MTHFR and ACE gene polymorphisms and risk of vascular and degenerative dementias in the elderly

Brain and Cognition 71 (2009) 295–299

Contents lists available at ScienceDirect

Brain and Cognition journal homepage: www.elsevier.com/locate/b&c

MTHFR and ACE gene polymorphisms and risk of vascular and degenerative dementias in the elderly Pratima Pandey a, Sunil Pradhan a,*, Dinesh Raj Modi b, Balraj Mittal c a

Department of Neurology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014, India Department of Biotechnology, Bhim Rao Ambedkar University, Lucknow 226014, India c Department of Genetics, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014, India b

a r t i c l e

i n f o

Article history: Accepted 26 July 2009 Available online 27 August 2009 Keywords: Gene polymorphism Angiotensin converting enzyme gene Methylene-tetrahydrofolate reductase gene Late onset dementia Alzheimer’s disease

a b s t r a c t Focal lacunar infarctions due to cerebral small vessel atherosclerosis or single/multiple large cortical infarcts lead to vascular dementia, and different genes and environmental factors have been implicated in causation or aggravation of the disease. Previous reports suggest that some of the risk factors may be common to both vascular as well as degenerative dementia. Among genetic factors, role of angiotensin converting enzyme (ACE) and methylene-tetrahydrofolate reductase (MTHFR) genes as putative risk factors has been examined but the outcome of these studies remain inconclusive. Present study attempted to see the importance of ACE alu insertion/deletion and MTHFR C677T polymorphisms as genetic predisposers to dementia. The study comprised of 80 vascular dementia patients, 90 degenerative dementia patients and 170 age matched controls. All were genotyped for ACE, MTHFR and APOE polymorphisms using PCR-RFLP method. Frequency of ACE D allele was seemingly high in dementia cases (26.7%) when compared to controls (11.2%). However, after adjusting for age and APOE E4, none of the ACE alleles showed good correlation. MTHFR genotypes or alleles also did not show any correlation. Our study suggests no true correlation of ACE or MTHR genes with dementia in elderly. Ó 2009 Elsevier Inc. All rights reserved.

1. Introduction Dementia is a multifactorial disorder. Besides old age, hyperlipidemia and presence of APOE E4, mid-life hypertension and hyperhomocysteinemia have also been known to contribute significantly to the disease (SBU Report, 2008; http://www.sbu.se/dementia project). Therefore, genes responsible for these risk factors such as ACE and MTHR could have some role to play in dementia. MTHFR gene codes for enzyme methylene-tetrahydrofolate reductase which converts 5, 10 methylene tetrahydrofolate to 5 methyl tetrahydrofolate required for the conversion of homocysteine to methionine (Pandey & Pradhan, 2006). A mutation (C677T) in MTHFR gene codes for aberrant thermo-labile enzyme resulting in raised plasma homocysteine concentration (Frosst et al., 1995). Angiotensin converting enzyme (ACE) regulates systemic blood pressure and fluid electrolyte balance and is encoded by ACE gene. Alu insertion/deletion polymorphism in intron 16 of ACE gene has been found to be associated with both vascular and degenerative dementias (Alvarez et al., 1999; Kehoe et al., 1999; Wang et al., 2006). In vitro studies also indicated the involvement of ACE in degrading amyloid b peptide and preventing its further accumula-

* Corresponding author. Fax: +91 11 22599227. E-mail address: [email protected] (S. Pradhan). 0278-2626/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.bandc.2009.07.007

tion in brains of AD patients (Hu, Igarashi, Kawamata, & Nakagawa, 2001; Kehoe et al., 2003). Objective of the present study is to evaluate the role of ACE I/D and MTHFR C677T polymorphism in vascular and combined degenerative dementias in our regional North Indian cohort. Since, APOE E4 allele is unequivocally associated with increased susceptibility to AD (Rubinsztein & Easton, 1999), we also analysed the effect of ACE and MTHFR in development of cognitive impairment in E4 stratified subset of the studied population.

