Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells

Biochimie xxx (2017) 1e11

Contents lists available at ScienceDirect

Biochimie journal homepage: www.elsevier.com/locate/biochi

Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells Anna M. Ogloblina a, *, 1, Alexandra N. Khristich a, b, 1, Natalia Y. Karpechenko a, Svetlana E. Semina a, Gennady A. Belitsky a, Nina G. Dolinnaya c, Marianna G. Yakubovskaya a a b c

N.N. Blokhin National Medical Research Center of Oncology, Ministry of Health, Moscow, Russian Federation Department of Biology, Tufts University, Medford, MA, USA Department of Chemistry, Lomonosov Moscow State University, Moscow, Russian Federation

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 September 2017 Accepted 30 November 2017 Available online xxx

We selected and investigated nine G-quadruplex (G4)-forming aptamers originally designed against different proteins involved in the regulation of cellular proliferation (STAT3, nucleolin, TOP1, SP1, VEGF, and SHP-2) and considered to be potential anticancer agents. We showed that under physiological conditions all the aptamers form stable G4s of different topology. G4 aptamers designed against STAT3, nucleolin and SP1 inhibit STAT3 transcriptional activity in human breast adenocarcinoma MCF-7 cells, and all the studied aptamers inhibit TOP1-mediated relaxation of supercoiled plasmid DNA. STAT3 inhibition by G4 aptamer designed against SP1 protein provides a new explanation for the SP1 and STAT3 crosstalk described recently. We found some correlation between G4-mediated inhibition of the DNA replication and TOP1 activity. Four G4 aptamers from our dataset that appeared to be the strongest TOP1 inhibitors most efficiently decreased de novo DNA synthesis, by up to 79e87%. Seven G4 aptamers demonstrated significantly higher antiproliferative activity on human breast adenocarcinoma MCF7 cells than on immortalized mammary epithelial MCF-10A cells. Pleiotropic properties of G4 aptamers and their high specificity against cancer cells observed for the majority of the studied G4 aptamers allowed us to present them as promising candidates for multi-targeted cancer therapy. © 2017 Published by Elsevier B.V.

Keywords: G-quadruplex-forming aptamers Pleiotropic effects of aptamers G-quadruplex-recognizing proteins STAT3 transcriptional activity TOP1 Multi-targeted cancer therapy

1. Introduction G-quadruplexes (G4s) constitute a unique class of highly ordered nucleic acid structures characterized by a large conformational diversity. The existence of G4s in living systems is rigorously proved. They are formed by intramolecular interactions of DNA or RNA fragments containing G-rich tracts. Four guanine residues from different G-tracts are linked by Hoogsteen hydrogen bonds to form planar G-tetrads that stack on each other to form a specific three-dimensional G4 conformation. G4-forming sequences (G4motifs) are known to be highly abundant both in genomic DNA [1] and RNA [2,3]. A number of cellular proteins that specifically recognize these non-canonical structures have been found among the regulators of transcription, translation, replication, signal

* Corresponding author. E-mail address: [email protected] (A.M. Ogloblina). 1 These authors contributed equally.

transduction, recombination and other key biological processes in cells [4e7]. Accordingly, exogenous G4s can interfere with the activity of G4-recognizing proteins. Indeed, the in vitro selection technique (SELEX) revealed a number of highly specific G4-forming oligonucleotide aptamers (G4 aptamers) against a variety of protein targets. G4 structures are thermodynamically stable; that is why they are quite resistant to the nuclease degradation, and it ensures the prolonged circulation of G4 aptamers in blood plasma [8]. Due to their favorable properties, G4 aptamers are considered as an emerging class of molecules with many potential applications in therapeutics, diagnostics and analysis [9,10]. G4 aptamers able to bind and inhibit certain cellular proteins involved in carcinogenesis and tumor progression may be considered as promising chemotherapeutic agents. The novel targeted therapy approach is suggested to be more specific one against cancer cells. Moreover, this approach is much less toxic for the organism than conventional genotoxic methods of chemotherapy. Targeted anticancer agents are designed for strong selective

https://doi.org/10.1016/j.biochi.2017.11.020 0300-9084/© 2017 Published by Elsevier B.V.

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

2

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

inhibition of proliferation mechanisms that are activated in malignant cells. A number of G4 aptamers were selected against recognized objects of targeted cancer therapy: signal transducer and activator of transcription 3 (STAT3) protein; topoisomerase I (TOP1), which is necessary for the relaxation of supercoiled DNA; transcription factor SP1, which facilitates gene transcription affecting cell proliferation; protein tyrosine phosphatase SHP-2, which plays a regulatory role in cell signaling events, such as mitogenic activation, metabolic control, transcription regulation, and cell migration; angiogenesis factor VEGF-A165; and multifunctional protein nucleolin, which is highly expressed in proliferating cells [11] and is able to shuttle between nucleus and cytoplasm [12]. The specificity of G4 interaction with proteins is explained by the peculiar conformation of quadruplexes. At the same time, similar structural patterns in G4s can be recognized by more than one particular G4-binding protein. In this case, G4 aptamers can act as multi-targeted agents. Nowadays, cancer therapy affecting several signaling pathways simultaneously is thought to be more effective than therapy that targets a single protein [13]. Accordingly, the main goal of our study was to choose a number of G4 aptamers that were initially designed as specific inhibitors of certain cell proteins, to analyze their topology by CD spectroscopy and to study their cross effects on other G4-recognizing proteins. G4 aptamers were tested for their ability to interfere with the functions of transcription factor STAT3 and TOP1. The data obtained were compared with the influence of G4 aptamers on de novo DNA synthesis and on viability of two cell lines: human breast adenocarcinoma MCF-7 cells and immortalized mammary epithelial MCF-10A cells. To the best of our knowledge, this is the first study on the multitargeted effect of G4 aptamers. Interestingly, our results show that some of the investigated G4 aptamers can interact not only with a specific target protein, but also with other G4-recognizing human proteins. Therefore, they may represent promising candidates for multi-targeted cancer therapy.

