- Email: [email protected]
Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs
Analytica Chimica Acta xxx (xxxx) xxx
Contents lists available at ScienceDirect
Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca
Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs Yunpeng Han a, Feng Zhang b, Hang Gong a, **, Changqun Cai a, * a
Key Laboratory for Green Organic Synthesis and Application of Hunan Province, Key Laboratory of Environmentally Friendly Chemistry and Application of Ministry of Education, College of Chemistry, Xiangtan University, Xiangtan, 411105, China College of Science, Hunan Agricultural University, Changsha, 410128, China
b
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
A rapid, label-free and multifunctional fluorescent probe was fabricated to overcome cumbersome labeling procedures. The system based on G-quadruplexes and DNA-templated silver nanoclusters (AgNCs) was designed for improving the sensitivity for simultaneous detection of virus DNA and microRNA. The proposed strategy exhibited special selectivity in similar oligonucleotides and could be well applied in biological fluids. The detection limit for H5N1 and H1N1 was estimated to be 0.45 nM and 10 nM respectively, and for miRNA-141 and miRNA-21was 1 nM and 10 nM respectively.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 September 2018 Received in revised form 26 November 2018 Accepted 30 November 2018 Available online xxx
A rapid, label-free, and multifunctional fluorescent probe for simultaneous detection of multiple targets was fabricated based on G-quadruplexes and DNA-templated silver nanoclusters (AgNCs). In this work, a probe with two capitated recognized regions was coupled with a locked G-quadruplex at the 50 -terminus and dark AgNC at the 30 -terminus. Upon the addition of the virus subtype H5N1 gene or microRNA-141, only the sequence of the G-quadruplex was released and bound with Thioflavin T (ThT) for a specific fluorescent response. On the contrary, with the presence of the influenza virus subtype H1N1 gene or microRNA-21, the fluorescence intensity was enhanced because of two split AgNCs approaching closely to produce a nanocluster dimer. Subsequently, with multiple target addition, fluorescence signals were produced for both G-quadruplexes and AgNCs. Moreover, this single and duplex detection for virus DNAs and microRNAs, which provides a versatile platform for different targets, was sufficiently sensitive for the expected detection limit, and still possessed unique selectivity with similar oligonucleotides. The
Keywords: Multifunctional G-quadruplex-based DNA-Templated AgNCs Fluorescent Simultaneous detection
* Corresponding author. ** Corresponding author. E-mail address: [email protected] (C. Cai). https://doi.org/10.1016/j.aca.2018.11.062 0003-2670/© 2018 Elsevier B.V. All rights reserved.
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
2
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
simultaneous detection of targets in biological fluids indicated that there is great opportunity for this strategy to be further applied in biomedical research and clinical diagnosis. © 2018 Elsevier B.V. All rights reserved.
1. Introduction Threats to human health caused by viral infectious diseases or cancers still have a tremendous influence on human society [1e5]. The appearance of diseases may be accompanied by changes in many diagnostic indexes, leading to difficulties in early and accurate diagnosis for disease therapy. Compared to single detection, simultaneous detection of multiple biomarkers, such as DNAs, microRNAs, small molecules, and proteins [6e8], is more desirable because of the higher detection efficiency and more accurate diagnosis. However, the complexity of the detection system and the inability to generate unique signals without interference often result in difficulty in simultaneously detecting targets. Thus, the development of highly sensitive and simultaneous detection for multiple biomarkers of critical diseases is challenging. At present, many methods have been applied for multiple detection. For example, polymerase