2. Materials and methods 2.1. Patients Subjects for this study were recruited from the Neurology outpatient clinic of Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow. All patients came from the State of Uttar Pradesh and other surrounding states of North India. The patients who complained of (or if their relatives gave history of) memory or other cognitive impairment, were subjected to mini mental state examination (MMSE) and those having <24/30 score were subjected to detailed neuropsychological testing for abnormalities in behavior, cognition and executive functions. In the neuropsychological examination, patients who fell under DSM IV TR criteria

296

P. Pandey et al. / Brain and Cognition 71 (2009) 295–299

for dementia were taken in the study. Diagnosis of probable AD was made according to NINCDS-ADRDA criteria; while diagnosis of VaD was based on NINDS-AIREN criteria for vascular dementia. Modified Hachinski score was used to differentiate between AD and VaD. Familial cases of cognitive and behavior abnormality, metabolic disorders, toxic encephalopathy and major depression, dementia due to infectious diseases, and structural brain disorders were excluded. The patients were further categorized into vascular and degenerative dementia on the basis of chronology of progression of symptoms, standard neuropsychological examination and MRI of brain. Clinical symptoms of each patient were correlated with the MR image. Patients with poor correlation or those having features of mixed dementia were excluded. The selection criteria for different dementias were as follows. 2.2. Vascular dementia The patients who fulfilled the criteria for dementia and had in addition, evidence of one or more ischemic strokes from history and multiple large cortical infarcts, border-zone/watershed infarcts, small strategic infarcts, for example, bilateral thalamic strokes, multiple lacunar infarcts particularly basal ganglia Leukoaraiosis-extensive white matter disease (sub-cortical leukoencephalopathy). Major parenchyma haemorrhage Cerebral amyloid angiopathy were included in the study. These criteria are in conformity with NINDS-CSN criteria. However, the patients with single clinical stroke and corresponding single large ischemic or hemorrhagic lesion on MRI, who were hospitalised in acute stage of the disease and had cognitive impairment at the time of discharge (2–5 weeks from admission) were excluded from this study. 2.3. Alzheimer’s disease The patients who fulfilled the criteria for dementia and had progressive worsening of two or more cognitive domains in the absence of other systemic or brain disease to account for the condition. The diagnosis was supported by the absence of extrapyramidal symptoms and presence of spatial disorientation in the initial phase of the illness. 2.4. Dementia with Lewy bodies The patients who fulfilled the criteria for dementia and had a progressive course, fluctuating cognition (particularly in attention and alertness), recurrent visual hallucinations (particularly formed hallucinations of people or animals), and parkinsonian features during the early phase of dementia. 2.5. Frontotemporal dementia The patients who fulfilled the criteria for dementia and had behavioral and personality changes early during the evolution of disease, particularly in the domains of mood and personal/social awareness. The patients were included if the cognitive profile was dominated by speech disturbance with relative preservation of practic functions and spatial orientation. Patients with other degenerative brain diseases (such as Parkinson’s disease, CBD, PSP, etc.) were included in this study if they had cardinal features of that disease and dementia developed in late stage of the disorder. 3. Controls Control group comprised of 170 non-related age-matched healthy volunteers aged 45–90 years. None had personal and fam-

