- Email: [email protected]
Mouse GLUT8: Genomic Organization and Regulation of Expression in 3T3-L1 Adipocytes by Glucose
Biochemical and Biophysical Research Communications 288, 969 –974 (2001) doi:10.1006/bbrc.2001.5866, available online at http://www.idealibrary.com on
Mouse GLUT8: Genomic Organization and Regulation of Expression in 3T3-L1 Adipocytes by Glucose A. Scheepers, H. Doege, H.-G. Joost, and A. Schu¨rmann 1 Institute of Pharmacology and Toxicology, Medical Faculty, Technical University of Aachen, D-52057 Aachen, Germany
Received September 28, 2001
Glucose transporter 8 (GLUT8) is a class III sugar transport facilitator predominantly expressed in testis and insulin-regulated tissues. Here we describe its genomic organization, the identification of its promoter region, and the regulation of its expression in 3T3-L1 cells. The mouse Glut8 gene spans approximately 9 kb, consists of 10 exons, and is highly similar to the human GLUT6 gene. Its 5ⴕ-flanking region exhibits promoter activity when fused with a luciferase reporter construct and expressed in HEK-293T cells. A deletion analysis indicated that the critical promoter elements are located in a region between ⴚ381 and the transcription start. This region comprises a CAAT box and consensus binding sites for the transcription factors SRY and NF1 that were highly conserved in the mouse and in the human sequence. In 3T3-L1 cells, GLUT8 mRNA levels increased markedly during the differentiation of cells. In contrast to GLUT1, expression of GLUT8 mRNA was significantly reduced by glucose deprivation and by prolonged hypoxia. The present data suggest that the function of GLUT8 is related to the adipocyte-like phenotype of 3T3-L1 cells, and that its expression is controlled by the metabolism of the adipocyte. © 2001 Academic Press
Hexose transport into mammalian cells requires specific carriers that catalyze the facilitated diffusion of sugars through the plasma membrane. These sugar transporters (GLUT1–5, gene symbols SLC2A1–5) have been known for more than 10 years (1). They belong to a family of membrane proteins which are characterized by 12 membrane spanning helices and a large intracellular loop connecting the helices 6 and 7 (2). Recently, several additional members of the GLUT family (GLUT6 –12, HMIT) have been identified by us Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. AJ413951 for Mus musculus SLC2A8 gene for glucose transporter 8. 1 To whom correspondence and reprint requests should be addressed. Fax: 49-241-8082433. E-mail: [email protected]. rwth-aachen.de.
and by others by cDNA cloning taking advantage of sequence information from expressed sequence tags and genomic sequence (3–9, for a review, see 10). Among the novel members of the GLUT family, human GLUT8 is so far the best characterized sugar transporter. Its sequence exhibits all elements and motifs (sugar transporter signatures) that are characteristic for the GLUT family, e.g., 12 membrane spanning helices, the GRR/K motifs in the loops 2 and 8, glutamate and arginine residues in the loops 4 and 10, the PESPR and the PETKG motifs after helices 6 and 12, respectively, and several other highly conserved residues (4). GLUT8 is a member of a subfamily (class III GLUTs, comprising GLUT6, GLUT10, GLUT12, and HMIT) which is mainly characterized by a larger and presumably glycosylated extracellular loop 9 (10). In spite of only 29.4% identical amino acids with GLUT1, human GLUT8 exhibits high-affinity glucose transport activity (4, 5). In addition, glucose transport activity is inhibitable by fructose, suggesting that GLUT8 is a dual-specific sugar transporter (5). mRNA of human GLUT8 was predominantly found in testis, lower amounts of RNA were detected in most other tissues including insulin-sensitive tissues (4, 5). In addition, mRNA and protein expression of human GLUT8 has also been detected in the blastocyst (11). The N-terminus of the GLUT8 harbors a dileucine motif which directs the protein to intracellular compartments when expressed in Xenopus oocytes, HEK293T cells (5), isolated fat cells and COS-7 cells (12). Mutation of the dileucine motif to alanines targets the protein to the cell membrane in all so far investigated expression systems. Interestingly, coexpression of a dominant negative dynamin mutant produces complete translocation of the GLUT8 to the plasma membrane (12). Thus, it seems reasonable to assume that the activity of these isotypes is regulated by cellular redistribution in response to yet unknown signals. Translocation of the GLUT8 in response to insulin has been reported in blastocysts (11). In fat cells transfected with a HA-tagged GLUT8 construct; however,
969
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
Vol. 288, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Organization of the mouse Glut8 gene, comparison with human GLUT6 and GLUT8, and analysis of its promoter. (A) Schematic representation of the exon–intron organization of mouse Glut8, human GLUT8 and human GLUT6 genes. Boxes represent exons as identified by the comparison with cDNA; the coding regions are drawn as shaded boxes. Localization of sequence motifs that are essential for the function of the transporter (sugar transporter signatures) on the exons are indicated. (B) Comparison of nucleotide sequence of the 5⬘-flanking region of the mouse and human GLUT8 gene. The numbers refer to the positions in the gene, where ⫹1 is the transcription initiation site. Putative cis-elements are boxed. (C) Deletion analysis of the Glut8 promoter. Constructs of the 5⬘-flanking region of exon1 of the Glut8 gene were generated by PCR and fused to the luciferase cDNA in the pGL3-basic vector. HEK-293T cells were transiently transfected with these Glut8 promoter–reporter constructs and luciferase activities were measured 48 h after transfection. Results represent means ⫾ SD of triplicate samples (transfections) from a representative experiment that was repeated three times.
