Multidrug resistance genes (MRP) and MDR1 expression in small cell lung cancer xenografts: relationship with response to chemotherapy

Cancer Letters 130 (1998) 133–141

Multidrug resistance genes (MRP) and MDR1 expression in small cell lung cancer xenografts: relationship with response to chemotherapy Yvan Canitrot a,*, Francis Bichat b, Susan P.C. Cole a, Roger G. Deeley a, James H. Gerlach a, Ge´rard Bastian b, Francisco Arvelo c, Marie-France Poupon c a

Cancer Research Laboratories, Queen’s University, Kingston, K7L 3N6, Ontario, Canada b Service d’Oncologie Me´dicale, Pitie´-Salpe´trie`re, 75013 Paris, France c Institut Curie, URA CNRS 620, 26 rue d’Ulm, 75231 Paris, Cedex 05, France Received 23 February 1998; accepted 27 April 1998

Abstract Intrinsic or acquired drug resistance is a major limiting factor of the effectiveness of chemotherapy. Increased expression of either the MRP gene or the MDR1 gene has been demonstrated to confer drug resistance in vitro. In this study, we examined MRP and MDR1 gene expression in a panel of 17 small cell lung cancers (SCLC) xenografted into nude mice from treated and untreated patients using an RT-PCR technique. For some of them, the outcome of the corresponding patients was known and we related MDR1/MRP expression with the xenograft response to C′CAV (cyclophosphamide, cisplatin, adriamycin and etoposide) combined chemotherapy. Fifteen (88%) of the 17 cases of SCLC were found to be positive for either MDR1 or MRP. MRP gene expression was present in 12 (71%) of 17 cases, whereas MDR1 gene expression was detected in eight (50%) of 16 cases. For six SCLC, the survival duration of patients differed, with three patients surviving for more than 30 months after therapy. Among these six tumours, five expressed MRP and/or MDR1. These six xenografts responded to the C′CAV treatment but a significant rate of cure was obtained in only three cases. No obvious relationship was observed between the response to this treatment and MRP or MDR1 expression. However, the remarkably high levels and frequency of MRP expression in some SCLC samples indicate that future developments in chemotherapy of this tumour type should anticipate that drugs which are substrates of MRP may be of limited effectiveness.  1998 Elsevier Science Ireland Ltd. All rights reserved Keywords: Multidrug resistance protein (MRP); MDR1; P-Glycoprotein (P-gp); Small cell lung cancer; Xenograft

1. Introduction Intrinsic or acquired drug resistance limits the * Corresponding author. Present address: Institut de Pharmacologie et de Biologie Structurale, UPR CNRS 9062, 205 route de Narbonne, 31077 Toulouse Cedex, France. Tel.: +33 5 61175927; fax: +33 5 61175994; e-mail: [email protected]

effectiveness of chemotherapy. One of the most studied mechanisms of drug resistance is that characterized by reduced drug accumulation and increased drug efflux resulting from overexpression of the plasma membrane protein, P-glycoprotein (P-gp) [1]. Overexpression of P-gp has been reported to be a marker of a poor prognosis in certain malignancies [2–4]. In a study of seven small cell lung cancer

0304-3835/98/$19.00  1998 Elsevier Science Ireland Ltd. All rights reserved PII S0304-3835 (98 )0 0128-1

134

Y. Canitrot et al. / Cancer Letters 130 (1998) 133–141

(SCLC) patients, a correlation was found between MDR1 expression and chemoresistance [5]. However, most investigators have found that the expression of P-gp is generally low in lung tumour cells [6,7], suggesting that other mechanisms of drug resistance may be more important in this tumour type. In addition to P-gp, a second gene is now known to cause multidrug resistance in vitro [8–10]. This gene encodes a 190 kDa membrane protein referred to as MRP (multidrug resistance protein) and like P-gp is a member of the ATP binding cassette (ABC) superfamily of transporters [11]. However, the two proteins are only 15% identical. MRP was originally isolated from an SCLC cell line, H69AR, that was selected in doxorubicin [8,12] and was subsequently shown to confer drug resistance to a large panel of natural product drugs by cDNA transfection studies [9,10,13]. Overexpression of the MRP gene has been reported in a large number of selected cell lines (for review see Loe et al. [14]) but relatively few studies have been carried out on clinical samples. Most of these involved samples from leukaemia patients where MRP was found to be expressed at a relatively high level [14–19]. MRP expression in solid tumours has been much less studied but several reports indicate an elevated expression of MRP in neuroblastoma [20,21], anaplastic thyroid [22], glioma [23], gastric carcinoma [24] and lung cancers [25–28]. In addition, Campling et al. [29] reported that of 10 clinical samples of pleural or pericardiac effusions of SCLC, three expressed only MRP, two expressed only MDR1 and four expressed both drug resistance genes. As part of an effort to ascertain the relative roles of P-gp and MRP in SCLC, we examined MRP and MDR1 gene expression in a panel of 17 SCLC xenografts established from tumours of treated and untreated patients using a reverse transcription polymerase chain reaction (RT-PCR) assay. The clinical outcome for six patients and the responses to chemotherapy of their corresponding xenografted tumours were related to their MDR1/MRP profiles.