ily history of cognitive impairment (dementia), stroke, or any neurodegenerative disorder and all of them came to the hospital for routine health check-up. About 4 ml of blood was taken after getting informed consent from all patients and control subjects. DNA was isolated from the leucocytes using salting out procedure (Miller, Dykes, & Polusky, 1988). 4. ACE genotyping DNA isolated by the above-said procedure was subjected to amplification using specific primers 50 CTGGAGACCACTCCCATCATTTCT30 and 50 GATGTGGCCATCACATTGGTCAGAT30 as described earlier (Tiret et al., 1992). Genotyping was done by running amplified PCR products on 3% agarose gel along with molecular weight markers. PCR product is a 190 bp fragment in the absence of insertion and 490 bp in the presence of the Alu insertion. 5. MTHFR genotyping DNA was amplified using specific primers 50 TGAAGGAGAAG GTGTCTGCGGGA 30 and 50 AGGACGGTGCGGTGAGAGTG30 as described previously by Frosst et al. (1995). The amplified product of 198 bp was digested using restriction enzyme Hinf1. Restriction digestion produced digested fragment of 175 and 23 bp which was analysed by running the digested product on 12% polyacrylamide gel. APOE genotyping was done as described by Hixson and Vernier, 1990. 6. Statistical analysis Chi-square (v2) test was applied for the analysis of genotypic and allelic distributions. Binary logistic regression analysis was used to find age adjusted odds ratio, using age as a covariate. In analysis of contribution of each genetic factor towards developing dementia, we calculated E4 adjusted odd’s ratio, using E4 allele as a covariate. All the analyses were done in control subjects vs. cumulative dementia, as well as control subjects vs. degenerative and vascular dementias separately using SPSS v 11.5. p-Value of less than 0.05 was taken as significant. 7. Results In this study we recruited 170 patients aged 45–90 years (mean age 64.16 ± 10.02 years), and 170 controls aged 45–90 years (mean age 60.60 ± 8.48 years). There was no significant difference in the mean age of the patients and controls (p = 0.07). Of 90 degenerative dementia patients, 33 had AD, 25 had DLB, 14 had FTD, 13 had PD with dementia and five had progressive supranuclear palsy with dementia. MR imaging of all patients was consistent with the clinical diagnosis. APOE E4 allele frequency was found to be significantly higher in degenerative dementia (p = 0.0001, OR 3.86, 95% CI 1.97–7.57) as well as vascular dementia patients (p = 0.004, OR 2.88, CI 1.39– 5.95). The frequency of this allele was still high when we combined the two dementias (p = 0.0001, OR 3.39, CI 1.82–6.32). APOE E2 allele frequency was found to be significantly protective in degenerative dementia (p = 0.02, OR 0.17, CI 0.04–0.72) but not in vascular dementia (Table 1). The genotype and allele frequencies of ACE gene in control subjects followed Hardy Weinberg equilibrium (p = 0.30). DD genotype frequency was found to be significantly high in dementia cases (26.7%) when compared to controls (11.2%), showing significant association with dementia, with an age adjusted odd’s ratio of

297

P. Pandey et al. / Brain and Cognition 71 (2009) 295–299 Table 1 APOE HhaI polymorphism genotype and allele frequency in total subjects and stratified in degenerative and vascular dementias. Genotype/ Total allele Control Patients p-Value OR (No.  = 170) (No.  = 170) (95% CI) N (%) N (%) E2

E3 E4

E3E3 E4E4 E2E3

E2E4 E3E4

24

9

(7.1) 302 (88.8) 14

(2.6) 286 (84.1) 45

(4.1) 133 (78.2) 0 0 23

(13.2) 119 (70) 3 (1.8) 9

(13.5) 1 (0.6) 13

(5.3) 0 0 39

(7.6)

(22.9)

0.02

– 0.0001

–

0.012

0.0001

Degenerative dementia

Vascular dementia

Control Patient p-Value OR (No.  = 170) (No.  = 90) (95% CI) N (%) N (%)

Control Patient p-Value OR (No.  = 170) (No.  = 80) (95% CI) N (%) N (%)

0.40 24 (0.18–0.87) (7.1) – 302 (88.8) 3.39 14 (1.82–6.32) (4.1) – 133 (78.2) 0 0 0.36 23 (0.16–0.80) (13.5) 1 (0.6) 3.60 13 (1.84–7.02) (7.6)

2 (1.1) 151 (83.9) 27 (15) 63 (70) 2 (2.2) 9 (5.3) 0 0 23 (25.6)