2.3. Cell cultures The cervix epithelioid carcinoma HeLa cell line, the breast adenocarcinoma MCF-7 cell line and the immortalized mammary epithelial MCF-10A cell line were obtained from Blokhin CRC cell collection. HeLa and MCF-7 cells were maintained in DMEM (Dulbecco's Modified Eagle's Medium) with 10% Fetal Bovine Serum, 0.32 mg/ml of glutamine, 100 units/ml of penicillin and 100 mg/ml of streptomycin. MCF-10A cells were maintained in DMEM/F-12 (Invitrogen, Prisley, UK) containing 5% (v/v) horse serum, 100 units/ml of penicillin and 100 mg/ml of streptomycin, 10 mg/ml of insulin (Sigma, St. Louis, MO), 20 ng/ml of EGF (Sigma), 100 ng/ml of choleratoxin (Sigma), 0.5 mg/ml of hydrocortisone (Sigma). Cell cultures were incubated at 37  C and 5% CO2. 2.4. Transcription factor STAT3 activity The effect of G4 aptamers on STAT3 transcriptional activity was tested on human breast adenocarcinoma MCF-7 cells with the firefly luciferase gene under the control of STAT3-responsive elements introduced into the genome. For this purpose, MCF-7 cells were infected by Cignal Lenti STAT3 Reporter (luc) following manufacturer's protocol («Qiagen», Cat. no. CLS-6028L). Infected cells were placed in a 24-well plate (105 cells per well) and were incubated for 18 h with G4 aptamers at different concentrations. Then, exogenous human interleukin-6 was added up to 25 ng/ml concentration to the culture medium to induce the transcriptional activity of STAT3. After additional 6 h incubation, cells were rinsed with 0.9% saline (10 mM Tris-HCl, pH 7.5, 0.14 M NaCl) and left at 4  C for 30 min in lysis buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, 1% NP-40, 1 mM DTT, 1 mM PMSF, 0.1 mM sodium ortho-vanadate and 1% aprotinin). The luciferase activity in the cell extracts was determined on the Infinite 200 PRO (Tecan, Switzerland) luminometer by a standard protocol using the appropriate Luciferase Assay System (Promega, USA). The inhibition of STAT3 activity, E, was estimated (in percent) according to the equation:

2. Materials and methods E ¼ (IIo)/(IconrolIo)  100, 2.1. DNA oligonucleotides All oligodeoxyribonucleotides used in this study were obtained HPLC pure from Syntol Co, Russia, and dissolved in the appropriate buffers. Their strand concentrations were determined spectrophotometrically using molar extinction coefficients calculated by the nearest neighbor algorithm [14]. 2.2. Circular dichroism spectroscopy Oligonucleotides were dissolved to ~2 mM concentration in 100 mM KCl, 20 mM HEPES, pH 7.3 (buffer A); in addition to buffer A, 100 mM LiCl, 20 mM HEPES, pH 7.3 (buffer A-Li) with Liþ ions (not stabilizing G4 structures) was used to estimate the relative G4 stability. To allow secondary structure formation, each solution was heated to 95  C for 1e2 min and then slowly cooled down to room temperature. The CD spectra were recorded on a Chirascan CD spectrometer (Applied Photophysics Ltd, UK) equipped with a thermoelectric controller at 37  C in the wavelength range 230e360 nm. A quartz cuvette with a 10 mm path length was used to measure CD spectra with a signal averaging time of 2 s and with the scan speed of 30 nm/min. A buffer baseline was registered in the same cuvette and was subtracted from the sample spectra. CD values were presented as molecular dichroism, Dε (cm1M1), counting per oligonucleotide. The data were analyzed in Origin 8.0 using Bolzmann function.

where I is the bioluminescence intensity of the sample containing G4 aptamer, Io is the bioluminescence intensity of the background signal, and Icontrol is the bioluminescence intensity of the control sample (without G4 aptamer). 2.5. Western blot analysis MCF-7 cells were placed in 6-well plate (3  106 cells per well) and were incubated for 18 h with G4 aptamers at 75 mM concentration. To induce the transcriptional activity of STAT3, exogenous human interleukin-6 was added up to 25 ng/ml concentration to the culture medium. Western blot analysis was performed after additional 6 h incubation. This analysis was performed according to the protocol described previously [15]. Total protein content was determined by Bradford method. Cell lysates were separated using 10% SDS-PAGE and transferred to a nitrocellulose membrane (SantaCruz, USA). To prevent non-specific absorption, the membranes were treated with 5% w/v nonfat dry milk (AppliChem, Germany) in TBS buffer (20 mM Tris-HCl, 500 mM NaCl, pH 7.5) with 0.1% Tween-20 and then incubated with primary antibodies overnight at 4  C. We used primary antibodies to STAT3 and to atubulin produced by Cell Signaling Technology, USA. Appropriate IgG's (Jackson ImmunoResearch, USA) conjugated to horseradish peroxidase were used as secondary antibodies. Signals were detected by enhanced chemiluminescence reagent prepared as

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

described in Mruk's protocol [16] using ImageQuant LAS 4000 imager (GE HealthCare, USA). 2.6. Topoisomerase I activity We used the nuclear extract from the HeLa cells that contained TOP1 or a high purity and catalytically active TOP1 Enzyme (TopoGen, USA). To prepare the extract, HeLa cells in late log phase of growth were double washed with PBS [17]. Then the pellet (~107 cells) was resuspended in 180 ml of ice-cold low-salt buffer (20 mM Tris-HCl, 5 mM KCl, 1 mM MgCl2, 10% (v/v) glycerol, pH 7.5), incubated for 10 min at 4  C and homogenized. The homogenate was incubated for 30 min at 4  C and centrifuged at the same temperature for 3 min at 15,000 g. The sediment (cell nuclei) was resuspended in 180 ml of ice-cold high-salt buffer (0.35 M KCl, 20 mM Tris-HCl, 5 mM KCl, 1 mM MgCl2, 10% (v/v) glycerol, pH 7.5) and incubated at 4  C for 80 min. The solution was centrifuged for 10 min at 15,000 g (4  C). The supernatant (nuclear extract) was stored at 20  C. One activity unit of TOP1 was defined as the nuclear extract concentration that converted 250 ng of supercoiled pUC19 plasmid to the completely relaxed form for 30 min at 37  C. Plasmid pUC19 was isolated from E. coli (strain XL1-Blue) using the GeneJET plasmid miniprep kit (Fermentas, USA) in accordance with the manufacturer's manual. Cells were cultivated in the LB medium (supplemented with 0.1 mg/ml of ampicillin) at 37  C with constant shaking for 10 h. To assess the ability of G4 aptamers to affect activity of TOP1, 0.15 mg of supercoiled pUC19 plasmid DNA was mixed in 10 mM Tris-HCl, pH 7.9, 1 mM EDTA, 0.15 M NaCl, 0.1% BSA, 0.1 mM spermidine, 5% glycerol, with the nuclear extract of HeLa cells containing one activity unit of TOP1 and the studied G4 aptamers at different concentrations. Reaction was performed at 37  C for 30 min, and then it was stopped by adding SDS to a final concentration of 1% and by treating with proteinase K (50 mg/ml) for 30e60 min at 55  C. Reaction products were separated by electrophoresis in 1 % agarose gel using Wide Mini-Sub Cell GT Systems (BioRad, USA). The gels were stained in a water solution of ethidium bromide and analyzed using ImageQuant LAS 4000 (GE Healthcare Life Sciences, USA). The enzyme inhibition percent, I, for each concentration of G4 aptamer was calculated using the equation: I ¼ (S e So)/(Scontrol e So)  100, where S is the relative amount of supercoiled plasmid after the treatment with TOP1 in the presence of G4 aptamer, Scontrol is the relative amount of supercoiled plasmid without enzyme treatment, and So is the relative amount of supercoiled plasmid after TOP1 treatment in the absence of aptamer inhibitor. The half-maximal inhibitory concentrations, IC50, for G4 aptamers were determined graphically from the curves obtained by plotting the inhibition percent vs the logarithm of G4 aptamer concentration. 2.7. Inhibition of DNA replication MCF-7 cells treated with G4 aptamers (10 mM concentration) were harvested in a 96-well plate for 24 h. After that, the cells were incubated with 1 mCi of 3H-thymidine triphosphate for an additional 4 h, washed three times with PBS buffer and frozen at 20  C. After defrosting at room temperature, the cells were transferred to a cellulose membrane, and the transferred cells were dried and placed in vials containing a scintillation liquid. The number of radioactive impulses per minute was measured on a Beckman Coulter LS6500 Multipurpose Scintillation Counter (USA).