with SCLC and immediately transplanted into nude mice. Clinical samples were obtained before treatment except for SCLC 63 who received combined chemotherapy by C′AV (cyclophosphamide, adriamycin and etoposide) and C′CAV (with cisplatin). Subsequently, treated patients received radiotherapy associated with C′CAV. Xenografts were established by the subcutaneous implantation of the human tumour fragments into the scapular area of the nude mice as described previously [5]. Cytogenetic analyses of the resulting xenografts confirmed a human karyotype. 2.2. Experimental procedures Chemotherapeutic assays were done as previously described [5]. Mice were divided into groups of 10– 20 animals and tumours were transplanted. The tumour-bearing mice were treated as soon as the mean diameter of their tumours reached 5–8 mm. Mice received C′CAV regimen, which consisted of cyclophosphamide, cisplatin, doxorubicin and etoposide. All agents were injected i.p. On day 1 the mice received 6 mg/kg doxorubicin and 8 mg/kg etoposide, on day 2 they received 8 mg/kg etoposide and 3 mg/kg cisplatin, on day 3 they received 8 mg/kg etoposide and 50 mg/kg cyclophosphamide, on day 4 they received 50 mg/kg cyclophosphamide and on day 5 they received 50 mg/kg cyclophosphamide. The mice in the control group received injections of isotonic saline solutions. Tumour growth was monitored by measuring the tumour diameter. The drug effect was expressed as the tumour growth inhibition evaluated between days 10 and 20. 2.3. Patients Written informed consent was obtained from each subject after approval by a local institutional review board. 2.4. RT-PCR analysis

2. Materials and methods 2.1. Tumour samples Tumours were obtained by biopsy from patients

2.4.1. Oligonucleotides The oligonucleotides used as primers for MRP analysis were synthesized on a Biosearch 8750 DNA synthesizer. The downstream primers for esterase D and MRP were biotinylated during synthesis at the

Y. Canitrot et al. / Cancer Letters 130 (1998) 133–141

NH2-modified 5′ end using biotin phosphoramidite (Prime Synthesis, Ashton, PA). Levels of esterase D were measured as an endogenous control for cDNA synthesis for the MRP analyses [30]. The oligonucleotides used as primers for analysis of MDR1 were provided by Bioprobe (Montreuil, France). The primers were as follows: esterase D, upstream, 5′ GGAGCTTCCCCAACTCATAAATGCC 3′, downstream, 5′ TTACTGACCACATCAGACATCATGC 3′; MRP, upstream, 5′ AGTGACCTCTGGTCCTTAAACAAGG 3′, downstream, 5′ GCAAGTCATCCTTGCTCTCTACCTC 3′; MDR1, upstream, 5′ TGTACCCATCATTGCAATAGCAGG 3′, downstream, 5′ ATATGTTCAAACTTCTGCTCCTGA 3′; GAPDH, upstream, 5′ TGAAGGTCGGAGTCA-ACGGATTTGGT 3′, downstream, 5′ CATGTG-GGCCATGAGGTCCACCAC 3′. 2.5. RNA isolation, cDNA synthesis and amplification by PCR Tissue specimens were cut into pieces, immediately immersed in liquid nitrogen and then kept at −70°C until further processing. Solid tumours were pulverized and total RNA was extracted with guanidium isothiocyanate and layered over caesium chloride (5.7 M) in a solution of sodium acetate (25 mM, pH 5.0) [31]. Gradients were centrifuged overnight in a Beckman SW 41 rotor (Beckman Instruments, Fullerton, CA) at 33 000 rev./min. 2.5.1. RT-PCR conditions for MRP mRNA For these analyses, the internal control was esterase D. All cDNA synthesis and PCR procedures were set up in a laminar flow hood, using positive displacement pipettors. Reagents and tubes were UV-irradiated in a Stratalinker (Stratagene, La Jolla, CA). cDNA was synthesized from 2 mg of total cellular RNA in a final volume of 20 ml. The synthesis mixture consisted of 50 mM Tris–HCl (pH 8.3), 8 mM MgCl2, 50 mM KCl, 2 mM of each dNTP, 20 U of RNasin, 20 U of AMV reverse transcriptase and 100 ng of random hexanucleotides primers. The RNA was incubated with the synthesis mixture at 37°C for 1 h and at the end of the incubation, nine volumes of distilled water were added. To amplify the cDNA, the diluted cDNA mixture (1/10, 20 ml) was placed in a 500-ml microcentrifuge tube containing 0.1% Triton X-100, 0.2