2.82 (p = 0.002, 95% CI = 1.47–5.41) (Table 2). Frequency of D allele was also significantly high in cases vs. controls (47.9% vs. 37.4%) (p = 0.005, OR = 1.55, 95% CI = 1.14–2.26). When patients were again sub-divided into degenerative and vascular dementia group, DD genotype and D allele were still higher in cases (26.7%, 48.3% and 25.0%, 47.5% for degenerative and vascular dementia, respectively) as against controls. The ACE I allele frequency in controls (62.6%) was taken as reference for logistic regression analysis. Frequency of MTHFR C and T alleles in control subjects were 82.6% and 17.4%, respectively. Frequencies of CC and CT genotypes in the same were 69.4% and 26.5%, while that of TT genotype was found to be too low at 4.1%. Both the genotype and allele frequencies followed Hardy Weinberg equilibrium in the control population (p = 0.60). However, we could not find any significant difference in the frequencies of wild type and variant allele or genotype in either of the two dementias when compared with control population. Frequency of C and T alleles and their respective genotypes in degenerative and vascular dementias are given in Table 3. 8. Effect of ACE allele D on the risk of developing dementia, after controlling for age and APOE E4 status ACE D allele initially appeared to increase the risk for dementia (p = 0.002, OR 2.82); however, the effect got diluted when we stratified our data according to age and APOE E4 gene status (p = 0.04, OR 1.38). When we further sub-divided the patients into sub-types degenerative and vascular dementia, the susceptibility towards either of the two dementias imparted by D allele almost disappeared in both (p = 0.08 and 0.11, respectively) (Table 4). 9. Discussion APOE E4 allele has been found to be consistently associated with AD as well as vascular dementia in the studies reported worldwide (Kawamata, Tanaka, Shimohama, Ueda, & Kimura, 1994; Luthra et al., 2004; Saunders et al., 1993) including our previous reports (Pandey, Pradhan, & Mittal, 2007; Pandey, Pradhan, & Mittal, 2008), thus providing a clear evidence, that APOE is a strong and independent predictor for dementia.

0.016

0.17 (0.04–0.72)

–

–

0.0001

3.86 (1.97–7.57)

–

–

–

–

0.02

0.18 (0.04–0.80) –

0.001

3.74 (1.78–7.85)

24

7

7.1 302 (88.8) 14

(4.4) 135 (84.4) 18

(4.1) 133 (78.2) 0 0 23

(11.3) 56 (70.0) 1 (1.3) 7

13.5 1 0.6 13

(8.8) 0 0 16

(7.6)

(20.0)

0.33

0.65 (0.27–1.55)

–

–

0.004

2.88 (1.39–5.95)

–

–

0.48

0.72 (0.29–1.78)

0.008

2.92 (1.32–6.48)

Apart from high LDL, owing to E4 allele of APOE gene, previous studies clearly indicated role of high homocysteine in neurological as well as vascular disorders (Harker, Ross, Slichter, & Scott, 1976; Porter & Roberts, 1993) Several studies have identified the thermolabile variant TT to be associated with mildly elevated plasma homocysteine levels in general population (Deloughery et al., 1996; Jacques et al., 1996), which however, is not unanimous (Jacques et al., 1996; McIlroy, Dynan, Lawson, Patterson, & Passmore, 2002). Due to contradictory data in the literature, contribution of elevated homocysteine and MTHFR polymorphisms in the etiopathogenesis of the disease is still obscure (Brunelli, Bagnoli, & Giusti, 2001; Gussekloo et al., 1999; Wakutani et al., 2002; Zuliani et al., 2001). In light of these events, we tested the hypothesis that MTHFR T allele may play a role in the adverse vascular events ultimately leading to dementia but the results contradict this hypothesis. Present study does not support the association of MTHFR gene with dementia, either in presence of confounding factors like age and APOE E4 or independent of it. The prevalence of MTHFR TT homozygotes exhibit vast diversity between different populations, ranging from 30% in Italian population (Abbate et al., 1998) to 0% in blacks (Giles et al., 1998; Mc Andrew, Brandt, Pearl, & Prior, 1996). The TT genotype and T allele frequencies in control subjects in the present study were quite low (4.1% and 17.4%) and matched the frequencies already reported in another Asian population (3% and 17.6%, respectively) as reported by Schneider, Rees, Liu, and Clegg (1998). No significant difference was found in the frequencies of either of the alleles between any of the sub-groups of patients, when compared with control subjects. This can be explained by the hypothesis that mutation in MTHFR gene alone may be insufficient to cause disease in old age, and only in combination with low folate status will it lead to a sufficient increase in plasma homocysteine and finally the disease (Jacques et al., 1996). In conclusion we did not find any relation between MTHFR C677T polymorphism and dementia in North Indian population. Also, the present study does not support previously reported association of ACE gene with dementia (Alvarez et al., 1999; Kehoe et al., 1999; Wang et al., 2006). Since one of the roles of ACE is to degrade amyloid b (Hu et al. 2001), it was speculated that D allele might be protective to degenerative dementias, however, in a report by Farrer, 1997, ACE D allele was found to increase suscepti-