chain reaction (PCR) [9e11] is frequently used to detect multiple targets because of its exquisite sensitivity and specificity, but it is difficult to design experiments to test short-length oligonucleotides. Electrochemical sensors [12e14] have been widely applied for sensitive and simultaneous detection of multiple biomarkers, because of time-saving, simple, and inexpensive analysis. However, their use in various applications has not expanded due to their instability and the difficulty in modification of their electrodes, which limit development. Surfaceenhanced Raman spectroscopy (SERS) [15e18] is feasible for simultaneous detection, because samples can be rapidly detected with high accuracy and without the necessity of sample pretreatment. However, it would be necessary for SERS probes to be combined with metal nanoparticles for this type of detection, leading to complicated synthetic steps. In addition, fluorescent methods, with the advantage of simple operation, stability, and fast detection, have also been developed for simultaneous detection based on molecular beacon and fluorescence quenching methods [19e23]. For example, Wang et al. has developed few-layer graphdiyne nanosheets that are used as novel sensing platforms for a variety of fluorophores for real-time detection of DNA with low background and high signal-to-noise ratio [24]. Nevertheless, experiments are complex and difficult to perform because of the synthesis of quencher and modification of fluorophores. Zhu's group has synthesized a silver nanocluster beacon that can be activated as a stimuli-responsive versatile platform for multiplex target detection [25]. However, some limits, such as requiring additional quencher and cumbersome modification, also exist with these methods. To address these difficulties mentioned above, we sought to design a label-free and quencher-free simultaneous detection strategy for multiple targets. In our work, rapid, quencher-free, and label-free simultaneous detection of multiple targets is proposed in combination with Gquadruplexes and DNA-templated silver nanoclusters (AgNCs). Genes of influenza A virus subtypes H5N1 and H1N1 were chosen as the models in this study for simultaneous detection. First, thioflavin T (ThT), which is a water-soluble benzothiazole salt fluorescent dye that is cell-permeable with superior selectivity for Gquadruplex [26], was selected for label-free detection of H5N1. A nanocluster dimer produced by two closely split AgNCs [27] was selected for label-free detection of H1N1. Next, with the H5N1
addition, only the G-quadruplex/ThT duplex was formed for specific and enhanced fluorescence response. In addition, an increase in the fluorescence intensity of AgNCs only occurred with the presence of H1N1 because dark AgNCs became bright nanocluster dimers. Then, with the addition of H5N1 and H1N1, the probe with two capitated recognized regions was hybridized with targets. Additionally, a G-quadruplex/ThT duplex and nanocluster dimer was formed, and the corresponding fluorescence was produced. Moreover, this label-free simultaneous detection possessed good sensitivity with a detection limit of 0.45 nM (H5N1) and 10 nM (H1N1). MicroRNA-141 (miR-141) and microRNA-21 (miR21) are both biomarkers of prostate cancer and indicators for identifying the stages of prostate cancer [19]. MiR-141 is significantly elevated in advanced prostate cancer, but its expression is normal in the early stages of the cancer. However, miR-21 is overexpressed in the early stage, but not in advanced prostate cancer. The versatile label-free method described above was also performed for the simultaneous detection of miR-141 and miR-21 with great sensitivity and selectivity. This approach also had various advantages, such as rapid detection in 40 min, low cost without the need for labeling procedures, and process simplicity without requiring large precision instruments. This simultaneous detection method would also be able to detect targets in biological fluids, and there is great potential application for its use in clinical diagnostics and biomedical research. 