135

mM of each dNTP, 10 pmol of each primer and 1 U of Pfu polymerase (Stratagene, La Jolla, CA) (final volume 50 ml). The reaction mixture was overlaid with light mineral oil and 35 cycles of amplification were performed on a PHC-2 Dri-Block thermocycler (Techne, Cambridge, UK) as follows: one cycle of denaturation at 95°C for 1.5 min, annealing at 58°C for 1 min and extension at 72°C for 3 min, 33 cycles of denaturation at 95°C for 0.75 min, annealing at 58°C (except for the MRP primers, 52°C) for 1 min and extension at 72°C for 1 min and a final cycle of denaturation at 95°C for 0.75 min, annealing at 58°C for 1 min and extension at 72°C for 3 min. 2.5.2. RT-PCR conditions for MDR1 mRNA For these analyses, the internal control was GAPDH. cDNA was synthesized from 2 mg of total RNA in a final volume of 20 ml. The synthesis mixture consisted of 50 mM Tris–HCl (pH 8.3), 3 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM of each dNTP, 20 U of Moloney’s murine leukaemia virus (M-MLV) reverse transcriptase (GIBCO) and 0.5 mg of oligo(dT)15 primer (Promega). The RNA was incubated with the synthesis mixture at 42°C for 1 h. To amplify cDNA, 5 ml of cDNA mixture was placed in a 500 ml microcentrifuge tube containing 50 mM KCl, 10 mM Tris–HCl (pH 9.0), 1.5 mM MgCl2, 200 mg/ml BSA, 0.25 mM of each primer, 1 mM of each dNTP and 2.5 U of Taq polymerase (Appligene Oncor, France) (final volume 50 ml). The reaction was overlaid with light mineral oil and 40 cycles of amplification were performed on a Microprocessor Controlled Incubation System Crocodile II (Appligene Oncor, France) as follows: one cycle of denaturation at 95°C for 3 min, annealing at 57°C for 0.8 min and extension at 72°C for 0.3 min. After the last cycle, all samples were incubated for an additional 5 min at 72°C. 2.6. Semi-quantification of the PCR products The MRP PCR products were separated by electrophoresis in 2% agarose in TAE buffer. The amplified DNA products were transferred to nylon membranes (Zeta-Probe, Biorad, Mississauga, Ontario, Canada) by capillary action and UV cross-linked to the membrane. The membrane was soaked for 30 min in blocking buffer (5% SDS, 17 mM Na2HPO4 and 8 mM NaHPO4) and incubated with a streptavidin–alkaline

136

Y. Canitrot et al. / Cancer Letters 130 (1998) 133–141

phosphatase conjugate (Boehringer, Mannheim) for 10 min. The membrane was then rinsed in 0.1 × blocking buffer for 15 min and washed for 30 min in buffer containing 100 mM NaCl, 10 mM MgCl2 and 100 mM Tris–HCl (pH 9.5). Lumiphos 530 (Boehringer, Mannheim) was applied to the membrane, incubated at 37°C for 1.5 h and then exposed to Kodak X-Omat AR film. Relative levels of the PCR products were estimated by densitometric analysis of the autoradiographs (Molecular Dynamics). For each sample, the level of MRP was normalized to the signal obtained for esterase D and the results were expressed as a fraction of the levels of MRP in the positive control H69AR cells [12]. The MDR1 PCR products were separated by electrophoresis in TAE buffer on 2% agarose gels. The gels were stained with 1 mg/ml ethidium bromide and photographed under UV illumination. Quantification was done by densitometric analysis of the bands using image analysis microsoftware (Image 1.44). Levels of MDR1 were normalized to the signal obtained for GAPDH and the results were expressed as relative levels of MDR1 in the positive control, the doxorubicin-selected MCF-7 cell line [32].

(Table 1). In SCLC 7 and 70, MRP levels were as high as those found in the highly MRP-overexpressing H69AR cells which were used as a positive control. MDR1 mRNA was high in five samples (SCLC 9, 61, 91, 95 and 99), low in three samples (SCLC 41, 75 and 98) and undetectable in the remaining nine samples. 3.2. Response of xenografts to chemotherapy and relationship with MRP and MDR1 expression Responses to C′CAV chemotherapy were examined in a subset of six xenografts that originated from patients in whom the outcome was known. The inhibition of tumour growth in mice after chemotherapy is summarized in Table 2. Data related to the chemotherapy responses of SCLC 41, 61 and 75 tumours were previously published [5]. Additional data were recently acquired for SCLC 82, 95 and 98. All the tumours responded to the treatment and tumour growth inhibition ranged from 60% (partial regression) to 100% (complete regression). In xenografts SCLC 61, 82, 95 and 98, complete regressions of tumour were observed. Only one recurrence of nine treated mice was observed for SCLC 61 for up to 3 Table 1