298

P. Pandey et al. / Brain and Cognition 71 (2009) 295–299

Table 2 ACE ins/del polymorphism genotype and allele frequency in total subjects and stratified in degenerative dementia and vascular dementia subjects. Genotype/ Total allele Control Patient p-Value OR (No.  = 170) (No.  = 170) (95% CI) N (%) N (%) I

213 (62.6) 127

177 (37.4) 163

ID

(37.4) 62 (36.5) 89

(47.9) 51 (30) 75

DD

(52.4) 19

(44.1) 44

0.002

(11.2)

(25.9)

D

II

Degenerative dementia

Vascular dementia

Control Patient p-Value OR (No.  = 170) (No.  = 90) (95% CI) N (%) N (%)

Control Patient p-Value OR (No.  = 170) (No.  = 80) (95% CI) N (%) N (%)

213 (62.6) 127

93 (51.7) 81

213 (62.6) 127

84 (52.5) 76

(37.4) 62 (36.5) 89

(48.3) 27 (30.0) 39

(37.4) 62 (36.5) 89

(47.5) 24 (30.0) 36

(52.4) 2.82 19 (1.47–5.41) (11.2)

(43.3) 24

0.006

(45) 20

–

–

0.005

1.55 (1.14–2.10)

–

–

0.92

1.02 (0.63–1.66)

–

–

0.016

1.57 (1.09–2.26)

–

–

0.98

1

(26.7)

bility to AD in age group 60–70, adding further, that high frequency of D allele in both cases and controls of higher age group may lead to better survival with the disease rather than being a true risk factor for AD. This was partially confirmed in another study by Panza et al. (2007), where authors reported high frequency of DD genotype in patients whose mean age of onset of disease was 72.1 years (±7.3 years). They also reported that AD patients with II genotype were on average 3.6 years younger than those with DD genotype giving an impression that ACE I allele may bring forward the age of onset of AD instead of increasing overall risk to AD. Since our study comprises of elderly subjects, with mean age of onset 64.16 years (±10.02), it supports the previous findings by Farrer, 1997, which shows that D allele is associated with AD among age group 60–70. We found a significantly high frequency of ACE D allele and DD genotype with vascular dementia (p = 0.032, OR 1.52, and p = 0.013 OR = 2.72 for allele and genotype, respectively), which was calculated using age as a covariate in a binary logistic regression analysis. This can be supported by the findings of Ludwig, Corneli, Anderson, et al. (1995) that elevated ACE activity has a primary impact on the transition of atherosclerosis to MI, rather than having a direct effect on atherosclerotic development. The association of ACE D allele with dementia (p = 0.002, OR 2.82) got diluted when we stratified our data according to APOE E4 status in overall dementia (p = 0.04, OR 1.38). On further subdividing the patients into sub-types degenerative and vascular dementia, the susceptibility towards dementia imparted by D

(0.56–1.81) (52.4) 2.90 19 (1.34–6.16) (11.2)