3

2.8. Cell viability assay The antiproliferative activity of the G4 aptamers was measured on two cell lines: human breast adenocarcinoma and immortalized normal breast epithelium (MCF-7 and MCF-10A, respectively) using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test based on the colorimetric determination of the metabolic activity of viable cells. To carry out the analysis, the cells of both lines were seeded in 96-well plates (1000 cells per well) and incubated for 24 h at 37  C. After that, the cells were incubated with G4 aptamers at different concentrations for 72 h. Then MTT reagent (5 mg/ml) was added to each well and cells were further incubated for 4 h. The plates were read on a Multiscan FC spectrophotometer (Thermo Fisher Scientific, USA) using a test wavelength of 570 nm. The IC50 values, the concentration of the G4 aptamer at which 50% of the cells survive, were derived from the curves of optical density (OD) values of MTT plotted vs the logarithm of G4 aptamer concentration (0.05e20 mM).

2.9. Data processing Data processing was carried out using Statistics for Windows software (StatSoft Inc., 2001, version 6.0) and Origin 8.0 (OriginLab Corporation, USA). The results presented below are the average of three independent experiments. They were presented as the mean value and the standard deviation. The statistical significance of the difference between means from two samples was evaluated with a paired samples Student's t-test. In all cases, we considered p < 0.05 as the criterion for statistical significance.

3. Results 3.1. Selection and design of G4 aptamer candidates Based on the analysis of the published data, we selected the G4 aptamers with the highest affinity for one of the G4-recognizing proteins considered as targets for anticancer therapy. Among these proteins, we chose STAT3 (transcription factor, a key participant in the JAK-STAT signaling pathway activated in malignant cells of different genesis), TOP1 (the enzyme responsible for the maintenance of the required topological state of double-stranded DNA), SP1 (a transcription factor that controls the expression of many genes involved in cell proliferation), nucleolin (multifunctional protein that is known to be highly abundant on the surface of malignant cells in certain cancers), vascular endothelial growth factor VEGF (signal protein that is produced by tumor cells to stimulate angiogenesis), and SHP-2 (signaling phosphatase, the inhibition of which leads to the simultaneous blockage of several proliferative signaling pathways activated in tumor cells). The sequences of the G4 aptamer candidates against the target proteins are presented in Table 1 together with the appropriate references. The selected aptamers were referred as G4 followed by the name of the target protein, except for the well-known antitumor aptamer AS1411 (formerly ARGO100) [18], the name of which was not changed. We also included in our set of G4 aptamers two G-rich oligonucleotides designed on the base of d(GGGT)-motif of G4-STAT3 aptamer, but differing in the middle loop: G4-TGT and G4-CCC contain TGT or CCC loop sequence, respectively (Table 1). It was recently reported that the middle loop length is the major determinant in the enhancement of protein binding (in particular, the nucleolin) to G4s [19]. We used the non-G4-forming oligonucleotide with the random sequence (Random) as a negative control.

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

4

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

Table 1 Sequences of G4 aptamers used in this study. DNA oligonucleotide

Sequence (50 -30 )

Reference

G4-STAT3 G4-TOP1 G4-SP1 G4-VEGF G4-NCL G4-SHP-2 AS1411 G4-TGT G4-CCC Random

GGGTGGGTGGGTGGGT GACTACGGGTTGGTGTGGTTGGGTAGTCTT GGCGAGGAGGGGCGTGGCCGG TGTGGGGGTGGACGGGCCGGGTAGA CCCCCCGGGGCGGGCCGGGGGCGGGGTCCCGGCGGGGCGGAGCCATG GCGTCGAATACCACTACAGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT GGTGGTGGTGGTTGTGGTGGTGGTGG GGGTGGGTGTGGGTGGG GGGTGGGCCCGGGTGGG CGATGCGTAGCTGAAGCTGCTGCAG

[20] [21] [22] [23] [24] [25] [26] our design our design our design

3.2. Structural analysis of G4 aptamers by CD spectroscopy Despite the striking progress in computational methods for assessing G4 folding propensity, prediction of the G4 topology formed by certain G4-motif remains problematic reflecting the enhanced diversity of these non-canonical structures [27,28]. To confirm the G4 formation and to elucidate the G4 topology adopted in solution, each oligonucleotide was analyzed in a medium containing potassium or lithium ions. Buffer A with Kþ ions was chosen to mimic physiological conditions. Buffer A-Li, in which Kþ ions were replaced by Liþ ions unable to induce G4 formation, was used to estimate the comparative stability of G4 structures formed by the oligonucleotides under investigation. CD spectra of previously annealed ~2 mM oligonucleotide samples recorded at 37  C are shown in Fig. 1. CD spectra of oligonucleotide Random, which is unable to form G4 structure, are rather similar in buffer A and buffer A-Li: the most intense positive peaks fall at 275 nm where the typical signals of unstructured DNA are located (Fig. 1A, Table 2). CD spectra of oligonucleotides G4-TGT, G4-CCC, G4-STAT3, G4SHP-2 and AS1411 in buffer A show a strong positive band at about 262 nm and a weaker negative band at 243 nm (Fig. 1B, Supplementary materials, Fig. S1); they have the characteristic features of a parallel folding pattern wherein all guanosines in the G-tetrads are in anti-conformation. CD spectra of G4-TGT, G4-CCC, G4-STAT3 and G4-SHP-2 aptamers samples recorded in the buffer without potassium ions (buffer A-Li) show that the G4 aptamers maintain a parallel folding; as expected, the amplitude of the bands is significantly lower compared to the amplitude characteristic for the corresponding samples in buffer A (Fig. 1B, Supplementary, Fig. S1). These data indicate relative instability of G4s under potassium-depleted conditions, although the signature features of a parallel topology can still be detected. In the absence of Kþ-ions, the aptamer AS1411 shows the CD spectrum of an unstructured oligonucleotide, probably because it is less prone to G4 formation than other aptamers due to 2-nt G-tracts. As evidenced by CD spectra, the oligonucleotides G4-VEGF and G4-NCL fold into hybrid (3 þ 1) type G4s in buffer A. Both sequences display positive peaks around 290 nm and 262 nm, which are signatures of hybrid type G4 topology: the positive peak around 290 nm is indicative of the presence of an antiparallel orientation of G4 strands with alternative glycosidic anti- and syn-conformations of G residues. Although G4-VEGF has the CD spectrum of unstructured oligonucleotide in the absence of Kþ-ions (buffer A-Li), the spectrum of G4-NCL in buffer A-Li is consistent with G4 formation (Fig. 1C). Unlike most of the oligonucleotides studied in this work, the CD spectra of the G4-TOP1 and G4-SP1 clearly show the characteristic features of antiparallel G4 conformation: two positive bands at about 245 nm and 295 nm, and a negative band around 265 nm (Fig. 1D). In the absence of potassium ions (buffer A-Li), these