3. Results 3.1. Analysis of MRP and MDR1 expression in SCLC xenografts The expression of MRP and MDR1 mRNA in 17 SCLC xenografts using the same extracted mRNA is reported in Table 1. Sixteen xenografts came from untreated patients and SCLC 63 came from a patient previously treated with cyclophosphamide, adriamycin and etoposide. In the treated SCLC, MRP but not MDR1 was detected. Of the 16 xenograft samples evaluated for MRP and MDR1, six expressed only MRP mRNA, three expressed only MDR1 mRNA, five expressed both drug resistance genes and two did not express either of them. SCLC 8 was found to be positive for MRP but MDR1 expression could not be examined. The expression level of MRP and MDR1, when detectable, was quite variable. For example, in some samples (SCLC 9, 14, 41, 82 and 95), MRP was undetectable, while in others (SCLC 7 and 70), high levels of MRP mRNA were observed

Relative gene expression of MRP and MDR1 in small cell lung cancer xenografts Samples

MRP

MDR1

SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC SCLC

1.02 0.07 0.00 0.17 0.00 0.02 0.01 0.00 0.01 0.47 0.95 0.52 0.00 0.45 0.00 0.21 0.49

0.00 ND 1.05 0.00 0.00 0.00 0.00 0.24 0.91 0.00 0.00 0.28 0.00 4.97 1.66 0.13 1.64

7 8 9 13 14 16 22 41 61 63a 70 75 82 91 95 98 99

ND, not determined. Quantification of the PCR products was done as described in Section 2. Arbitrary the positive control was set at 1. a This tumour came from a previously treated patient.

137

Y. Canitrot et al. / Cancer Letters 130 (1998) 133–141 Table 2 a

Response of xenografts to chemotherapy and MRP and MDR1 expression Tumour

% tumour growth inhibition

Cures (%)b

MRP

MDR1

SCLC SCLC SCLC SCLC SCLC SCLC

63 100 85 100 100 100

0 90 0 50 60 0

0.00 0.01 0.52 0.00 0.00 0.21

0.24 0.91 0.28 0.00 1.66 0.13

41 61 75 82 95 98

(0/10) (9/10) (0/10) (5/10) (6/10) (0/10)

Quantification of the PCR products was done as described in Section 2. Arbitrary the positive control was set at 1. a See Section 2.2 for an explanation of the treatment. b Cures correspond to the percentage of mice that did not have any tumour burden after 90 days/total number of mice treated.

months. In SCLC 82 and 95, five and six tumours in 10 tumour-bearing mice recurred, respectively. Among the three curable tumours (SCLC 61, 82 and 95), SCLC 61 expressed both MDR1 and MRP mRNA, SCLC 82 expressed neither MDR1 nor MRP mRNA and SCLC 95 expressed only MDR1 mRNA. The tumour SCLC 98, which was not cured by the treatment, expressed both MDR1 and MRP mRNA, although it displayed an initial complete regression. Marked inhibition of tumour growth but no complete regression (85%) was observed for SCLC 75 tumour after chemotherapy. However, at 90 days after treatment, mice bearing SCLC 75 were dead due to tumour relapse. SCLC 75 expressed MRP and MDR1 mRNA. For SCLC 41 tumour, a weaker therapeutic response to C′CAV was observed (63%). Ninety days after treatment, relapse was observed and no mice bearing SCLC 41 xenograft survived. SCLC 41 expressed only MDR1 mRNA.

MRP and MDR1 mRNA gene expression in the tumour samples (Table 2) and the clinical outcome in the corresponding patients were compared (Table 3). In the six cases examined, remissions in patients with tumours positive for MRP and MDR1 (SCLC 61and 98) or negative for MRP and MDR1 (SCLC 82) were observed. A short survival duration was observed in patients with tumours expressing only MDR1 (SCLC 41 and 95) or both genes (SCLC 75). In this limited series, no correlation was observed between MRP and MDR1 mRNA expression in the tumour samples and clinical outcome of the patients.

4. Discussion Patients with SCLC are difficult to cure because of the development of drug resistance which often occurs after an initial period of chemosensitivity. The acquisition of drug resistance is frequently associated with cross-resistance to a broad range of anticancer drugs. This multidrug resistance phenotype has been related to the overexpression of a membrane glycoprotein, the P-gp. P-gp acts by decreasing intracellular drug accumulation in an ATP-dependent process. However, the role of P-gp in resistance in this tumour type remains controversial [6,7]. Additionally, a number of resistant cell lines selected with a variety of drugs display multidrug resistance which is not associated with overexpression of the MDR1 gene [12,33,34]. The cloning and transfection of the MRP gene coding for a transmembrane glycoprotein demonstrated the ability of this protein to confer multidrug resistance [8–10]. The aim of this study was to determine whether the Table 3

3.3. MRP and MDR1 mRNA expression and duration of patient survival All the samples originated from male patients aged between 47 and 69 years. Five were of oat-cell histology (SCLC 41, 61, 82, 95 and 98), while the other (SCLC 75) was of intermediate grade. One clinical sample came from lymph node metastases (SCLC 41) and five came from a primary site (SCLC 61, 75, 82, 95 and 98). All received radiotherapy combined with chemotherapy by C′CAV.