insulin as well as several other agents failed to produce translocation of the protein (12). All so far available data are compatible with the assumption that GLUT8 participates in the regulation of glucose uptake by fat and muscle tissue. The present study was initiated to provide the basis for further studies of the transcriptional control of GLUT8. Here we describe the genomic organization of the mouse Glut8 gene, its promoter region, and its regulation of expression in 3T3-L1 adipose cells by the state of differentiation and by metabolic conditions, i.e. the ambient glucose concentration and the oxygenation of cells. METHODS Library screening and DNA sequencing. A genomic library (library number 121) generated from spleen of 129/Ola mice was obtained from the Resource Center/Primary Database of the German Human Genome Projekt (RZPD, Berlin, Germany). The library consisted of approximately 300,000 single cosmid clones (MboI digest,
Lawrist 7 vector) spotted on to nylon filters. The filters were hybridized with a full length cDNA probe of mouse GLUT8 (4). Two positive genomic clones were identified, and fragments were prepared by sonication and digestion with restriction enzymes. The fragments were subcloned into pUC18 and sequenced in both directions by the method of Sanger with the aid of an automated sequencer (LI-COR, Lincoln, NE). Promoter analysis. DNA fragments of the 5⬘-flanking region of the Glut8 gene were generated by PCR (⫺590 to ⫹25, forward: CAAGCACCAGGAATGCATGG; ⫺381 to ⫹25, forward: CTCAGGGAAGTTTACTTCG; ⫺214 to ⫹25, forward: CCTTCAGACTCACACCACAC; reverse: GTCAGCAGGACCTGACC). Constructs were fused to luciferase cDNA in the vector pGL3-basic (Promega, Madison, WI). These constructs were transiently transfected into HEK-293T cells with the aid of FuGene 6-Reagent (Boehringer Mannheim GmbH, Mannheim, Germany). 48 h after transfection, cells were lysed, and luciferase activity was analyzed with a kit from Promega (Luciferase Assay System) according to the instructions of the manufacturer. 3T3-L1 cells. 3T3-L1 cells were obtained from American Type Culture Collection (Rockville, MD), and were grown and differentiated as described previously (13). Incubation with fructose, galactose, glucosamine (25 mM) or glucose deprivation was initiated 8 –10
970
Vol. 288, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
days after the start of differentiation. Hypoxic conditions were generated by culture of cells in an atmosphere of 95% N 2/5% CO 2. Northern blot analysis. Total RNA was isolated from 3T3-L1 cells or the indicated mouse tissues according to the method of Chirgwin et al. (14). Samples (20 g) of total RNA were separated by electrophoresis on 1% (w/v) agarose gels containing 1% (v/v) formaldehyde and were transferred on to nylon membranes (Hybond N ⫹; Amersham-Pharmacia, Freiburg, Germany). Probes were generated with the Klenow fragment of DNA polymerase I and [␣- 32P]dCTP by random oligonucleotide priming. The nylon membranes were hybridized for 16 h at 42°C and blots were washed twice with 0.8% SSC containing 0.1% SDS.
RESULTS AND DISCUSSION Genomic organization of the mouse Glut8 gene. Two cosmid clones comprising mouse Glut8 were isolated in the screen of the genomic 129/Ola library. The cosmid DNAs were analyzed by restriction fragmentation and hybridization with probes derived from the 5⬘ (1–91 bp; 571–778 bp) and the 3⬘ (1221–1490 bp) end of the mouse GLUT8 cDNA. In addition, fragments from these clones covering the complete gene were subcloned and sequenced. Intron– exon boundarys were identified by a comparison of the genomic sequence with the cDNA sequences of GLUT8. Figure 1A illustrates the genomic organization of mouse Glut8. The gene spans approximately 9 kb and consists of 10 exons. The transcription start was defined with the longest 5⬘-RACE product that was amplified from mouse testis mRNA (4). The presumable translation start of the murine Glut8 could be defined at the first ATG after a stop codon in exon 1. In order to compare the human and mouse GLUT8 genes, the exon–intron borders of the human GLUT8 gene were mapped by a comparison of the genomic sequence as identified in a database search (Clone RP11-356B19, EMBL Accession No. AL445222) with the GLUT8 cDNA (GenBank Accession No. Y17801). As is illustrated in Fig. 1A, mouse and human GLUT8 are identical with regard to exon number and size, and highly similar with regard to intron size. A comparison of the GLUT8 gene structure with the human GLUT6 gene (3) reveals a striking homology of these genes: GLUT6 spans approximately 8 kb and also consists of 10 exons. Moreover, the distribution of the coding region over 10 exons is nearly identical, as indicated by the localization of critical transporter signatures (e.g., GRK and DLGRK) on exactly corresponding exons (Fig. 1A). This high degree of homology, and also the localization of human GLUT8 and GLUT6 in close proximity on chromosome 9 (GLUT8 at position 123,556 K and GLUT6 at position 128,574) suggest that the two genes have evolved by gene duplication. In order to identify the promoter region of GLUT8 and its presumable regulatory elements, the 5⬘flanking region of the mouse Glut8 gene (1054 bp) was analyzed by alignment with the corresponding genomic sequence of the human gene. Only a small portion from
FIG. 2. Northern blot analysis of the expression of GLUT8. (A) mRNA levels of GLUT8 in different mouse tissues. (B) mRNA levels in testis from prepubertal (12 days), pubertal (24 days) and adult (12 weeks) mice. (C) mRNA levels of GLUT8 in 3T3-L1 fibroblasts and adipocytes. Samples of 20 g RNA from the indicated tissues or cells were separated on an agarose gel and transferred on to nylon membrane; blots were hybridized with a mouse GLUT8 cDNA probe.
⫺277 to ⫺50 exhibited significant sequence similarity (71%) with the corresponding region of the human gene (Fig. 1B). This sequence contains a GC-rich region and several palindromic elements. A computerized analysis of the sequence (TRANSFAC 4.0) suggested the presence of a CAAT-box (starting at base ⫺192), two consensus motifs for binding of the transcription factor NF1 (15–17), and a consensus motif for binding of the male sex-determining transcription factor SRY (18). Promoter activity of the 5⬘-flanking region of Glut8. To determine the region of the Glut8 promoter three constructs of the 5⬘-flanking region of exon 1 (⫺590 to ⫹25; ⫺381 to ⫹25; ⫺214 to ⫹25) were transiently expressed in HEK-293T cells as luciferase fusion constructs. As shown in Fig. 1C, the constructs ⫺590 to ⫹25 and ⫺381 to ⫹25 exhibited comparable luciferase activity. These two constructs contain all putative transcription factor binding sites that are conserved in the 5⬘-flanking region of both the mouse and the human GLUT8 genes (SRY, NF1). After deletion of the putative SRY and one NF1 site (⫺214 to ⫹25), promoter activity was reduced by 50%. This result indicates that the region between ⫺381 and the transcription start harbors critical promoter elements, and
971
Vol. 288, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Regulation of expression of GLUT8 in 3T3-L1 cells by glucose and hypoxia. (A) 3T3-L1 fibroblasts or adipocytes were incubated with or without 250 nM insulin for 24 h. (B) 3T3-L1 adipocytes were incubated without or with 25 mM glucose, fructose, galactose or glucosamine for 24 h. (C) 3T3-L1 adipocytes were incubated for the indicated time in the absence of glucose. (D) 3T3-L1 fibroblasts or adipocytes were incubated for the indicated times under hypoxic conditions (95% N 2/5% CO 2). Samples of 20 g RNA from the indicated cells were separated on an agarose gel and transferred onto nylon membrane; blots were hybridized with a mouse GLUT8 cDNA probe.