oligonucleotides are clearly unable to form G4 structures. CD spectra of G4-SP1 under our experimental conditions are entirely consistent with the data published by Raiber et al. [22]. 3.3. Effect of G4 aptamers on the transcriptional activity of STAT3 STAT3 signaling pathway has recently been shown to play a central role in inflammation-mediated carcinogenesis, cancer progression and pre-metastatic niche formation [29]. Its activation has been observed in nearly 70% of solid and hematological tumors [30]. STAT3 represents a promising cancer target for chemotherapy, and early clinical data on a small molecule inhibitor of STAT3 has shown efficacy against non-small lung cancer with the mutant epidermal growth factor receptor [30]. G4 aptamers are also considered as promising STAT3 inhibitors of high specificity [31]. Accordingly, we chose STAT3 as the first target protein, and included G4 aptamer against STAT3 (G4-STAT3) in our study. Inhibition of STAT3 was assessed as a decrease in luciferase activity in human breast adenocarcinoma MCF-7 cells with a transgene reporter construct carrying a firefly luciferase gene under the control of STAT3-responsive elements. The transcriptional activity of STAT3 was induced by the addition of exogenous human interleukin-6 to the culture medium. The luciferase activity was measured 24 h after the addition of G4 aptamers at various concentrations. All the G4 aptamers from our set were tested for their ability to inhibit the activity of the transcription factor STAT3 in MCF-7 cells. As can be seen in Fig. 2, STAT3 inhibition by G4-STAT3 aptamer was dose-dependent and its IC50 value (15 ± 3 mM, Table 2) was consistent with the previously observed one (25 mM) on the human hepatocarcinoma cell line, HepG2 [20]. The other G4 aptamers from our set can be divided into two groups according to their inhibitory activity. The first group consists of G4 aptamers that inhibit STAT3 activity in micromolar concentrations: AS1411, G4-CCC, G4-SP1, G4TGT. Interestingly, the oligonucleotides from this group fold into parallel G4s, except for G4-SP1 aptamer, which has an antiparallel topology (Table 2). However, this aptamer demonstrates the weakest inhibitory effect toward the transcriptional activity of STAT3 with IC50 ¼ 140 ± 30 mM. Nevertheless, AS1411 and G4-SP1, the two G4 aptamers, designed for other protein targets (nucleolin and SP1, respectively) efficiently interact with STAT3, thus showing their multi-targeted effects. G4-CCC and G4-TGT were designed to enhance G4-protein interaction, but a loop introduced in G4-STAT3 did not lead to an increase of activity. Using Western blot analysis, we showed that the expression levels of total STAT3 (calculated both per cell and relative to a-tubulin) is not influenced by G4 aptamers (Fig. 2B). The second group included aptamers incapable of inhibiting the transcriptional activity of STAT3: G4-SHP-2, G4-NCL, and G4-VEGF (Supplementary, Fig. S2). These aptamers generally contain more than four guanosines in the G-tracts, and their chain length exceeds

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

5

Fig. 1. CD spectra of DNA oligonucleotides in buffer A (solid lines) and in buffer A-Li (dashed lines) at 37  C.

23 nucleotide units. The control oligonucleotide of the random sequence (Random) also did not display the ability to inhibit STAT3 activity. 3.4. Inhibition of topoisomerase I activity by G4 aptamers TOP1 is vitally essential in higher eukaryotes, as it relaxes supercoiled DNA and consequently mediates chromatin dynamics, transcription, replication, DNA damage repair, and genomic stability [32]. TOP1 is an attractive target for anticancer agents, and some of TOP1 inhibitors are efficiently used in cancer chemotherapy [33,34]. Recently, it has been shown that TOP1-mediated supercoiled DNA relaxation may be inhibited by inter- and intramolecular DNA and RNA G4s [35,36] with both parallel [37] and antiparallel topologies [21]. Moreover, TOP1 was shown to have a chaperone activity and is capable of inducing the G4 formation by G-rich oligonucleotides [35]. That is why we considered TOP1 as the second target protein and hypothesized that at least some of

the G4 aptamers from our set would be efficient TOP1 inhibitors. We studied the ability of G4 aptamers to interfere with the TOP1-mediated relaxation of the negatively supercoiled pUC19 plasmid DNA via reversible cleavage of one strand of the double helix. Each reaction mixture contained the supercoiled plasmid DNA, the nuclear extract of HeLa cells containing one activity unit of TOP1 and one of the studied G4 aptamers at various concentrations. Plasmid relaxation was visualized with agarose gel electrophoresis, as electrophoretic mobility of the supercoiled DNA topoisomer is significantly higher than that of relaxed or nicked forms. At first, the prepared nuclear extract from HeLa cells was verified to contain TOP1 with the highly specific TOP1 inhibitor camptothecin [38]. This experiment confirmed that the supercoiled plasmid DNA relaxation was caused by TOP1 and not by other nuclear proteins. Typical electrophoregrams are presented in Fig. 3. As can be seen in Fig. 3A and B, the amount of supercoiled DNA (green arrow) increases when the concentration of the G4 aptamer rises, while the fractions of the relaxed form (red arrow) decrease as a result of TOP1 inhibition.

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

6

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

Table 2 The structure and biological activity of the G4 aptamers.

Fig. 2. G4 aptamer influence on STAT3 transcriptional activity estimated by luciferase reporter assay (A) and STAT3 expression level measured by Western blot analysis (B) in MCF-7 cells.

Random sequence oligonucleotide (Random) was used as a negative control. It did not affect TOP1 activity in the range of studied concentrations (Fig. 3E). Complete relaxation of the supercoiled plasmid occurs when the enzyme is added to the reaction mixture containing Random, as indicated by the absence of a band of supercoiled plasmid DNA at the appropriate level (green arrow). To quantify the inhibitory effect of the G4 aptamers, the IC50

values determined as an aptamer concentration resulting in 50% inhibition of TOP1 relaxation activity (or the half-maximal inhibitory concentrations) were calculated for all studied oligonucleotides (Table 2) based on the curves of TOP1 inhibition rate vs logarithm of the G4 aptamer concentration in the reaction mixture (Fig. 3C and D). The majority of the G4 aptamers from our set significantly inhibited TOP1 activity at nano- or micromolar concentrations (Fig. 3, Supplementary, Fig. S3, Table 2). These findings clearly demonstrate the pleiotropic behavior of G4 aptamers. The specific TOP1 inhibitor camptothecin (used widely in clinical oncology) inhibited the enzyme at a concentration range of 0.1e10 mM. This range is several times higher than that of the strongest enzyme inhibitors from our set, G4-SHP-2 and G4-TGT, which had IC50 values of 0.03 and 0.04 mM, respectively. Unexpectedly, the aptamer G4-TOP1 considered to be the most effective TOP1 inhibitor [21] showed very weak inhibitory activity under our conditions. In particular, the IC50 value (>74 mM) calculated for G4-TOP1 was more than 3-orders of magnitude higher than that observed for the aptamers G4-SHP-2, G4-TGT or G4-SP1. G4-TOP1 and AS1411 demonstrated the same inhibitory activity when we used pure TOP1. The difference between our findings and the previously published data might be due to the fact that the reaction mixture in our experiment contained three times more concentrated substrate (plasmid DNA) and higher enzyme activity comparing to the conditions used in the study of Shuai et al. [21]. Moreover, it may be explained by the peculiarities of the enzyme used by Shuai et al. (CT DNA topoisomerase I, Toyobo, Japan).