Characteristics of the human tumours and duration of patient survival Tumour

Sex/age (years)

Histology

Origin

Survival duration (months)

SCLC SCLC SCLC SCLC SCLC SCLC

M/55 M/63 M/47 M/61 M/58 M/48

Oat–cell Oat–cell Intermediate Oat–cell Oat–cell Oat–cell

Metastasis Primary Primary Primary Primary Primary

1 30 10 >96 12 >72

41 61 75 82 95 98

138

Y. Canitrot et al. / Cancer Letters 130 (1998) 133–141

MRP gene could be involved in the drug resistance of SCLC and to compare its expression with that of the MDR1 gene. Because MRP was originally isolated from an SCLC cell line, it was of interest to examine the possible implication of MRP in the chemoresistance of this type of lung cancer. In a previous study, we developed a model system which involved inserting grafts of tumours from SCLC patients into nude mice and subsequently we examined the response of these xenografts to chemotherapy in relation to MDR1 and GST p expression by Northern blot and immunocytochemistry. The clinical outcome of the respective patients was compared with these data [5]. In the present study, we extended the number of samples to 17, including three samples of the previous study. The expression of the MRP and MDR1 mRNA genes was done in the same samples. We compared the responses of the xenografts to chemotherapy with those of the respective patients and the responses were then related to the levels of expression of both MDR1 and MRP. Using RT-PCR, we found that expression of MDR1 mRNA was detectable in eight of 16 xenografts. These observations reflect a variability in P-gp expression. Some of the studies on clinical samples have concluded that elevated expression of P-gp is rarely found in lung tumours [6], whereas others suggest that P-gp expression is prevalent in this disease [35] (for review see Cole [7]). Campling et al. [29] found MDR1 mRNA expression in six out of 10 freshly harvested SCLC. In the same study, the authors described that only one of 23 SCLC cell lines, 10 of which were established from the same clinical SCLC sample, expressed the MDR1 gene, suggesting a decline of MDR1 expression during in vitro culture. The role of MDR1 in the multidrug resistance of these tumours could be reflected by the response of xenografts to chemotherapy. All three incurable tumours were MDR1-positive and among the three curable tumours, two were MDR1-positive (Table 2). Analysis of MRP mRNA expression in the same samples showed that MRP was expressed in 12 (71%) of the 17 samples. These results confirm those reported by Campling et al. [29], where the MRP gene was expressed in seven out of 10 clinical samples and in 18 of 23 SCLC cell lines. Both studies support the idea that MRP is frequently expressed in

this type of tumour. The role of MRP in the drug resistance of SCLC has to be established from the in vivo response of tumours to chemotherapy. Our series is small but indicates a tendency for such a role for MRP. Among the three incurable tumours, two were MRP-positive and among the three curable tumours, two were MRP-negative (Table 2). In a previous study, it was shown that MRP gene expression in acute myeloid leukaemia had a negative impact on the outcome of chemotherapy, since elevated MRP mRNA levels correlated significantly with a lower complete remission rate and higher resistant disease rates [17–19]. Recently, a study by Nooter et al. [36] in breast cancers showed that the expression of MRP was correlated with a poor prognosis evidenced by a short survival. Co-expression of MDR1 and MRP was found in five (31%) of 16 samples, which is close to that found in the study of Campling et al. [29] (four (40%) of 10). Interestingly, in the tumour from the previously treated patient (SCLC 63), MRP expression was detected although MDR1 was undetectable. It is possible that in the clinical situation, MDR1 expression in SCLC is more constitutive than inducible, while MRP can be induced by drugs used during the chemotherapeutic treatment of SCLC. However, since MRP expression can also be detected in untreated patients, the data suggest that elevated MRP expression is not always the result of drug exposure. In addition, Nooter et al. [37] examined MRP expression in different human cancers and reported that overexpression of MRP was not associated with previous chemotherapy. Thus, MRP and, to a lesser degree, MDR1 are components of the intrinsic drug resistance observed in SCLC. The lack of correlation observed between MRP and MDR1 mRNA levels suggests that the regulation of the two genes is not dependent. This is in contrast to the suggestion of Zhou et al. [38], who in a series of homoharringtonine-selected K562 leukaemia cells found the emergence of MRP expression in the low levels of resistance and the appearance of MDR1 expression concomitantly with a decreasing MRP expression in higher levels of resistance. The different observations may be attributable to differences in tumour type and the drug used. Our study supports a role for the expression of MRP mRNA as a negative determinant of the chemothera-