suggest that the conserved motifs (Fig. 1B) may represent binding sites of transcription factors. Expression of GLUT8 mRNA in testis and insulinsensitive tissues. The tissue distribution of GLUT8 was assessed by Northern blot analysis of RNA from adult mouse tissues. The strongest expression was seen in testis, with moderate expression in tissues exhibiting insulin-sensitive glucose transport (heart, skeletal muscle, fat) and liver (Fig. 2A). These data indicate that the expression pattern of GLUT8 in mouse is comparable with that in humans (4, 5). Because of the predominant expression of GLUT8 in testis we studied its expression in testis from prepu-
bertal, pubertal and adult mice. As illustrated in Fig. 2B, GLUT8 is absent in testes from prepubertal mice but present in pubertal and adult animals. This result indicates that GLUT8 expression in testis is dependent on gonadotropins, and suggests that GLUT8 is associated with male germ cells. The predominant expression of GLUT8 in testes is consistent with the presence of an SRY binding element in the promoter region of both genes. SRY is a Y-chromosomal gene that triggers the development of the male phenotype in mammalian embryos (19), and is necessary for the development of Sertoli cells, Leydig cells, and the testis (18). Interestingly, we identified 4
972
Vol. 288, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
putative SRY binding sites in the 5⬘-region of the Glut5 gene (Accession No. AF233337; between ⫺2005 and ⫺1974) by a database search with the TRANSFAC program. GLUT5 is a fructose transporter which is highly expressed in mature sperm cells (20, 21). Thus, SRY binding elements could play a role for the germ cell-specific expression of both GLUT5 and GLUT8 expression in testis. Differential expression of GLUT8 in 3T3-L1 cells. Since GLUT8 mRNA was detected in adipose tissue (Fig. 2A), we investigated its expression in the 3T3-L1 preadipocyte cell line. As is illustrated in Fig. 2C, mRNA levels of GLUT8 were markedly increased after differentiation of cells to the adipocyte-like phenotype. Thus, GLUT8 may specifically be involved in the regulation of glucose metabolism of the fat cell. However, in contrast to GLUT1 and GLUT4 (22), expression of GLUT8 was not altered by treatment with insulin for 24 h (Fig. 3A). Differential expression of many genes in 3T3-L1 adipocytes is regulated by the transcription factors C/EBP and/or PPAR␥. Binding elements for these transcription factors exhibit a marked sequence variability and can therefore not be detected on the basis of a sequence analysis alone. However, the NF1 binding elements that are present in the promoter region of GLUT8 might participate in the adipose specific gene expression of the transporter. NF1 has been described to mediate the expression of adipocyte and mammary cell-specific genes (23). In addition, NF1 mediates the repression of the Glut4 promoter in response to cAMP and insulin (24, 25). The expression of GLUT8 in 3T3-L1 adipocytes is regulated by glucose. The expression of the glucose transporter GLUT1 in 3T3-L1 cells is regulated by metabolic conditions, e.g., the ambient glucose concentration (26, 27). Thus, we studied the effects of glucose deprivation and its reversal by glucose, fructose, galactose or glucosamine on GLUT8 mRNA levels in 3T3-L1 adipocytes. As is illustrated in Figs. 3B and 3C, culture of cells for 24 h in the absence of glucose markedly reduced GLUT8 mRNA levels as compared to cells cultured in the presence of glucose. This decrease progressed over a time period of 48 h (Fig. 3C). Galactose, but not fructose or glucosamine, could partially reverse the effect of the glucose deprivation (Fig. 3B). Hypoxia has previously been shown to stimulate glucose transport (28, 29), and to markedly increase the expression of GLUT1 (30, 31). In order to investigate the expression of GLUT8 in response to hypoxia, 3T3-L1 fibroblasts and adipocytes were cultured under an atmosphere of 95% N 2/5% CO 2 over a time period of 24 and 48 h, respectively. As illustrated in Fig. 3D, 12 h of hypoxia markedly decreased GLUT8 mRNA levels in differentiated 3T3-L1 cells. In contrast, GLUT8 mRNA was unaltered after 24 h of hypoxia in the fibroblasts.
The regulated expression of GLUT8 in 3T3-L1 cells suggests that this transporter plays an important role in glucose uptake of the adipocyte. This conclusion is supported by the finding that GLUT8 expression is sensitive both to the ambient glucose concentration and to hypoxia. The present data show that the regulation of GLUT8 expression in adipocytes differs strikingly from that of GLUT1 and GLUT4. GLUT1 expression is increased by glucose deprivation, whereas that of GLUT4 is unaltered (26). It might be speculated, therefore, that this reciprocal regulation of GLUT1 and GLUT8 gene expression represents a complex mechanism adapting the cells to requirements of substrate shortage. ACKNOWLEDGMENTS The skillful technical assistance of S. Detro-Dassen is gratefully acknowledged. We also thank Walter Becker for critical reading of the manuscript. This work was supported by grants from the Deutsche Forschungsgemeinschaft (Schu 750/4) and from the Medical Faculty of the Technical University, Aachen (START program).