3.5. Influence of G4 aptamers on de novo DNA synthesis Given that TOP1 mediates replication [39] and that some G-rich oligonucleotides has been shown to inhibit de novo DNA synthesis [40], we decided to investigate the influence of G4 aptamers from our set on DNA replication. The ability of the aptamer AS1411 as well as its modified forms to inhibit the synthesis of DNA both

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

7

Fig. 3. TOP1-catalyzed relaxation of supercoiled pUC19 plasmid in the presence of aptamers. A: G4-SHP-2, B: G4-TGT, E: Random. Topoisomers were separated in 1% agarose gel; the aptamer concentrations (mM) are indicated above the corresponding lanes. Lane 0 corresponds to the reaction mixture containing no enzyme. For visualization, gels were stained with ethidium bromide. Positions of negatively supercoiled (green arrow) and relaxed (red arrow) plasmids are indicated on the left side. Dependence of enzyme inhibition rate on the logarithm of G4 aptamer concentration (C and D) was built according to the gel electrophoresis data (panels A and B) and IC50 values were quantified by ImageJ software.

in vivo and in vitro has already been shown by Xu et al. [40]. Notably, these authors demonstrated that G4 aptamers have an effect on the replication level that may result from modulation of replicative helicase activity. In our study, the influence of G4 aptamers on DNA replication was assessed on MCF-7 cells by measuring the intensity of 3Hthymidine incorporation into a newly synthesized DNA chain. According to our data, all the investigated G4 aptamers after 24 h cell treatment at the concentration of 10 mM inhibited DNA synthesis to varying degree (Fig. 4A). The most powerful inhibitors were aptamers G4-TGT, G4-SHP-2

and G4-CCC, which blocked the DNA replication by 87, 84 and 79%, respectively (Table 2). As we unambiguously showed by CD spectroscopy, these aptamers prefer parallel G4 conformation. Among the whole set of G4 aptamers, the G4-TOP1 that adopts the Gquadruplex of antiparallel topology demonstrates the least blocking effect; the decrease in the level of replication was 22%. For comparison, the Random oligonucleotide was shown to be not capable of inhibiting DNA replication. It should be noted that cytotoxic effect was not observed under conditions used; more that 90% of cells were still alive (Supplementary, Fig. S4).

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

8

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

aptamer concentration (from 0.02 to 50 mM) were used to calculate the IC50 values determined as the aptamer concentrations resulting in 50% cell death. The MCF-7 cell survival curves as a function of G4 aptamer concentration are shown in Fig. 4B. Seven of the nine G4 aptamers exhibited dose-dependent antiproliferative activity on the MCF-7 tumor cell line (Table 2). The exceptions were the oligonucleotides G4-TOP1, G4-SP1, and Random, which had no effect at the working concentrations (up to 50 mM) on the viability of MCF-7 cells. The antiproliferative effects of aptamers AS1411, G4-VEGF, G4-CCC, and G4-TGT on MCF-10A cells were significantly weaker (Supplementary, Fig. S5). According to the obtained results, the G4 aptamers under consideration can be divided into 4 groups. 3.6.1. Group 1 This group includes G4-STAT3 and G4-NCL. These aptamers reveal antiproliferative activity on the MCF-7 malignant cell line, but do not affect the viability of MCF-10A cells. The antiproliferative effects of G4 aptamers on MCF-7 cells were dose-dependent. 3.6.2. Group 2 This group includes G4-CCC, G4-TGT, AS1411, and G4-VEGF. They exhibited antiproliferative activity to the cancer cells and tended to suppress the vital activity of the immortalized cells. Antiproliferative effect of G4 aptamers was also dose-dependent and their toxic concentrations were significantly higher for immortalized mammary epithelial MCF-10A cells than for cancer cells. The most active aptamer from this group, G4-CCC, is 133 times more cytotoxic to MCF-7 cells than to MCF-10A cells (IC50 is 0.06 mM and 8 mM for MCF-7 and MCF-10A cells, respectively).

Fig. 4. A: Effect of G4 aptamers on 3H-thymidine incorporation into a newly synthesized DNA chain in MCF-7 cells after 24 h treatment. B: Viability of MCF-7 cells treated with G4 aptamers at concentrations from 0.2 nM to 50 mM for 72 h.

3.6. Antiproliferative activity of G4 aptamers The pleiotropic properties of the G4 aptamers shown in this study support our hypothesis that the integral effect of such aptamers in cells is not purely due to the targeting of the proteins against which the aptamers were designed, but also reflect their interaction with other G4-recognizing cell proteins. Taking into consideration that some of G4-recognizing proteins are multifunctional [41] and that G4-recognizing transcriptional factors may control different cell processes simultaneously [29], it is difficult to predict whether integral antiproliferative activity of G4 aptamers on cancer cells may be more pronounced with respect to normal tissue cells. Comparison of the aptamers' antiprofirative effects on breast adenocarcinoma MCF-7 cells and immortalized mammary epithelial MCF-10A cells was performed in previous research only for AS1411 [42e44]. In our work, we carried out an analogous analysis for all the G4 aptamers from our set. To test the potential of the characterized G4 aptamers as anticancer agents, we explored their ability to induce cell death in malignant and normal cells. The antiproliferative activity of the G4 aptamers was evaluated in the two types of cells (MCF-7 and MCF-10A) after 72 h treatment using the MTT test. The curves of the percentage of cell viability vs the logarithm of G4

3.6.3. Group 3 This group includes only the aptamer G4-SHP-2, which exhibited significantly smaller antiproliferative effect on MCF-7 cancer cells compared to G4-CCC, G4-VEGF and others, but demonstrated a “reverse” effect on the normal cell line: after the treatment with G4-SHP-2, immortalized MCF-10A cells showed improved survival compared to the control sample lacking an aptamer. This effect is not desirable because compounds that stimulate cellular growth have a procarcinogenic potential. 3.6.4. Group 4 This group includes G4-TOP1, G4-SP1, and an oligonucleotide with random sequence. The aptamers from the forth group had no antiproliferative effect on either cancer or immortalized normal cells at tested concentrations (from 0.01 to 20 mM). The greatest antiproliferative effect among all the aptamers was observed for G4-CCC. Its IC50 value was 0.06 ± 0.013 mM for MCF-7 cancer cells; at this G4 aptamer concentration more than 90% of the cells of the immortalized MCF-10A cell line survived (Fig. 4B, Table 2). 4. Discussion Herein, we present the comparative analysis of nine G4 aptamers; seven of them were already known to interfere with a specific cancer-associated proteins (Table 1). We compared the topologies of formed G4s, their ability to cross-interact with two G4-recognizing proteins (STAT3 and TOP1) and to inhibit de novo DNA synthesis. Antiproliferative effects of G4 aptamers on human breast adenocarcinoma MCF-7 cells and immortalized mammary epithelial MCF-10A cells were studied as well. Using CD spectroscopy, we demonstrated that under experimental conditions close to physiological ones all of the selected