Y. Canitrot et al. / Cancer Letters 130 (1998) 133–141

peutic response of untreated SCLC patients. However, MRP and MDR1 gene expression might not be the only factors contributing to the failure of SCLC to chemotherapy. Additional mechanisms of resistance may coexist in SCLC, such as an alteration in topoisomerase II levels [39]. The presence of other molecular determinants, such as LRP, which was isolated in an MDR1/MRP-negative resistant SCLC cell line and has been shown to be largely expressed in different tumour types [40], could influence MDR phenotype. The role of multiple factors of resistance in lung cancer has been analyzed by Oberli-Schrammli et al. [41], who demonstrated the contribution of glutathione-related determinants in the resistance of SCLC. In conclusion, our results suggest that MRP and MDR1 could participate in the drug resistance in SCLC, although more studies are required to correlate the expression of these genes and the protein-encoded activity. In particular, studies of the MRP expression of patients at the time of diagnosis and the time of relapse after drug treatment would be useful. In addition, the determination of the co-expression of other determinants of drug resistance would also be necessary to understand the parameters of the striking therapeutic escape in SCLC.

Acknowledgements Y.C. was supported in part by a fellowship from the Ligue Nationale Franc¸aise contre le Cancer. This work was supported by a grant (MT-10519) from the Medical Research Council of Canada to S.P.C.C. and R.G.D. and by a grant from the Ontario Cancer Foundation to J.H.G. We thank L. Young for helpful advice and assistance. The technical assistance of K. Sparks is also acknowledged. Dr D. Lautier is acknowledged for her continuous support during this work.

References [1] M.M. Gottesman, I. Pastan, Biochemistry of multidrug resistance mediated by the multidrug transporter, Annu. Rev. Biochem. 62 (1993) 385–427. [2] R. Pirker, J. Wallner, K. Geissler, MDR1 gene expression and

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

139

treatment outcome in acute myeloid leukemia, J. Natl. Cancer Inst. 83 (1991) 708–712. L. Campos, D. Guyotat, E. Archimbaud, P. Calmard-Oruiol, T. Tsuruo, J. Troncy, D. Treille, D. Fiere, Clinical significance of multidrug resistance P-glycoprotein expression on acute nonlymphoblastic leukemia cells at diagnosis, Blood 79 (1991) 473–476. J.E. Goasguen, J.M. Dossot, O. Fardel, F. Lemee, E. Le Gall, R. Leblay, P. Leprise, J. Chaperon, R. Fauchet, Expression of the multidrug resistance-associated P-glycoprotein (P-170) in 59 cases of de novo acute lymphoblastic leukemia and prognostic implication, Blood 81 (1993) 2394–2398. M.F. Poupon, F. Arvelo, A.F. Goguel, Y. Bourgeois, M. Jacrot, N. Hanania, R. Arriagada, T. Le Chevalier, Response of small-cell lung cancer xenografts to chemotherapy: multidrug resistance and direct clinical correlates, J. Natl. Cancer Inst. 85 (1993) 2023–2029. S.L. Lai, L.J. Goldstein, M.M. Gottesman, I. Pastan, C.M. Tsai, B.E. Johnson, J.L. Mulshine, D.C. Inde, K. Kayser, A.F. Gazdar, MDR1 gene expression in lung cancer, J. Natl. Cancer Inst. 81 (1989) 1144–1150. S.P.C. Cole, Multidrug resistance in human lung cancer and topoisomerase II, in: H.I. Pass, J.B. Mitchell, D.H. Johnson, A.T. Turrisi (Eds.), Lung Cancer: Principles and Practice, J.B. Lippincott, Philadelphia, PA, 1996, pp. 169–204. S.P.C. Cole, G. Bhardwaj, J.H. Gerlach, J.E. Mackie, C.E. Grant, K.C. Almquist, A.J. Stewart, E.U. Kurz, A.M.V. Duncan, R.G. Deeley, Overexpression of a transporter gene in multidrug resistant human lung cancer line, Science 258 (1992) 1650–1654. C.E. Grant, G. Valdimarsson, D.R. Hipfner, K.C. Almquist, S.P.C. Cole, R.G. Deeley, Overexpression of multidrug resistance associated protein (MRP) increases resistance to natural product drugs, Cancer Res. 54 (1994) 357–361. G.J.R. Zaman, M.J. Flens, M.R. van Leusden, M. de Haas, R.J. Sheper, H.S. Mulder, J. Lankelma, H.M. Pinedo, F. Baas, H.J. Broxterman, P. Borst, The human multidrug resistance associated protein (MRP) is a plasma membrane drug efflux pump, Proc. Natl. Acad. Sci. USA 91 (1994) 8822– 8826. D. Lautier, Y. Canitrot, R.G. Deeley, S.P.C. Cole, Multidrug resistance mediated by the multidrug resistance protein (MRP) gene, Biochem. Pharmacol. 52 (1996) 967–977. S.E.L. Mirski, J.H. Gerlach, S.P.C. Cole, Multidrug resistance in a human small cell lung cancer cell line selected in adriamycin, Cancer Res. 47 (1987) 2594–2598. S.P.C. Cole, K. Sparks, K. Fraser, D.W. Loe, C.E. Grant, G.M. Wilson, R.G. Deeley, Pharmacological characterization of multidrug resistant MRP-transfected human tumour cells, Cancer Res. 54 (1994) 5902–5910. D.W. Loe, R.G. Deeley, S.P.C. Cole, Biology of the multidrug resistance-associated protein, MRP, Eur. J. Cancer 32A (1996) 945–957. H. Burger, K. Nooter, G. Zaman, P. Sonneveld, K.E. van Wingerden, R.G. Oostrum, G. Stoter, Expression of the multidrug resistance-associated protein (MRP) in acute and chronic leukemias, Leukemia 8 (1994) 990–997.