2. Materials and methods 2.1. Materials and reagents The DNA and microRNA oligonucleotides were synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China). The sequences of oligonucleotides used in the study are listed in Table 1 and Table 2. Silver nitrate (AgNO3) and sodium borohydride (NaBH4) were purchased from Energy Chemical (Shanghai, China). ThT (4-(3,6dimethyl-1,3-benzothiazol-3-ium-2-yl)-N,N-dimethylaniline chloride) was provided by J&K Scientific Co., Ltd. (Beijing, China). All reagents were of analytical grade and used without further purification. Ultrapure water (18.2 MU) was supplied from a water purification system (Aquapro, DE, USA). A reaction buffer (pH 6.8) containing 20 mM phosphate buffered saline (PBS), 20 mM KNO3 and 5 mM Mg(NO3)2 was used in the experiment unless otherwise stated. Each DNA oligonucleotide was heated to 95 C for 5 min and then slowly cooled to room temperature for 1 h before use. 2.2. Apparatus Fluorescence measurements were obtained with an RF-5300PC spectrofluorometer (Shimadzu Corporation, Kyoto, Japan). ThT was excited at 420 nm with a wavelength range of 450e600 nm, and the AgNCs were excited at 560 nm with a wavelength range of 575e680 nm. The slit widths of the excitation and emission were both 5 nm. Circular dichroism (CD) analysis was recorded on a Chirascan™ CD chiroptical spectrometer (Applied Photophysics Ltd., Leatherhead, UK). Absorbance spectra measurements were obtained on a UV-2450 spectrophotometer (Shimadzu Co., Ltd.,
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx Table 1 Sequences used in our experiments. name
sequences (50 to 30 )
Probe
GGGTGGGTGGGTGGGTAGACTCTTGAGTTCTCAGTATGT CTTGTCTACCCACCATACGGACGTTCTTCATCGAGAGTGT AGTCGCTAGAAGAACGTCCGTCCTCCTTCCTCC CCCTAACTCCCCACGGACGTTCTTCTAG CGACTACACTCTCGATGAAGAA CGACTACACTCTAGATGAAGAA
cDNA H1N1 DNA Single-base mismatch SM1 Double-base mismatch DM1 Three-base mismatch TM1 Non-complementary NC1 H5N1 DNA Single-base mismatch SM2 Double-base mismatchDM2 Three-base mismatch TM2 Non-complementary NC2
CGACTACACTCTAGATTAAGAA CGACTATACTCTAGATTAAGAA ATCAGCACAGATGAGTCTGCTC CATACTGAGAACTCAAGAGTCT CATACTGAGAATTCAAGAGTCT CATACTTAGAATTCAAGAGTCT CATACTTAGAATTCAAGATTCT TGCGACTGTCCAGTGGACTCAC
a The boldfaced letters represent the sequence to form G-quadruplexes; the italic letters are the DNA template for forming AgNCs; the underlined italic letters are the complementary sequence of target DNAs; the underlined letters indicate the mismatched base sequence.
Kyoto, Japan). 2.3. Synthesis of DNA-templated AgNCs In this study, 25 mL of 10 mM DNA template was dissolved in 195 mL of 20 mM PBS buffer (pH 6.8). Then, 15 mL of 300 mM freshly prepared AgNO3 aqueous solution was added, followed by the vigorous shaking of the reaction mixture for 60 s and then incubation for 30 min at 4 C in the dark. Finally, 15 mL of 300 mM freshly prepared NaBH4 was added with vigorous shaking for 60 s, and then, the mixture was incubated in the dark at 4 C for 4 h before use. The final concentrations of DNA template, AgNO3, and NaBH4 were 1 mM, 18 mM, 18 mM, respectively (molar ratio of 1:18:18). 2.4. Fluorescence assay for simultaneous detection The measurements were performed in 250 mL of reaction buffer containing 500 nM probe, 500 nM cDNA-AgNCs, 1 mM ThT and different concentrations of two target virus DNAs or miRNAs at 37 C for 40 min. The fluorescence signals were collected at room temperature under optimal experimental conditions.
Table 2 Sequences used in our experiments for miRNAs detection. name
sequences (50 to 30 )
Probe
GGGTGGGTGGGTGGGTTAACTCATCCATCTTTACC AGACAGTGTTAACCCACCATACGGACGTCAACATCA GTCTGATAAGCTACTATGTTGACGTCCGTCCTCCTTCCTCC CCCTAACTCCCCACGGACGTCAACATAG UAACACUGUCUGGUAAAGAUGG UAGCUUAUCAGACUGAUGUUGA UUCAAGUAAUCCAGGAUAGGCU UGGAGUGUGACAAUGGUGUUUG UAAUACUGUCUGGUAAAACCGU UAAUACUGCCUGGUAAUGAUGA
cDNA miRNA-141 miRNA-21 miRNA-26a miRNA-122 miRNA-429 miRNA-200b
a The boldfaced letters represent the sequence to form G-quadruplexes; the italic letters are the DNA template for forming AgNCs; the underlined italic letters are the complementary sequence of target miRNAs.