–

–

0.032

1.52 (1.04–2.22)

–

–

0.88

1.05 (0.57–1.92)

0.013

2.72 (1.24–5.96)

(25.0)

allele almost disappeared in both (p = 0.08 and 0.11, respectively) (Table 4). To summarise, observations in the present study again support the APOE E4 allele as a major risk factor in late onset sporadic dementia. However, ACE I/D polymorphism is not a major contributory factor for either degenerative or vascular dementia; rather it might be playing a role in the primary ageing process either through the modulation of ischemia or through the effect on amyloid deposition. MTHFR gene polymorphism did not seem to play any role in the development of disease either alone, or in the presence of confounding factors. Also, due to absence of any biochemical, genetic or imagiological confirmatory test for the diagnosis of different sub-types of dementia, the clinical and currently available imaging criteria used in this study to differentiate these sub-types are quite arbitrary and remain an inherent weakness of this study. Table 4 Contribution of MTHFR allele T and ACE I allele in development of overall dementia after controlling for age and APOE E4 allele.

Total patients Degenerative dementia Vascular dementia

Gene variant

p-Value

Odd’s ratio

95% CI

MTHFR T allele ACE D allele MTHFR T allele

0.65 0.04 0.38

0.91 1.38 0.79

0.60–1.37 1.02–1.90 0.48–1.32

ACE D allele MTHFR T allele ACE D allele

0.08 0.78 0.11

1.39 1.07 1.37

0.95–2.02 0.66–1.75 0.93–2.03

Table 3 MTHFR C677T polymorphism genotype and allele frequency in total subjects and stratified in degenerative dementia and vascular dementia subjects. Genotype/ Total allele Control Patient p-Value OR (No.  = 170) (No.  = 170) (95% CI) N (%) N (%) C

281 (82.6) 59

278 (81.8) 62

CT

(17.4) 118 (69.4) 45

(18.2) 110 (64.7) 58

TT

(26.5) 7

(34.1) 2

0.15

(4.1)

(1.2)

T

CC

Degenerative dementia

Vascular dementia

Control Patient p-Value OR (No.  = 170) (No.  = 90) (95% CI) N (%) N (%)

Control Patient p-Value OR (No.  = 170) (No.  = 80) (95% CI) N (%) N (%)

281 (82.6) 59

151 (83.9) 29

281 (82.6) 59

127 (79.4) 33

(17.4) 118 (69.4) 45

(16.1) 61 (77.8) 29

(17.4) 118 (69.4) 45

(20.6) 49 (61.3) 29

(26.5) 0.31 7 (0.06–1.51) (4.1)

(32.2) 0

(26.5) 7

(36.3) 2

(4.1)

(2.5)

–

–

0.76

0.94 (0.64–1.40)

–

–

0.18

1.38 (0.86–2.21)

0

–

–

0.72

0.92 (0.56–1.48)

–

–

0.44

1.25 (0.71–2.18)

0.99

0

–

–

0.38

0.81 (0.50–1.30)

–

–

0.13

1.56 (0.88–2.75)

0.65

0.68 (0.14–3.43)