REFERENCES 1. Barrett, M. P., Walmsley, A. R., and Gould, G. W. (1999) Structure and function of facilitative sugar transporters. Curr. Opin. Cell Biol. 11, 496 –502. 2. Mueckler, M. (1994) Facilitative glucose transporters. Eur. J. Biochem. 219, 713–725. 3. Doege, H., Bocianski, A., Joost, H.-G., and Schu¨rmann, A. (2000) Activity and genomic organization of human glucose transporter 9 (GLUT9), a novel member of the family of sugar-transport facilitators predominantly expressed in brain and leucocytes. Biochem. J. 15, 771–776. 4. Doege, H., Schu¨rmann, A., Bahrenberg, G., Brauers, A., and Joost, H.-G. (2000) GLUT8, a novel member of the sugar transport facilitator family with glucose transport activity. J. Biol. Chem. 275, 16275–16280. 5. Ibberson, M., Uldry, M., and Thorens, B. (2000) GLUTX1, a novel mammalian glucose transporter expressed in the central nervous system and insulin-sensitive tissues. J. Biol. Chem. 275, 4607– 4612. 6. Phay, J. E., Hussain, H. B., and Moley, J. F. (2000) Cloning and expression analysis of a novel member of the facilitative glucose transporter family, SLC2A9 (GLUT9). Genomics 66, 217–220. 7. McVie-Wylie, A. J., Lamson, D. R., and Chen, Y. T. (2001) Molecular cloning of a novel member of the GLUT family of transporters, SLC2a10 (GLUT10), localized on chromosome 20q13.1: A candidate gene for NIDDM susceptibility. Genomics 72, 113– 117. 8. Doege, H., Bocianski, Scheepers, Axer, H., Eckel, J., Joost, H.-G., and Schu¨rmann, A. (2001) Characterization of human glucose transporter (GLUT)11 (SLC2A11), a novel sugar-transport facilitator specifically expressed in heart and skeletal muscle. Biochem. J., in press. 9. Uldry, M., Ibberson, M., Horisberger, J. D., Chatton, J. Y., Riederer, B. M., and Thorens, B. (2001) Identification of a mammalian H(⫹)-myo-inositol symporter expressed predominantly in the brain. EMBO J. 20, 4467– 4477. 10. Joost, H.-G., and Thorens, B. (2001) The extended GLUT-family of sugar/polyol transport facilitators—Nomenclature, sequence
973
Vol. 288, No. 4, 2001
11.
12.
13.
14.
15.
16.
17.
18. 19. 20.
21.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
characteristics, and potential function of its novel members. Mol. Membr. Biol., in press. Carayannopoulos, M. O., Chi, M. M., Cui, Y., Pingsterhaus, J. M., McKnight, R. A., Mueckler, M., Devaskar, S. U., and Moley, K. H. (2000) GLUT8 is a glucose transporter responsible for insulin-stimulated glucose uptake in the blastocyst. Proc. Natl. Acad. Sci. USA 97, 7313–7318. Lisinski, I., Schu¨rmann, A., Joost, H.-G., Cushman, S. W., and Al-Hasani, H. (2001) Targeting of GLUT6 (formerly GLUT9) and GLUT8 in rat adipose cells. Biochem. J. 358, 517–522. Weiland, M., Bahr, F., Ho¨hne, M., Schu¨rmann, A., Ziehm, D., and Joost, H.-G. (1991) The signaling potential of the receptors for insulin and insulin-like growth factor I (IGF-I) in 3T3-L1 adipocytes: Comparison of glucose transport activity, induction of oncogene c-fos, glucose transporter mRNA, and DNAsynthesis. J. Cell. Physiol. 149, 428 – 435. Chirgwin, J. M., Przybyla, A. E., McDonald, R. J., and Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochem. J. 18, 5294 –5299. Lee, M., Yu, S., and Park, J. (2000) Characterization of a nuclear factor that binds to AP1-like element in the rat p53 promoter during liver regeneration. J. Cell. Biochem. 78, 1–7. Nayak, B. K., and Das, B. R. (1999) Differential binding of NF1 transcription factor to p53 gene promoter and its depletion in human breast tumours. Mol. Biol. Rep. 26, 223–230. Gao, B., and Kunos, G. (1998) Cell type-specific transcriptional activation and suppression of the alpha1B adrenergic receptor gene middle promoter by nuclear factor 1. J. Biol. Chem. 273, 31784 –31787. Lamb, D. J. (1995) Genes involved in testicular development and function. World J. Urol. 13, 277–284. Koopman, P. (1999) Sry and Sox9: Mammalian testisdetermining genes. Cell. Mol. Life Sci. 55, 839 – 856. Rand, E. B., Depaoli, A. M., Davidson, N. O., Bell, G. I., and Burant, C. F. (1993) Sequence, tissue distribution, and functional characterization of the rat fructose transporter GLUT5. Am. J. Physiol. 264, G1169 –G1176. Burant, C. F., Takeda, J., Brot-Laroche, E., Bell, G. I., and Davidson, N. O. (1992) Fructose transporter in human sperma-
22.
23.
24.
25.
26.
27.
28. 29. 30.
31.
974
tozoa and small intestine is GLUT5. J. Biol. Chem. 267, 14523– 14526. Taha, C., Liu, Z., Jin, J., Al-Hasani, H., Sonenberg, N., and Klip, A. (1999) Opposite translational control of GLUT1 and GLUT4 glucose transporter mRNAs in response to insulin. Role of mammalian target of rapamycin, protein kinase B, and phosphatidylinositol 3-kinase in GLUT1 mRNA translation. J. Biol. Chem. 274, 33085–33091. Nebl, G., Mermod, N., and Cato, A. C. (1994) Post-transcriptional down-regulation of expression of transcription factor NF1 by Ha-ras oncogene. J. Biol. Chem. 269, 7371–7378. Cooke, D. W., and Lane, M. D. (1999) Transcription factor NF1 mediates repression of the GLUT4 promoter by cyclic-AMP. Biochem. Biophys. Res. Commun. 260, 600 – 604. Cooke, D. W., and Lane, M. D. (1999) The transcription factor nuclear factor I mediates repression of the GLUT4 promoter by insulin. J. Biol. Chem. 274, 12917–12924. Koivisto, U. M., Martinez-Valdez, H., Bilan, P. J., Burdett, E., Ramlal, T., and Klip, A. (1991) Differential regulation of the GLUT-1 and GLUT-4 glucose transport systems by glucose and insulin in L6 muscle cells in culture. J. Biol. Chem. 266, 2615– 2621. von der Crone, S., Deppe, C., Barthel, A., Sasson, S., Joost, H.-G., and Schu¨rmann, A. (2000) Glucose deprivation induces Aktdependent synthesis and incorporation of GLUT1, but not of GLUT4, into the plasma membrane of 3T3-L1 adipocytes. Eur. J. Cell. Biol. 79, 943–949. Ismail-Beigi, F. (1993) Metabolic regulation of glucose transport. J. Membr. Biol. 135, 1–10. Zhang, J. Z., Behrooz, A., and Ismail-Beigi, F. (1999) Regulation of glucose transport by hypoxia. Am. J. Kidney Dis. 34, 189 –202. Hamrahian, A. H., Zhang, J.-Z., Elkhairi, F. S., Prasad, R., and Ismail-Beigi, F. (1999) Activation of Glut1 glucose transporter in response to inhibition of oxidative phosphorylation. Arch. Biochem. Biophys. 368, 375–379. Carrier, V., Rodolosse, A., Lcasa, M., Cambier, D., Zweibaum, A., and Rousset, M. (1998) Hypoxia and CYP1A1 induction-dependent regulation of proteins involved in glucose utilization in Caco-2 cells. Am. J. Physiol. 274, G1101–G1108.