3
2.5. CD analysis The CD spectra of DNA oligonucleotides were measured at room temperature in PBS buffer (20 mM, pH 6.8). The optical chamber was deoxygenated with dry purified nitrogen (99.99%) before use and maintained under a nitrogen atmosphere during the measurements. The CD spectra were recorded at the wavelength range of 220e320 nm in a quartz cuvette with a 1-mm path length. Spectra were measured at 100 nm/min scanning mode with 0.5 s response time and 1.0 nm band width. Three scans were averaged to produce each spectrum. The buffer blank was subtracted from the CD data. 3. Results and discussion 3.1. Principle of the fluorescence assay The principle of the label-free, simultaneous detection of multiple targets based on G-quadruplexes and AgNCs is illustrated in Scheme 1. In this strategy, a multifunctional probe with two capitated recognized regions for simultaneous detection was artfully designed. The sequences of capitated region I (blue) and region II (purple) were complementary to Target 1 and Target 2, respectively. In the absence of targets, the G-quadruplex-forming sequence was locked at the 50 end of the probe. Additionally, the dark AgNC at the 30 end was sufficiently far from the free cDNA/AgNC in solution so that it could not form a nanocluster dimer. Therefore, low fluorescent emissions as background were expected. When the targets were added, the two capitated recognized regions hybridized with the targets, and then the probe structure switch followed. The G-quadruplex-forming sequence was released and then was folded into the G-quadruplex, leading to an association with ThT to form a G-quadruplex/ThT duplex and yield a significant fluorescence signal for Target 1 detection. Region III (red) of the probe, which was completely complementary with the hybridization sequence of cDNA, was also exposed so that it would hybridize with cDNA/AgNC, with two AgNCs closely approaching to produce a nanocluster dimer. The fluorescence intensity of the nanocluster dimer was markedly enhanced for the sensitive monitoring of Target 2. Herein, the proposed label-free simultaneous fluorescence detection of virus DNA and microRNA was developed. 3.2. Experimental feasibility for simultaneous detection To further verify the feasibility of this method, the fluorescence spectra were applied and tested. As indicated in Fig. 1, the probes only responded to the specific targets, and emitted at the corresponding wavelength. In the presence of H5N1, only a specific fluorescence signal derived from the G-quadruplex/ThT duplex with a characteristic peak of 487 nm was recorded, but no remarkable AgNC fluorescence signal at the emission wavelength of 607 nm was observed (Fig. 1a). On the contrary, no fluorescence signal of the G-quadruplex/ThT duplex and significant AgNC fluorescence signal was observed with the presence of H1N1 (Fig. 1b). The coexistence of H5N1 and H1N1 might lead to the simultaneously enhanced fluorescence signals of both G-quadruplex/ThT duplex and AgNCs (Fig. 1c). The results indicated the effectiveness of simultaneous detection for multiple virus genes. Next, mutual interference of target virus genes was also investigated. Fig. 2a shows that the fluorescent signal of the G-quadruplex/ThT duplex for detecting H5N1 was not subject to interference when H1N1 was present at various concentrations. Accordingly, as shown in Fig. 2b, the presence of various concentrations of H5N1 would not affect the response signal of AgNCs for monitoring H1N1. Overall, the
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
4
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
Scheme 1. Schematic representation of label-free and simultaneous detection of multiple targets.
proposed approach was feasible and successfully used for simultaneous detection. In addition, circular dichroism (CD) was applied to validate the G-quadruplex conformation. As illustrated in Fig. 3, there was a characteristic peak of parallel G-quadruplexes near 270 nm and a trough near 245 nm. When H5N1 was added, the characteristic
peak was significantly increased because more G-quadruplexes were released and formed. Subsequently, UVeVis spectroscopy was used to characterize AgNCs. Fig. S1 shows the UVeVis absorption responses of DNA/AgNCs in the presence and absence of H1N1. There was only one peak at 430 nm for dark AgNCs, as a result of the surface plasmon resonance peak of the Ag nanoparticles (curve a).