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

oligonucleotides form stable G4 structures of different topology, and can be considered as potential G4-based anticancer agents. Five of the oligonucleotides (G4-TGT, G4-CCC, G4-STAT3, AS1411, and G4-SHP-2) fold into G4s with parallel strand orientation, oligonucleotides G4-VEGF and G4-NCL adopt the hybrid (3 þ 1) G4 topology, and only two aptamers (G4-TOP1 and G4-SP1) show the characteristic features of an antiparallel G4 conformation (Table 2). We showed that G4s with parallel topology have the maximal antiproliferative activity on cancer cells. This result may be explained by the fact that G4-motifs that are located in the promoter regions of genes fold mainly into parallel G-quadruplexes, and G4-binding proteins involved in the regulation of cell proliferation, replication and transcription preferentially recognize this type of G4 topology. We showed that the aptamers AS1411 and G4-SP1 along with G4STAT3 and its analogs (G4-TGT, G4-CCC) decrease STAT3 transcriptional activity, and that all the G4 aptamers from our set effectively inhibit TOP1 activity. In this way, we confirmed the multi-targeted effect of the tested G4 aptamers. STAT3 is an upstream regulator of nucleolin expression. Consequently, the observed inhibition of STAT3 transcriptional activity by AS1411 could not be caused by AS1411nucleolin interaction [29]. Moreover, nucleolin does not influence the activity of the TOP1, although it is a TOP1-binding protein [45]. Thus, our data show that AS1411 inhibits G4-recognizing proteins STAT3 and TOP1 additionally to nucleolin. Although previous research has shown that AS1411 is able to inhibit IKKg, this effect was proven to be nucleolin-mediated [46]. Other protein targets apart from nucleolin had not been found for AS1411 prior to our study. Nevertheless, our result demonstrating AS1411 pleiotropic action is consistent with the published data describing AS1411's interaction with hemin (an iron-containing porphyrin) [47]. It is particularly noteworthy that STAT3 transcriptional activity was inhibited by G4-SP1. This aptamer was designed by Raiber et al. [22] on the basis of the SP1 recognition site in the c-Kit promoter region located upstream of the transcription start site. This G4forming motif of c-Kit promoter represents the only known example of a non-telomeric human DNA-sequence that folds into an antiparallel two-tetrad G4 [22]. SP1 protein, whose DNA binding site contains a zinc-finger motif, is prone to recognize different G4s [22]. At the same time, STAT3 controls SP1 expression and, being an upstream regulator, it may hardly be inhibited as a consequence of SP1 interaction with the G4-SP1 aptamer. Moreover, SP1-controled proteins were described to bind STAT3 and inhibit its transcriptional activity [48]. This implies that SP1 inhibition should automatically increase STAT3 transcriptional activity. In this context, our results clearly show STAT3 inhibition by G4-SP1 and confirm a direct interaction between STAT3 and G4-SP1. This can be explained in part by the distribution of SP1 and STAT3 binding sites in the regulatory regions of genes, which may be regulated by both these transcriptional factors in a cooperative manner [48]. Our findings suggest one more explanation for the observed SP1 and STAT3 crosstalk via interaction of these two proteins with the same G4 structure. The cross-interaction of G4 aptamers designed against STAT3, VEGF, SHP-2, SP1 and nucleolin with TOP1 is consistent with this enzyme's recognition of G4s of differing topologies. The most effective inhibitors of TOP1 are known to be the oligonucleotides containing extended G-tracts, regardless of whether they fold into G4s [33]. Our results are consistent with the published data: G4SHP-2 aptamer, which contains several 4- and 5-nt G-tracts, was the strongest TOP1 inhibitor. More than 100 times less active inhibition was observed for AS1411, which contains only 2 guanosine residues in the G-tracts. It is noteworthy that G4-TOP1 with four 2and 3-nt G-tracts flanked by duplex-forming regions (Table 1),

9

which was proposed by Shuai et al. [21], showed a very weak inhibitory ability under our conditions. Multi-targeted effects of G4-STAT3 aptamer (influence on STAT3 and TOP1 activity) are supported by other studies. This aptamer was shown to interact with HIV-1 integrase [49] and interleukin-6 receptor [50]. It bears mentioning that we found a correlation between G4 aptamers' influence on DNA replication and their influence on TOP1 activity. Four G4 aptamers (G4-TGT, G4-SP1, G4-SHP-2 and G4CCC), which inhibited TOP1 more efficiently than other aptamers, resulted in the maximal decrease of 3H-thymidine incorporation (87-79%) into the growing DNA chain. In contrast, G4-TOP1 demonstrated a worse inhibiting effect on TOP1 activity compared to all the G4 aptamers from our set, and it also inhibited DNA replication less than the others (22%; Table 2). The only aptamer that stood out from this observed correlation was AS1411: it was the eighth by its effect on TOP1, but the fifth/sixth among DNA replication inhibitors. In the final part of our investigation, having shown the multitargeted effect of several G4 aptamers, we performed comparative analysis of integral antiproliferative activity of the aptamers on breast adenocarcinoma MCF-7 cells and immortalized mammary epithelial MCF-10A cells. Seven aptamers of our set (G4-STAT3, G4ССС, AS1411, G4-TGT, G4-NCL, G4-VEGF and G4-SHP-2) had significantly higher antiproliferative effects on cancer cells than on immortalized ones. Taking into account the pleiotropic properties of G4 aptamers and their selective antiproliferative activity against cancer cells, we consider the G4 aptamers as promising candidates for multi-targeted cancer chemotherapy, a contemporary prospective direction for cancer treatment. 5. Conclusions G4-forming sequences are highly abundant in genomic DNA and RNA. Endogenous G4s and G4-recognizing proteins play an important role in the regulation of various biological processes. Exogenous G4 aptamers can interfere with the activity of G4recognizing proteins. Recently, a number of G4 aptamers were designed as potential targeted anticancer drugs against proteins taking part in carcinogenesis and cancer progression. In our study, we demonstrated multi-targeted effects for a majority of tested G4 aptamers. In particular, we found that (i) the wellknown G4 aptamer AS1411 inhibits TOP1 and STAT3, that (ii) G4 aptamer designed against SP1 also interacts with STAT3 and TOP1, and that (iii) all the G4 aptamers inhibited TOP1-mediated relaxation of supercoiled DNA. We also showed that the G4 aptamers inhibit de novo DNA synthesis and that this inhibition, as expected, correlated with G4 aptamer's influence on TOP1 activity. To estimate specificity of the integral effects of G4 aptamers on cancer cells, we analyzed their antiproliferative activity on breast adenocarcinoma MCF-7 cells and on immortalized mammary epithelial cells MCF-10A. Seven of the nine G4 aptamers demonstrated high specificity to cancer cells allowing to consider them as promising candidates for multi-targeted cancer therapy. Author contributions A.O. and A.K. designed the research and performed most of the experiments; N.K. was responsible for the TOP1 experiments and preparing of MCF-7 cells with the firefly luciferase transgene under the control of STAT3-responsive elements, S.S. performed Western blot analysis, G.B. participated in the data analysis and critically read the manuscript; N.D. participated in CD structural analysis of the aptamers and the manuscript preparation; M.Y. contributed to