Mouse GLUT8: Genomic Organization and Regulation of Expression in 3T3-L1 Adipocytes by Glucose A. Scheepers, H. Doege, H.-G. Joost, and A. Schu¨rmann 1 Institute of Pharmacology and Toxicology, Medical Faculty, Technical University of Aachen, D-52057 Aachen, Germany
Received September 28, 2001
Glucose transporter 8 (GLUT8) is a class III sugar transport facilitator predominantly expressed in testis and insulin-regulated tissues. Here we describe its genomic organization, the identification of its promoter region, and the regulation of its expression in 3T3-L1 cells. The mouse Glut8 gene spans approximately 9 kb, consists of 10 exons, and is highly similar to the human GLUT6 gene. Its 5ⴕ-flanking region exhibits promoter activity when fused with a luciferase reporter construct and expressed in HEK-293T cells. A deletion analysis indicated that the critical promoter elements are located in a region between ⴚ381 and the transcription start. This region comprises a CAAT box and consensus binding sites for the transcription factors SRY and NF1 that were highly conserved in the mouse and in the human sequence. In 3T3-L1 cells, GLUT8 mRNA levels increased markedly during the differentiation of cells. In contrast to GLUT1, expression of GLUT8 mRNA was significantly reduced by glucose deprivation and by prolonged hypoxia. The present data suggest that the function of GLUT8 is related to the adipocyte-like phenotype of 3T3-L1 cells, and that its expression is controlled by the metabolism of the adipocyte. © 2001 Academic Press
Hexose transport into mammalian cells requires specific carriers that catalyze the facilitated diffusion of sugars through the plasma membrane. These sugar transporters (GLUT1–5, gene symbols SLC2A1–5) have been known for more than 10 years (1). They belong to a family of membrane proteins which are characterized by 12 membrane spanning helices and a large intracellular loop connecting the helices 6 and 7 (2). Recently, several additional members of the GLUT family (GLUT6 –12, HMIT) have been identified by us Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. AJ413951 for Mus musculus SLC2A8 gene for glucose transporter 8. 1 To whom correspondence and reprint requests should be addressed. Fax: 49-241-8082433. E-mail: [email protected]. rwth-aachen.de.
and by others by cDNA cloning taking advantage of sequence information from expressed sequence tags and genomic sequence (3–9, for a review, see 10). Among the novel members of the GLUT family, human GLUT8 is so far the best characterized sugar transporter. Its sequence exhibits all elements and motifs (sugar transporter signatures) that are characteristic for the GLUT family, e.g., 12 membrane spanning helices, the GRR/K motifs in the loops 2 and 8, glutamate and arginine residues in the loops 4 and 10, the PESPR and the PETKG motifs after helices 6 and 12, respectively, and several other highly conserved residues (4). GLUT8 is a member of a subfamily (class III GLUTs, comprising GLUT6, GLUT10, GLUT12, and HMIT) which is mainly characterized by a larger and presumably glycosylated extracellular loop 9 (10). In spite of only 29.4% identical amino acids with GLUT1, human GLUT8 exhibits high-affinity glucose transport activity (4, 5). In addition, glucose transport activity is inhibitable by fructose, suggesting that GLUT8 is a dual-specific sugar transporter (5). mRNA of human GLUT8 was predominantly found in testis, lower amounts of RNA were detected in most other tissues including insulin-sensitive tissues (4, 5). In addition, mRNA and protein expression of human GLUT8 has also been detected in the blastocyst (11). The N-terminus of the GLUT8 harbors a dileucine motif which directs the protein to intracellular compartments when expressed in Xenopus oocytes, HEK293T cells (5), isolated fat cells and COS-7 cells (12). Mutation of the dileucine motif to alanines targets the protein to the cell membrane in all so far investigated expression systems. Interestingly, coexpression of a dominant negative dynamin mutant produces complete translocation of the GLUT8 to the plasma membrane (12). Thus, it seems reasonable to assume that the activity of these isotypes is regulated by cellular redistribution in response to yet unknown signals. Translocation of the GLUT8 in response to insulin has been reported in blastocysts (11). In fat cells transfected with a HA-tagged GLUT8 construct; however,
969
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
Vol. 288, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Organization of the mouse Glut8 gene, comparison with human GLUT6 and GLUT8, and analysis of its promoter. (A) Schematic representation of the exon–intron organization of mouse Glut8, human GLUT8 and human GLUT6 genes. Boxes represent exons as identified by the comparison with cDNA; the coding regions are drawn as shaded boxes. Localization of sequence motifs that are essential for the function of the transporter (sugar transporter signatures) on the exons are indicated. (B) Comparison of nucleotide sequence of the 5⬘-flanking region of the mouse and human GLUT8 gene. The numbers refer to the positions in the gene, where ⫹1 is the transcription initiation site. Putative cis-elements are boxed. (C) Deletion analysis of the Glut8 promoter. Constructs of the 5⬘-flanking region of exon1 of the Glut8 gene were generated by PCR and fused to the luciferase cDNA in the pGL3-basic vector. HEK-293T cells were transiently transfected with these Glut8 promoter–reporter constructs and luciferase activities were measured 48 h after transfection. Results represent means ⫾ SD of triplicate samples (transfections) from a representative experiment that was repeated three times.