140

Y. Canitrot et al. / Cancer Letters 130 (1998) 133–141

[16] J. Beck, D. Niethammer, V. Gekeler, High mdr1 and mrp−, but low topoisomerase IIa gene expression in B-cell chronic lymphocytic leukemias, Cancer Lett. 86 (1994) 135– 142. [17] S.M. Hart, K. Ganeshaguru, A.V. Hoffbrand, H.G. Prentice, A.B. Mehta, Expression of the multidrug resistance-associated protein (MRP) in acute leukemia, Leukemia 8 (1994) 2163–2168. [18] G.J. Schuurhuis, H.J. Broxterman, G.J. Ossenkopele, J.P.A. Baak, C.A. Eekman, C.M. Kuiper, N. Feller, T.H.M. van Heijningen, E. Klumper, R. Picters, J. Lankelma, H.M. Pinedo, Functional multidrug resistance phenotype associated with combined overexpression of P-gp/MDR1 and MRP together with 1-b-d-arabinofuranosylcytosine sensitivity may predict clinical response in acute myeloid leukemia, Clin. Cancer Res. 1 (1995) 81–93. [19] D.C. Zhou, R. Zittoun, J.P. Marie, Expression of multidrug resistance-associated protein (MRP) and multidrug resistance (MDR1) genes in acute myeloid leukemia, Leukemia 9 (1995) 1661–1666. [20] S.B. Bordow, M. Haber, J. Madafiglio, B. Cheung, G.M. Marshall, M.D. Norris, Expression of the multidrug resistance-associated protein (MRP) gene correlates with amplification and overexpression of the N-myc oncogene in childhood neuroblastoma, Cancer Res. 54 (1994) 5036– 5040. [21] M.D. Norris, S.B. Bordow, G.M. Marshall, P.S. Hader, S.L. Cohn, M. Haber, Association between high levels of expression of the multidrug resistance-associated protein (MRP) and poor outcome in primary human neuroblastoma, N. Engl. J. Med. 334 (1996) 231–238. [22] I. Sugawara, T. Arai, T. Yamashita, A. Yoshida, A. Masunaga, S. Itoyama, Expression of multidrug resistance associated protein (MRP) in anaplastic carcinoma of the thyroid, Cancer Lett. 82 (1994) 185–188. [23] T. Abe, S. Hasegawa, K. Taniguchi, A. Yokomizo, T. Kuwano, M. Ono, T. Mori, S. Hori, K. Kohno, M. Kuwano, Possible involvement of multidrug-resistance-associated protein (MRP) gene expression in spontaneous drug resistance to vincristine, etoposide and adriamycin in human glioma cells, Int. J. Cancer 58 (1994) 860–864. [24] K. Endo, H. Maehara, T. Kusumoto, Y. Ichiyoshi, M. Kuwano, K. Sugimachi, Expression of multidrugresistance-associated protein (MRP) and chemosensitivity in human gastric cancer, Int. J. Cancer 68 (1996) 372– 377. [25] Y. Chuman, T. Sumizawa, Y. Takebayashi, K. Niwa, K. Yamada, M. Haraguchi, T. Furukawa, S. Akiyama, T. Aikou, Expression of the multidrug-resistance-associated protein (MRP) gene in human colorectal, gastric and nonsmall-cell lung carcinomas, Int. J. Cancer 66 (1996) 274– 279. [26] G. Giaccone, J. van Ark-Otte, G.J. Rubio, A.F. Gazdar, H.J. Broxterman, A.M. Dingemans, M.J. Flens, R.J. Scheper, H.M. Pinedo, MRP is frequently expressed in human lung cancer cell lines, in non-small-cell lung cancer and in normal lung, Int. J. Cancer 66 (1996) 760–767.