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

10

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11

the study design, data processing and the manuscript preparation. Conflicts of interest No conflict of interest. Acknowledgments We thank Dr. Leyla R. Tilova for valuable suggestions regarding STAT3-activity assay and Dr. Jussara Amato for pieces of advice and helpful discussions. Our work was supported by Russian Science Foundation [17-15-01526] and by the Russian Foundation for Basic Research [15-04-09216_A and 16-04-00575_A]. Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.biochi.2017.11.020. References [1] J. Bidzinska, G. Cimino-Reale, N. Zaffaroni, M. Folini, G-quadruplex structures in the human genome as novel therapeutic targets, Molecules 18 (2013) 12368e12395. [2] N.G. Dolinnaya, A.M. Ogloblina, M.G. Yakubovskaya, Structure, properties, and biological relevance of the DNA and RNA G-quadruplexes: overview 50 Years after their discovery, Biochemistry (Moscow) 81 (2016) 1602e1649. [3] C.K. Kwok, A.B. Sahakyan, S. Balasubramanian, Structural analysis using SHALiPE to reveal RNA g-quadruplex formation in human precursor MicroRNA, Angew. Chem. Int. Ed. Engl. 55 (2016) 8958e8961.
roníkova
, J.C. Liao, M. Fojta, DNA and RNA quadruplex-binding [4] V. Br
azda, L. Ha proteins, Int. J. Mol. Sci. 15 (2014) 17493e17517. [5] C. Sissi, B. Gatto, M. Palumbo, The evolving world of protein-G-quadruplex recognition: a medicinal chemist's perspective, Biochimie 93 (2011) 1219e1230. [6] H.J. Lipps, D. Rhodes, G-quadruplex structures: in vivo evidence and function, Trends Cell Biol. 19 (2009) 414e422. [7] M.L. Bochman, K. Paeschke, V.A. Zakian, DNA secondary structures: stability and function of G-quadruplex structures, Nat. Rev. Genet. 13 (2012) 770e780. [8] Z. Cao, C.C. Huang, W. Tan, Nuclease resistance of telomere-like oligonucleotides monitored in live cells by fluorescence anisotropy imaging, Anal. Chem. 78 (2006) 1478e1484. [9] V. Viglasky, T. Hianik, Potential uses of G-quadruplex-forming aptamers, Gen. Physiol. Biophys. 32 (2013) 149e172. [10] C. Platella, C. Riccardi, D. Montesarchio, G.N. Roviello, D. Musumeci, G-quadruplex-based aptamers against protein targets in therapy and diagnostics, Biochim. Biophys. Acta 1861 (2017) 1429e1447. [11] S. Soundararajan, L. Wang, V. Sridharan, W. Chen, N. Courtenay-Luck, D. Jones, E.K. Spicer, D.J. Fernandes, Plasma membrane nucleolin is a receptor for the anticancer aptamer AS1411 in MV4-11 leukemia cells, Mol. Pharmacol. 76 (2009) 984e991. [12] E.M. Reyes-Reyes, Y. Teng, P.J. Bates, A new paradigm for aptamer therapeutic AS1411 action: uptake by macropinocytosis and its stimulation by a nucleolin-dependent mechanism, Cancer Res. 70 (2010) 8617e8629. [13] F. Broekman, E. Giovannetti, G.J. Peters, Tyrosine kinase inhibitors: multitargeted or single-targeted? World J. Clin. Oncol. 2 (2011) 80e93. [14] C.R. Cantor, M.M. Warshaw, H. Shapiro, Oligonucleotide interactions. 3. Circular dichroism studies of the conformation of deoxyoligonucleotides, Biopolymers 9 (1970) 1059e1077. [15] S.E. Semina, A.M. Scherbakov, S.V. Kovalev, V.E. Shevchenko, M.A. Krasilnikov, Horizontal transfer of tamoxifen resistance in MCF-7 cell derivates: proteome study, Canc. Invest. 35 (2017) 506e518. [16] D.D. Mruk, C.Y. Cheng, Enhanced chemiluminescence (ECL) for routine immunoblotting: an inexpensive alternative to commercially available kits, Spermatogenesis 1 (2011) 121e122. [17] J.L. Nitiss, E. Soans, A. Rogojina, A. Seth, M. Mishina, Topoisomerase assays, Curr. Protoc. Pharmacol. Chapter 3 (2012). Unit 3.3. [18] J.E. Rosenberg, R.M. Bambury, E.M. van Allen, H.A. Drabkin, P.N. Lara Jr., A.L. Harzstark, N. Wagle, R.A. Figlin, G.W. Smith, L.A. Garraway, T. Choueiri, F. Erlandsson, D.A. Laber, A phase II trial of AS1411 (a novel nucleolin-targeted DNA aptamer) in metastatic renal cell carcinoma, Invest. N. Drugs 32 (2014) 178e187. [19] S. Lago, E. Tosoni, M. Nadai, M. Palumbo, S.N. Richter, The cellular protein nucleolin preferentially binds long-looped G-quadruplex nucleic acids, Biochim. Biophys. Acta 1861 (2017) 1371e1381.