insulin as well as several other agents failed to produce translocation of the protein (12). All so far available data are compatible with the assumption that GLUT8 participates in the regulation of glucose uptake by fat and muscle tissue. The present study was initiated to provide the basis for further studies of the transcriptional control of GLUT8. Here we describe the genomic organization of the mouse Glut8 gene, its promoter region, and its regulation of expression in 3T3-L1 adipose cells by the state of differentiation and by metabolic conditions, i.e. the ambient glucose concentration and the oxygenation of cells. METHODS Library screening and DNA sequencing. A genomic library (library number 121) generated from spleen of 129/Ola mice was obtained from the Resource Center/Primary Database of the German Human Genome Projekt (RZPD, Berlin, Germany). The library consisted of approximately 300,000 single cosmid clones (MboI digest,
Lawrist 7 vector) spotted on to nylon filters. The filters were hybridized with a full length cDNA probe of mouse GLUT8 (4). Two positive genomic clones were identified, and fragments were prepared by sonication and digestion with restriction enzymes. The fragments were subcloned into pUC18 and sequenced in both directions by the method of Sanger with the aid of an automated sequencer (LI-COR, Lincoln, NE). Promoter analysis. DNA fragments of the 5⬘-flanking region of the Glut8 gene were generated by PCR (⫺590 to ⫹25, forward: CAAGCACCAGGAATGCATGG; ⫺381 to ⫹25, forward: CTCAGGGAAGTTTACTTCG; ⫺214 to ⫹25, forward: CCTTCAGACTCACACCACAC; reverse: GTCAGCAGGACCTGACC). Constructs were fused to luciferase cDNA in the vector pGL3-basic (Promega, Madison, WI). These constructs were transiently transfected into HEK-293T cells with the aid of FuGene 6-Reagent (Boehringer Mannheim GmbH, Mannheim, Germany). 48 h after transfection, cells were lysed, and luciferase activity was analyzed with a kit from Promega (Luciferase Assay System) according to the instructions of the manufacturer. 3T3-L1 cells. 3T3-L1 cells were obtained from American Type Culture Collection (Rockville, MD), and were grown and differentiated as described previously (13). Incubation with fructose, galactose, glucosamine (25 mM) or glucose deprivation was initiated 8 –10
970
Vol. 288, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
days after the start of differentiation. Hypoxic conditions were generated by culture of cells in an atmosphere of 95% N 2/5% CO 2. Northern blot analysis. Total RNA was isolated from 3T3-L1 cells or the indicated mouse tissues according to the method of Chirgwin et al. (14). Samples (20 g) of total RNA were separated by electrophoresis on 1% (w/v) agarose gels containing 1% (v/v) formaldehyde and were transferred on to nylon membranes (Hybond N ⫹; Amersham-Pharmacia, Freiburg, Germany). Probes were generated with the Klenow fragment of DNA polymerase I and [␣- 32P]dCTP by random oligonucleotide priming. The nylon membranes were hybridized for 16 h at 42°C and blots were washed twice with 0.8% SSC containing 0.1% SDS.
RESULTS AND DISCUSSION Genomic organization of the mouse Glut8 gene. Two cosmid clones comprising mouse Glut8 were isolated in the screen of the genomic 129/Ola library. The cosmid DNAs were analyzed by restriction fragmentation and hybridization with probes derived from the 5⬘ (1–91 bp; 571–778 bp) and the 3⬘ (1221–1490 bp) end of the mouse GLUT8 cDNA. In addition, fragments from these clones covering the complete gene were subcloned and sequenced. Intron– exon boundarys were identified by a comparison of the genomic sequence with the cDNA sequences of GLUT8. Figure 1A illustrates the genomic organization of mouse Glut8. The gene spans approximately 9 kb and consists of 10 exons. The transcription start was defined with the longest 5⬘-RACE product that was amplified from mouse testis mRNA (4). The presumable translation start of the murine Glut8 could be defined at the first ATG after a stop codon in exon 1. In order to compare the human and mouse GLUT8 genes, the exon–intron borders of the human GLUT8 gene were mapped by a comparison of the genomic sequence as identified in a database search (Clone RP11-356B19, EMBL Accession No. AL445222) with the GLUT8 cDNA (GenBank Accession No. Y17801). As is illustrated in Fig. 1A, mouse and human GLUT8 are identical with regard to exon number and size, and highly similar with regard to intron size. A comparison of the GLUT8 gene structure with the human GLUT6 gene (3) reveals a striking homology of these genes: GLUT6 spans approximately 8 kb and also consists of 10 exons. Moreover, the distribution of the coding region over 10 exons is nearly identical, as indicated by the localization of critical transporter signatures (e.g., GRK and DLGRK) on exactly corresponding exons (Fig. 1A). This high degree of homology, and also the localization of human GLUT8 and GLUT6 in close proximity on chromosome 9 (GLUT8 at position 123,556 K and GLUT6 at position 128,574) suggest that the two genes have evolved by gene duplication. In order to identify the promoter region of GLUT8 and its presumable regulatory elements, the 5⬘flanking region of the mouse Glut8 gene (1054 bp) was analyzed by alignment with the corresponding genomic sequence of the human gene. Only a small portion from
FIG. 2. Northern blot analysis of the expression of GLUT8. (A) mRNA levels of GLUT8 in different mouse tissues. (B) mRNA levels in testis from prepubertal (12 days), pubertal (24 days) and adult (12 weeks) mice. (C) mRNA levels of GLUT8 in 3T3-L1 fibroblasts and adipocytes. Samples of 20 g RNA from the indicated tissues or cells were separated on an agarose gel and transferred on to nylon membrane; blots were hybridized with a mouse GLUT8 cDNA probe.
⫺277 to ⫺50 exhibited significant sequence similarity (71%) with the corresponding region of the human gene (Fig. 1B). This sequence contains a GC-rich region and several palindromic elements. A computerized analysis of the sequence (TRANSFAC 4.0) suggested the presence of a CAAT-box (starting at base ⫺192), two consensus motifs for binding of the transcription factor NF1 (15–17), and a consensus motif for binding of the male sex-determining transcription factor SRY (18). Promoter activity of the 5⬘-flanking region of Glut8. To determine the region of the Glut8 promoter three constructs of the 5⬘-flanking region of exon 1 (⫺590 to ⫹25; ⫺381 to ⫹25; ⫺214 to ⫹25) were transiently expressed in HEK-293T cells as luciferase fusion constructs. As shown in Fig. 1C, the constructs ⫺590 to ⫹25 and ⫺381 to ⫹25 exhibited comparable luciferase activity. These two constructs contain all putative transcription factor binding sites that are conserved in the 5⬘-flanking region of both the mouse and the human GLUT8 genes (SRY, NF1). After deletion of the putative SRY and one NF1 site (⫺214 to ⫹25), promoter activity was reduced by 50%. This result indicates that the region between ⫺381 and the transcription start harbors critical promoter elements, and
971
Vol. 288, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Regulation of expression of GLUT8 in 3T3-L1 cells by glucose and hypoxia. (A) 3T3-L1 fibroblasts or adipocytes were incubated with or without 250 nM insulin for 24 h. (B) 3T3-L1 adipocytes were incubated without or with 25 mM glucose, fructose, galactose or glucosamine for 24 h. (C) 3T3-L1 adipocytes were incubated for the indicated time in the absence of glucose. (D) 3T3-L1 fibroblasts or adipocytes were incubated for the indicated times under hypoxic conditions (95% N 2/5% CO 2). Samples of 20 g RNA from the indicated cells were separated on an agarose gel and transferred onto nylon membrane; blots were hybridized with a mouse GLUT8 cDNA probe.