P. Pandey et al. / Brain and Cognition 71 (2009) 295–299

Disclosure statement Authors have no potential conflicts of interest including any financial, personal or other relationships with other people or organizations. Acknowledgement Financial support provided for the study to the first author in the form of senior research fellowship by Indian Council of Medical Research, Delhi, India, is greatly acknowledged. References Abbate, R., Sardi, I., Pepe, G., Marcucci, R., Brunelli, T., Prisco, D., et al. (1998). The high prevalence of thermolabile 5, 10-methylene tetrahydrofolate reductase (MTHFR) in Italians is not associated to an increased risk for coronary artery disease (CAD). Journal of Thrombosis and Haemostasis, 79, 727–730. Alvarez, R., Alvarez, A., Lahoz, C. H., Martinez, C., Pena, J., Sanchez, J. M., et al. (1999). Angiotensin converting enzyme and endothelial nitric oxide synthase DNA polymorphism and late onset Alzheimer’s disease. Journal of Neurology Neurosurgery and Psychiatry, 67, 733–736. Brunelli, T., Bagnoli, S., & Giusti, B. (2001). The C677T methylenetetrahydrofolate reductase mutation is not associated with Alzheimer´s disease. Neuroscience Letters, 315, 103–105. Deloughery, T. G., Evans, A., Sadeghi, A., McWilliams, J., Henner, W. D., Taylor, L. M. Jr.,, et al. (1996). Common mutation in methylenetetra-hydrofolate reductase. Correlation with homocysteine metabolism and late onset vascular disease. Circulation, 94, 3074–3078. Farrer, L. A. (1997). Genetics and the dementia patient. Neurologist, 3, 13–30. Frosst, P., Blom, H. J., Milos, R., Goyette, P., Sheppard, C. A., Mathews, R. G., et al. (1995). A candidate risk factor for vascular disease: A common mutation in MTHFR. Nature Genetics, 10, 111–113. Giles, W. H., Kittner, S. J., Ou, C. Y., Croft, J. B., Brown, V., Buchholz, D. W., et al. (1998). Thermolabile methylene tetrahydrofolate reductase polymorphism C677T and total homocysteine concentration among African American and White women. Ethnicity and Disease, 8, 149–157. Gussekloo, J., Heijmans, B. T., Slagboom, P. E., Lagaay, A. M., Knook, D. L., & Westendorp, R. G. (1999). Thermolabile methylenetetrahydrofolate reductase gene and the risk of cognitive impairment in those over 85. Journal of Neurology Neurosurgery and Psychiatry, 67, 535–553. Harker, L. A., Ross, R., Slichter, S. J., & Scott, C. R. (1976). Homocysteine induced arteriosclerosis: The role of endothelial cell injury and platelet response in its genesis. Journal of Clinical Investigations, 58, 731–741. Hixson, J. E., & Vernier, D. T. (1990). Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. Journal of Lipid Research, 31(3), 545–548. Hu, J., Igarashi, A., Kawamata, M., & Nakagawa, H. (2001). Angiotensin converting enzyme degrades Alzheimer amyloid b peptide (Ab); retards Ab aggregation, deposition, fibril formation; and inhibits cytotoxicity. Journal of Biological Chemistry, 276, 47863–47868. Jacques, P. F., Bostom, A. G., Williams, R. R., Ellison, R. C., Eckfeldt, J. H., Rosenberg, I. H., et al. (1996). Relation between folate status, a common mutation in methylene tetrahydrofolate reductase and plasma homocysteine concentrations. Circulation, 93, 7–9. Kawamata, J., Tanaka, S., Shimohama, S., Ueda, K., & Kimura, J. (1994). Apolipoprotein E polymorphism in Japanese patients with Alzheimer’s disease or vascular dementia. Journal of Neurology Neurosurgery and Psychiatry, 57, 1414–1416.