[20] N. Jing, Y. Li, X. Xu, W. Sha, P. Li, L. Feng, D.J. Tweardy, Targeting Stat3 with Gquartet oligodeoxynucleotides in human cancer cells, DNA Cell Biol. 22 (2003) 685e696. [21] L. Shuai, M. Deng, D. Zhang, Y. Zhou, X. Zhou, Quadruplex-duplex motifs as new topoisomerase I inhibitors, Nucleos Nucleot. Nucleic Acids 29 (2010) 841e853. [22] E.A. Raiber, R. Kranaster, E. Lam, M. Nikan, S. Balasubramanian, A non-canonical DNA structure is a binding motif for the transcription factor SP1 in vitro, Nucleic Acids Res. 40 (2012) 1499e1508. [23] Y. Nonaka, K. Sode, K. Ikebukuro, Screening and improvement of an anti-VEGF DNA aptamer, Molecules 15 (2010) 215e225. [24] V. Gonzalez, K. Guo, L. Hurley, D. Sun, Identification and characterization of nucleolin as a c-myc G-quadruplex-binding protein, J. Biol. Chem. 284 (2009) 23622e23635. [25] J. Hu, J. Wu, C. Li, L. Zhu, W.Y. Zhang, G. Kong, Z. Lu, C.J. Yang, A G-quadruplex aptamer inhibits the phosphatase activity of oncogenic protein Shp2 in vitro, Chembiochem 12 (2011) 424e430. [26] A.C. Girvan, Y. Teng, L.K. Casson, S.D. Thomas, S. Jüliger, M.W. Ball, J.B. Klein, W.M. Pierce Jr., S.S. Barve, P.J. Bates, AGRO100 inhibits activation of nuclear factor-kappaB (NF-kappaB) by forming a complex with NF-kappaB essential modulator (NEMO) and nucleolin, Mol. Canc. Therapeut. 5 (2006) 1790e1799. [27] A. Randazzo, G.P. Spada, M.W. da Silva, Circular dichroism of quadruplex structure, Top. Curr. Chem. 330 (2013) 67e86. [28] A.I. Karsisiotis, N.M. Hessari, E. Novellino, G.P. Spada, A. Randazzo, M. Webba da Silva, Topological characterization of nucleic acid G-quadruplexes by UV absorption and circular dichroism, Angew. Chem. Int. Ed. Engl. 50 (2011) 10645e10648. [29] H. Yu, H. Lee, A. Herrmann, R. Buettner, R. Jove, Revisiting STAT3 signalling in cancer: new and unexpected biological functions, Nat. Rev. Cancer 14 (2014) 736e746. [30] A.L.A. Wong, J.L. Hirpara, S. Pervaiz, J.Q. Eu, G. Sethi, B.C. Goh, Do STAT3 inhibitors have potential in the future for cancer therapy? Expet Opin. Invest. Drugs (2017) 1e5. [31] P. Weerasinghe, G.E. Garcia, Q. Zhu, P. Yuan, L. Feng, L. Mao, N. Jing, Inhibition of Stat3 activation and tumor growth suppression of non-small cell lung cancer by G-quartet oligonucleotide, Int. J. Oncol. 31 (2007) 129e136. [32] Y. Pommier, Y. Sun, S.N. Huang, J.L. Nitiss, Topoisomerase I inhibitors: camptothecins and beyond, Nat. Rev. Cancer 6 (2006) 789e802. [33] Y. Pommier, Drugging topoisomerases: lessons and challenge, ACS Chem. Biol. 8 (2013) 82e95. [34] M.K. Kathiravan, A.N. Kale, S. Nilewar, Discovery and development of topoisomerase inhibitors as anticancer agent, Mini Rev. Med. Chem. 16 (2016) 1219e1229.
le ne, [35] P.B. Arimondo, J.F. Riou, J.L. Mergny, J. Tazi, J.S. Sun, T. Garestier, C. He Interaction of human DNA topoisomerase I with G-quartet structure, Nucleic Acids Res. 28 (2000) 4832e4838. [36] C. Marchand, P. Pourquier, G.S. Laco, N. Jing, Y. Pommier, Interaction of human nuclear topoisomerase I with guanosine quartet-forming and guanosine-rich single-stranded DNA and RNA oligonucleotides, J. Biol. Chem. 277 (2002) 8906e8911. [37] A.M. Ogloblina, V.A. Bannikova, A.N. Khristich, T.S. Oretskaya, M.G. Yakubovskaya, N.G. Dolinnaya, Parallel g-quadruplexes formed by guanine-rich microsatellite repeats inhibit human topoisomerase I, Biochemistry (Moscow) 80 (2015) 1026e1038. [38] A. Coletta, A. Desideri, Role of the protein in the DNA sequence specificity of the cleavage site stabilized by the camptothecin topoisomerase IB inhibitor: a metadynamics study, Nucleic Acids Res. 41 (2013) 9977e9986. [39] Y. Pommier, Y. Sun, S.N. Huang, J.L. Nitiss, Roles of eukaryotic topoisomerases in transcription, replication and genomic stability, Nat. Rev. Mol. Cell Biol. 17 (2016) 703e721. [40] X. Xu, F. Hamhouyia, S.D. Thomas, T.J. Burke, A.C. Girvan, W.G. McGregor, J.O. Trent, D.M. Miller, P.J. Bates, Inhibition of DNA replication and induction of S phase cell cycle arrest by G-rich oligonucleotides, J. Biol. Chem. 276 (2001) 43221e43230. [41] C.M. Berger, X. Gaume, P. Bouvet, The roles of nucleolin subcellular localization in cancer, Biochimie 113 (2015) 78e85.  [42] E.M. Reyes-Reyes, F.R. Salipur, M. Shams, M.K. Forsthoefel, P.J. Bates, Mechanistic studies of anticancer aptamer AS1411 reveal a novel role for nucleolin in regulating Rac1 activation, Mol. Oncol. 9 (2015) 1392e1405. [43] S. Soundararajan, W. Chen, E.K. Spicer, N. Courtenay-Luck, D.J. Fernandes, The nucleolin targeting aptamer AS1411 destabilizes Bcl-2 messenger RNA in human breast cancer cells, Cancer Res. 68 (2008) 2358e2365. [44] M.T. Malik, M.G. O'Toole, L.K. Casson, S.D. Thomas, G.T. Bardi, E.M. ReyesReyes, AS1411-conjugated gold nanospheres and their potential for breast cancer therapy, Oncotarget 6 (2015) 22270e22281. [45] A.K. Bharti, M.O. Olson, D.W. Kufe, E.H. Rubin, Identification of a nucleolin binding site in human topoisomerase I, J. Biol. Chem. 271 (1996) 1993e1997. [46] P.J. Bates, D.A. Laber, D.M. Miller, S.D. Thomas, J.O. Trent, Discovery and development of the G-rich oligonucleotide AS1411 as a novel treatment for cancer, Exp. Mol. Pathol. 86 (2009) 151e164. [47] T. Li, S. Dong, E. Wang, G-quadruplex aptamers with peroxidase-like DNAzyme functions: which is the best and how does it work? Chem. Asian J. 4

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020

A.M. Ogloblina et al. / Biochimie xxx (2017) 1e11 (2009) 918e922. [48] C. Huang, K. Xie, Crosstalk of Sp1 and Stat3 signaling in pancreatic cancer pathogenesis, Cytokine Growth Factor Rev. 23 (2012) 25e35. [49] N. Jing, C. Marchand, J. Liu, R. Mitra, M.E. Hogan, Y. Pommier, Mechanism of inhibition of HIV-1 integrase by G-tetrad-forming oligonucleotides in Vitro,

11

J. Biol. Chem. 275 (2000) 21460e21467. [50] E. Magbanua, T. Zivkovic, B. Hansen, N. Beschorner, C. Meyer, I. Lorenzen, €tzinger, J. Hauber, A.E. Torda, G. Mayer, S. Rose-John, U. Hahn, d(GGGT)4 J. Gro and r(GGGU)4 are both HIV-1 inhibitors and interleukin-6 receptor aptamers, RNA Biol. 10 (2013) 216e227.

Please cite this article in press as: A.M. Ogloblina, et al., Multi-targeted effects of G4-aptamers and their antiproliferative activity against cancer cells, Biochimie (2017), https://doi.org/10.1016/j.biochi.2017.11.020