suggest that the conserved motifs (Fig. 1B) may represent binding sites of transcription factors. Expression of GLUT8 mRNA in testis and insulinsensitive tissues. The tissue distribution of GLUT8 was assessed by Northern blot analysis of RNA from adult mouse tissues. The strongest expression was seen in testis, with moderate expression in tissues exhibiting insulin-sensitive glucose transport (heart, skeletal muscle, fat) and liver (Fig. 2A). These data indicate that the expression pattern of GLUT8 in mouse is comparable with that in humans (4, 5). Because of the predominant expression of GLUT8 in testis we studied its expression in testis from prepu-
bertal, pubertal and adult mice. As illustrated in Fig. 2B, GLUT8 is absent in testes from prepubertal mice but present in pubertal and adult animals. This result indicates that GLUT8 expression in testis is dependent on gonadotropins, and suggests that GLUT8 is associated with male germ cells. The predominant expression of GLUT8 in testes is consistent with the presence of an SRY binding element in the promoter region of both genes. SRY is a Y-chromosomal gene that triggers the development of the male phenotype in mammalian embryos (19), and is necessary for the development of Sertoli cells, Leydig cells, and the testis (18). Interestingly, we identified 4
972
Vol. 288, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
putative SRY binding sites in the 5⬘-region of the Glut5 gene (Accession No. AF233337; between ⫺2005 and ⫺1974) by a database search with the TRANSFAC program. GLUT5 is a fructose transporter which is highly expressed in mature sperm cells (20, 21). Thus, SRY binding elements could play a role for the germ cell-specific expression of both GLUT5 and GLUT8 expression in testis. Differential expression of GLUT8 in 3T3-L1 cells. Since GLUT8 mRNA was detected in adipose tissue (Fig. 2A), we investigated its expression in the 3T3-L1 preadipocyte cell line. As is illustrated in Fig. 2C, mRNA levels of GLUT8 were markedly increased after differentiation of cells to the adipocyte-like phenotype. Thus, GLUT8 may specifically be involved in the regulation of glucose metabolism of the fat cell. However, in contrast to GLUT1 and GLUT4 (22), expression of GLUT8 was not altered by treatment with insulin for 24 h (Fig. 3A). Differential expression of many genes in 3T3-L1 adipocytes is regulated by the transcription factors C/EBP and/or PPAR␥. Binding elements for these transcription factors exhibit a marked sequence variability and can therefore not be detected on the basis of a sequence analysis alone. However, the NF1 binding elements that are present in the promoter region of GLUT8 might participate in the adipose specific gene expression of the transporter. NF1 has been described to mediate the expression of adipocyte and mammary cell-specific genes (23). In addition, NF1 mediates the repression of the Glut4 promoter in response to cAMP and insulin (24, 25). The expression of GLUT8 in 3T3-L1 adipocytes is regulated by glucose. The expression of the glucose transporter GLUT1 in 3T3-L1 cells is regulated by metabolic conditions, e.g., the ambient glucose concentration (26, 27). Thus, we studied the effects of glucose deprivation and its reversal by glucose, fructose, galactose or glucosamine on GLUT8 mRNA levels in 3T3-L1 adipocytes. As is illustrated in Figs. 3B and 3C, culture of cells for 24 h in the absence of glucose markedly reduced GLUT8 mRNA levels as compared to cells cultured in the presence of glucose. This decrease progressed over a time period of 48 h (Fig. 3C). Galactose, but not fructose or glucosamine, could partially reverse the effect of the glucose deprivation (Fig. 3B). Hypoxia has previously been shown to stimulate glucose transport (28, 29), and to markedly increase the expression of GLUT1 (30, 31). In order to investigate the expression of GLUT8 in response to hypoxia, 3T3-L1 fibroblasts and adipocytes were cultured under an atmosphere of 95% N 2/5% CO 2 over a time period of 24 and 48 h, respectively. As illustrated in Fig. 3D, 12 h of hypoxia markedly decreased GLUT8 mRNA levels in differentiated 3T3-L1 cells. In contrast, GLUT8 mRNA was unaltered after 24 h of hypoxia in the fibroblasts.
The regulated expression of GLUT8 in 3T3-L1 cells suggests that this transporter plays an important role in glucose uptake of the adipocyte. This conclusion is supported by the finding that GLUT8 expression is sensitive both to the ambient glucose concentration and to hypoxia. The present data show that the regulation of GLUT8 expression in adipocytes differs strikingly from that of GLUT1 and GLUT4. GLUT1 expression is increased by glucose deprivation, whereas that of GLUT4 is unaltered (26). It might be speculated, therefore, that this reciprocal regulation of GLUT1 and GLUT8 gene expression represents a complex mechanism adapting the cells to requirements of substrate shortage. ACKNOWLEDGMENTS The skillful technical assistance of S. Detro-Dassen is gratefully acknowledged. We also thank Walter Becker for critical reading of the manuscript. This work was supported by grants from the Deutsche Forschungsgemeinschaft (Schu 750/4) and from the Medical Faculty of the Technical University, Aachen (START program).
REFERENCES 1. Barrett, M. P., Walmsley, A. R., and Gould, G. W. (1999) Structure and function of facilitative sugar transporters. Curr. Opin. Cell Biol. 11, 496 –502. 2. Mueckler, M. (1994) Facilitative glucose transporters. Eur. J. Biochem. 219, 713–725. 3. Doege, H., Bocianski, A., Joost, H.-G., and Schu¨rmann, A. (2000) Activity and genomic organization of human glucose transporter 9 (GLUT9), a novel member of the family of sugar-transport facilitators predominantly expressed in brain and leucocytes. Biochem. J. 15, 771–776. 4. Doege, H., Schu¨rmann, A., Bahrenberg, G., Brauers, A., and Joost, H.-G. (2000) GLUT8, a novel member of the sugar transport facilitator family with glucose transport activity. J. Biol. Chem. 275, 16275–16280. 5. Ibberson, M., Uldry, M., and Thorens, B. (2000) GLUTX1, a novel mammalian glucose transporter expressed in the central nervous system and insulin-sensitive tissues. J. Biol. Chem. 275, 4607– 4612. 6. Phay, J. E., Hussain, H. B., and Moley, J. F. (2000) Cloning and expression analysis of a novel member of the facilitative glucose transporter family, SLC2A9 (GLUT9). Genomics 66, 217–220. 7. McVie-Wylie, A. J., Lamson, D. R., and Chen, Y. T. (2001) Molecular cloning of a novel member of the GLUT family of transporters, SLC2a10 (GLUT10), localized on chromosome 20q13.1: A candidate gene for NIDDM susceptibility. Genomics 72, 113– 117. 8. Doege, H., Bocianski, Scheepers, Axer, H., Eckel, J., Joost, H.-G., and Schu¨rmann, A. (2001) Characterization of human glucose transporter (GLUT)11 (SLC2A11), a novel sugar-transport facilitator specifically expressed in heart and skeletal muscle. Biochem. J., in press. 9. Uldry, M., Ibberson, M., Horisberger, J. D., Chatton, J. Y., Riederer, B. M., and Thorens, B. (2001) Identification of a mammalian H(⫹)-myo-inositol symporter expressed predominantly in the brain. EMBO J. 20, 4467– 4477. 10. Joost, H.-G., and Thorens, B. (2001) The extended GLUT-family of sugar/polyol transport facilitators—Nomenclature, sequence
973
Vol. 288, No. 4, 2001
11.