299

Kehoe, P. G., Russ, C., Mcllroys Williams, H., Holmans, P., Holmes, C., et al. (1999). Variation in DCP 1, encoding ACE is associated with susceptibility to Alzheimer’s disease. Nature Genetics, 21, 71–72. Kehoe, P. G., Katzoe, H., Feuk, L., Benett, M., Johansson, B., Wilman, B., et al. (2003). Haplotypes extending across ACE are associated with AD. Human Molecular Genetics, 12(8), 859–867. Ludwig, E., Corneli, P. S., Anderson, J. L., et al. (1995). Angiotensin converting enzyme gene is associated with myocardial infarction but not with development of coronary stenosis. Circulation, 91, 2120–2124. Luthra, K., Tripathi, M., Grover, R., Dwivedi, M., Kumar, A., & Dey, A. B. (2004). Apolipoprotein E gene polymorphism in Indian patients with Alzheimer’s disease and vascular dementia. Dementia and Geriatric Cognitive Disorders, 17, 132–135. Mc Andrew, P. E., Brandt, J. T., Pearl, D. K., & Prior, T. W. (1996). The incidence for the gene for thermolabile methylene tetrahydrofolate reductase in African Americans. Thrombosis Research, 83, 195–198. McIlroy, S. P., Dynan, K. B., Lawson, J. T., Patterson, C. C., & Passmore, A. P. (2002). Moderately elevated plasma homocysteine, methylene tetrahydrofolate reductase genotype and risk for stroke, vascular dementia and AD in Northern Ireland. Stroke, 33, 2351–2356. Miller, S. A., Dykes, D. D., & Polusky, H. F. (1988). A salting out procedure for extracting DNA from nucleic acid cells. Nucleic Acid Research, 16, 215. Pandey, P., & Pradhan, S. (2006). Homocysteine: A possible modifiable risk factor in vascular dementia. Annals of Neurosciences, 13, 12–18. Pandey, P., Pradhan, S., & Mittal, B. (2007). Presenilin gene predisposes to late-onset degenerative but not vascular dementia: A comparative study of PS1 and ApoE genes in a North Indian cohort. Dementia and Geriatric Cognitive Disorders, 24(3), 151–161. Pandey, P., Pradhan, S., & Mittal, B. (2008). LRP-associated protein gene (LRPAP1) and susceptibility to degenerative dementia. Genes, Brain and Behaviour, 7, 943–950. Panza, F., Capurso, C., D’Introno, A., Colacicco, A. M., Kehoe, P. G., Seripa, D., et al. (2007). Differences in allele frequencies of ACE I/D polymorphism between Northern and Southern Europe at different ages. Atherosclerosis, 193(2), 455–457. Porter, R. H., & Roberts, P. J. (1993). Glutamate metabotropic receptor activation in neonatal rat cerebral cortex by sulphur containing excitatory amino acids. Neuroscience letters, 154, 78–80. Rubinsztein, D. C., & Easton, D. F. (1999). Apolipoprotein E genetic variation and Alzheimer’s disease: a meta-analysis. Dementia and Geriatric Cognitive Disorders, 10, 199–209. Saunders, A., Strittmatter, W. J., Schmechel, S., St. George Hyslop, P., Pericak Vance, M., Joo, S. H., et al. (1993). Association of Apo e 4 with late onset familial AD and Sporadic AD. Neurology, 43, 1467–1472. SBU Report (2008). SBU (Swedish council of on technology assessment in health care project). Schneider, J. A., Rees, D. C., Liu, Y. T., & Clegg, J. B. (1998). Worldwide distribution of a common methylenetetrahydrofolate reductase mutation. (Letter) American Journal of Human Genetics, 62, 1258–1260. Tiret, L., Rigat, B., Visvikis, S., Breda, C., Corvol, P., Cambien, F., et al. (1992). Evidence, from combined segregation and linkage analysis, that a variant of Angiotensin 1 converting enzyme (ACE) gene controls plasma ACE levels. American Journal of Human Genetics, 51, 197–205. Wang, H. K., Fung, H. C., Hu, W. C., Wu, Y. R., Lin, J. C., Ro, L. S., et al. (2006). Apolipoprotein E, angiotensin-converting enzyme and kallikrein gene polymorphisms and the risk of Alzheimer’s disease and vascular dementia. Journal of Neural Transmission, 113(10), 1499–1509. Wakutani, Y., Kowa, H., Kusumi, M., Yamagata, K., Wada-Isoe, K., Adachi, Y., et al. (2002). Genetic analysis of vascular factors in Alzheimer´s disease. Annals of New York Academy of Sciences, 977, 232–238. Zuliani, G., Ble, A., Zanca, R., Munari, M. R., Zurlo, A., Vavalle, C., et al. (2001). Genetic polymorphisms in older subjects with vascular or Alzheimer´s dementia. Acta Neurologica Scandinavia, 103, 304–308.