [31] Lupski JR. Genetics. Genome mosaicism—one human, multiple genomes. Science 2013;341:358-9. [32] Cabelof DC, Patel HV, Chen Q, et al. Mutational spectrum at GATA1 provides insights into mutagenesis and leukemogenesis in Down syndrome. Blood 2009;114:2753-63. [33] Bloom W, Bartelmez GW. Hematopoiesis in young human embryos. Am J Anat 1940:67. [34] Gilmour J. Normal hemopoiesis in intrauterine and neonatal life. J Pathol 1942:52. [35] Moll NM, Ransohoff RM. CXCL12 and CXCR4 in bone marrow physiology. Expert Rev Hematol 2010;3:315-22.