12.
13.
14.
15.
16.
17.
18. 19. 20.
21.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
characteristics, and potential function of its novel members. Mol. Membr. Biol., in press. Carayannopoulos, M. O., Chi, M. M., Cui, Y., Pingsterhaus, J. M., McKnight, R. A., Mueckler, M., Devaskar, S. U., and Moley, K. H. (2000) GLUT8 is a glucose transporter responsible for insulin-stimulated glucose uptake in the blastocyst. Proc. Natl. Acad. Sci. USA 97, 7313–7318. Lisinski, I., Schu¨rmann, A., Joost, H.-G., Cushman, S. W., and Al-Hasani, H. (2001) Targeting of GLUT6 (formerly GLUT9) and GLUT8 in rat adipose cells. Biochem. J. 358, 517–522. Weiland, M., Bahr, F., Ho¨hne, M., Schu¨rmann, A., Ziehm, D., and Joost, H.-G. (1991) The signaling potential of the receptors for insulin and insulin-like growth factor I (IGF-I) in 3T3-L1 adipocytes: Comparison of glucose transport activity, induction of oncogene c-fos, glucose transporter mRNA, and DNAsynthesis. J. Cell. Physiol. 149, 428 – 435. Chirgwin, J. M., Przybyla, A. E., McDonald, R. J., and Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochem. J. 18, 5294 –5299. Lee, M., Yu, S., and Park, J. (2000) Characterization of a nuclear factor that binds to AP1-like element in the rat p53 promoter during liver regeneration. J. Cell. Biochem. 78, 1–7. Nayak, B. K., and Das, B. R. (1999) Differential binding of NF1 transcription factor to p53 gene promoter and its depletion in human breast tumours. Mol. Biol. Rep. 26, 223–230. Gao, B., and Kunos, G. (1998) Cell type-specific transcriptional activation and suppression of the alpha1B adrenergic receptor gene middle promoter by nuclear factor 1. J. Biol. Chem. 273, 31784 –31787. Lamb, D. J. (1995) Genes involved in testicular development and function. World J. Urol. 13, 277–284. Koopman, P. (1999) Sry and Sox9: Mammalian testisdetermining genes. Cell. Mol. Life Sci. 55, 839 – 856. Rand, E. B., Depaoli, A. M., Davidson, N. O., Bell, G. I., and Burant, C. F. (1993) Sequence, tissue distribution, and functional characterization of the rat fructose transporter GLUT5. Am. J. Physiol. 264, G1169 –G1176. Burant, C. F., Takeda, J., Brot-Laroche, E., Bell, G. I., and Davidson, N. O. (1992) Fructose transporter in human sperma-
22.
23.
24.
25.
26.
27.
28. 29. 30.
31.
974
tozoa and small intestine is GLUT5. J. Biol. Chem. 267, 14523– 14526. Taha, C., Liu, Z., Jin, J., Al-Hasani, H., Sonenberg, N., and Klip, A. (1999) Opposite translational control of GLUT1 and GLUT4 glucose transporter mRNAs in response to insulin. Role of mammalian target of rapamycin, protein kinase B, and phosphatidylinositol 3-kinase in GLUT1 mRNA translation. J. Biol. Chem. 274, 33085–33091. Nebl, G., Mermod, N., and Cato, A. C. (1994) Post-transcriptional down-regulation of expression of transcription factor NF1 by Ha-ras oncogene. J. Biol. Chem. 269, 7371–7378. Cooke, D. W., and Lane, M. D. (1999) Transcription factor NF1 mediates repression of the GLUT4 promoter by cyclic-AMP. Biochem. Biophys. Res. Commun. 260, 600 – 604. Cooke, D. W., and Lane, M. D. (1999) The transcription factor nuclear factor I mediates repression of the GLUT4 promoter by insulin. J. Biol. Chem. 274, 12917–12924. Koivisto, U. M., Martinez-Valdez, H., Bilan, P. J., Burdett, E., Ramlal, T., and Klip, A. (1991) Differential regulation of the GLUT-1 and GLUT-4 glucose transport systems by glucose and insulin in L6 muscle cells in culture. J. Biol. Chem. 266, 2615– 2621. von der Crone, S., Deppe, C., Barthel, A., Sasson, S., Joost, H.-G., and Schu¨rmann, A. (2000) Glucose deprivation induces Aktdependent synthesis and incorporation of GLUT1, but not of GLUT4, into the plasma membrane of 3T3-L1 adipocytes. Eur. J. Cell. Biol. 79, 943–949. Ismail-Beigi, F. (1993) Metabolic regulation of glucose transport. J. Membr. Biol. 135, 1–10. Zhang, J. Z., Behrooz, A., and Ismail-Beigi, F. (1999) Regulation of glucose transport by hypoxia. Am. J. Kidney Dis. 34, 189 –202. Hamrahian, A. H., Zhang, J.-Z., Elkhairi, F. S., Prasad, R., and Ismail-Beigi, F. (1999) Activation of Glut1 glucose transporter in response to inhibition of oxidative phosphorylation. Arch. Biochem. Biophys. 368, 375–379. Carrier, V., Rodolosse, A., Lcasa, M., Cambier, D., Zweibaum, A., and Rousset, M. (1998) Hypoxia and CYP1A1 induction-dependent regulation of proteins involved in glucose utilization in Caco-2 cells. Am. J. Physiol. 274, G1101–G1108.