[27] E. Ota, Y. Abe, Y. Oshika, Y. Ozeki, M. Iwasaki, H. Inoue, H. Yamazaki, Y. Ueyama, K. Takagi, T. Ogata, N. Tamaoki, M. Nakamura, Expression of the multidrug resistance-associated protein (MRP) gene in non-small-cell lung cancer, Br. J. Cancer 72 (1995) 550–554. [28] F. Narasaki, I. Matsuo, N. Ikuno, M. Fukuda, H. Soda, M. Oka, Multidrug resistance-associated protein (MRP) gene expression in human lung cancer, Anticancer Res. 16 (1996) 2079–2082. [29] B. Campling, L.C. Young, K.A. Baer, Y.M. Lam, R.G. Deeley, S.P.C. Cole, J.H. Gerlach, Expression of the MRP and MDR1 multidrug resistance genes in small cell lung cancer, Clin. Cancer Res. 3 (1997) 115–122. [30] S.P.C. Cole, E.R. Chanda, F.P. Dicke, J.H. Gerlach, S.E.L. Mirski, Non-P-glycoprotein-mediated multidrug resistance in a small cell lung cancer cell line: evidence for decreased susceptibility to drug-induced DNA damage and reduced levels of topoisomerase II, Cancer Res. 51 (1991) 3345– 3352. [31] J.M. Chirgwin, A.E. Przybyla, R.J. Mc Donald, W.J. Rutter, Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease, Biochemistry 18 (1979) 5294– 5299. [32] E.G. Minnaugh, C.R. Fairchild, J.P. Fruehauf, B.K. Sinha, Biochemical and pharmacological characterization of MCF7 drug sensitive and AdrR multidrug-resistant human breast tumor xenografts in athymic nude mice, Biochem. Pharmacol. 42 (1991) 391–402. [33] J. Mc Grath, M.S. Center, Adriamycin resistance in HL60 cells in the absence of detectable P-glycoprotein, Biochem. Biophys. Res. Commun. 145 (1987) 1171–1176. [34] J.G. Zijlstra, E.G.E. de Vries, N.H. Mulder, Multifactorial drug resistance in an adriamycin-resistant human small cell lung carcinoma cell line, Cancer Res. 47 (1987) 1780– 1784. [35] T.A. Holzmayer, S. Hilsenbeck, D.D. Von Hoff, I.B. Roninson, Clinical correlates of MDR1 (P-glycoprotein) gene expression in ovarian and small-cell lung carcinomas, J. Natl. Cancer Inst. 84 (1992) 1486–1491. [36] K. Nooter, G. Brutel de la Riviere, J. Klijn, G. Stoter, J. Foekens, Multidrug resistance protein in recurrent breast cancer, Lancet 349 (1997) 1885–1886. [37] K. Nooter, A.M. Westerman, M.J. Flens, G.J.R. Zaman, R.J. Scheper, K.E. van Wingerden, H. Burger, R. Oostrum, T. Boersma, P. Sonneveld, J.W. Gratama, T. Kok, A.M. Eggermont, F.T. Bosman, G. Stoter, Expression of the multidrug resistance-associated protein (MRP) gene in human cancers, Clin. Cancer Res. 1 (1995) 1301–1310. [38] D.C. Zhou, S. Ramond, F. Viguie, A.M. Faussat, R. Zittoun, J.P. Marie, Sequential emergence of MRP and MDR1 gene overexpression as well as MDR1-gene translocation in homoharringtonine-selected K562 human leukemia cell lines, Int. J. Cancer 65 (1996) 365–371. [39] B.G. Campling, K.A. Baer, J.H. Gerlach, Y.M. Lam, S.P.C. Cole, S.E.L. Mirski, Topoisomerase II levels and drug response in small cell lung cancer, Int. J. Oncol. 10 (1997) 885–893.

Y. Canitrot et al. / Cancer Letters 130 (1998) 133–141 [40] M.A. Izquierdo, G.L. Scheffer, M.J. Flens, G. Giaccone, H.J. Broxterman, C.J. Meijer, P. van der Valk, R.J. Scheper, Broad distribution of the multidrug resistance related vault lung resistance protein in normal human tissues and tumors, Am. J. Pathol. 148 (1996) 877–887. [41] A.E. Oberli-Schrammli, F. Joncourt, M. Stadler, H.J. Alter-

141

matt, K. Buser, H.B. Ris, U. Schmid, T. Cerny, Parallel assessment of glutathione-based detoxifying enzymes, O6alkylguanine-DNA alkyltransferase and P-glycoprotein as indicators of drug resistance in tumor and normal lung of patients with lung cancer, Int. J. Cancer 59 (1994) 629–636.