Fig. 1. Fluorescence intensity of samples under different conditions: (a) 500 nM probe, 200 nM H5N1; (b) 500 nM probe, 400 nM H1N1 (c) 500 nM probe, 200 nM H5N1, 400 nM H1N1, 1 mM ThT.
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
5
With the addition of H1N1, an absorption peak at 560 nm corresponding to the characteristic absorption of DNA/AgNCs appeared (curve b). 3.3. Optimization of experimental conditions To achieve the maximum fluorescent sensing performance, the reaction parameters that should be necessarily optimized are pH and the reaction ratio for AgNCs, the concentrations of potassium ions (Kþ), magnesium ions (Mg2þ) and ThT for G-quadruplexes, and hybridization temperature and reaction time. First, in order to obtain optimal fluorescence signal for bright AgNCs, the pH and reaction ratio were properly optimized. As shown in Fig. S2 and S3, when the pH was at 6.8 and reaction ratio (DNA template: Agþ: NaBH4) was chosen as 1: 18: 18, the response signal showed the most optimal performance due to the relatively stable formation of AgNCs. Moreover, the concentrations of Kþ, Mg2þ, and ThT played important roles in the fluorescence intensity of the G-quadruplex/ ThT duplex. Figs. S4 e S6 depict the fluorescence responses to the concentrations of Kþ, Mg2þ, and ThT, respectively. The (F/F0)-1 values (where F and F0 represent the fluorescence intensity in the presence and absence of targets, respectively) were employed to evaluate the sensitivity of the method. With increasing concentrations, the (F/F0)-1 values initially increased and then decreased. Thus, the optimum concentrations of Kþ, Mg2þ, and ThT were selected as 20 mM, 5 mM, and 1 mM, respectively, in the following experiments. The hybridization temperature and reaction time were also vital for this assay. Measurements of the fluorescence of AgNCs and the G-quadruplex/ThT duplex with increasing time and temperature displayed remarkable changes. Fig. S7 illustrates that the fluorescence change (F/F0) gradually increased and reached plateaus within 30 min for H5N1 detection and 40 min for H1N1 detection. Therefore, 40 min was comprehensively chosen for subsequent study. The fluorescence intensity could be influenced by the hybridization temperature as well. As shown in Fig. S8, the F/F0 values arrived with peaks at 37 C with the increase in temperature, and 37 C was the most optimal choice for simultaneous detection. Under the above optimized conditions, a detection protocol was attained that resulted in more optimal response performance for simultaneously monitoring multiple influenza A virus DNA. Fig. 2. Mutual interference of target virus genes for fluorescence response. (a) The fluorescent signal of G-quadruplex/ThT duplex for detecting H5N1 with the presence of H1N1 at various concentrations; (b) The fluorescent signal of AgNCs for detecting H1N1 with the presence of H5N1 at various concentrations.
Fig. 3. CD spectra of the probe with absence and presence of H5N1 virus DNA.
3.4. Sensitivity investigation for the assay Under the optimized conditions discussed above, targets were simultaneously monitored by the probe integrated with G-quadruplexes and AgNCs. As displayed in Fig. 4a, the fluorescence intensity at the emission wavelength of 487 nm increased with increasing concentration of the H5N1 gene. Moreover, the fluorescence change value (FeF0) showed a clear linear dependence (R2 ¼ 0.9954) on the H5N1 concentration over the range from 0.5 to 200 nM (Fig. 4b). The regression equation used was F F0 ¼ 1.65 C þ 11.55, where F0 and F denote the fluorescence intensities without and with the presence of target, respectively, and C denotes the concentration of H5N1. The detection limit was estimated to be 0.45 nM (3s/slope, s denotes the standard deviation of the blank solution, n ¼ 11). Then, the variance of the fluorescence emission spectra with the concentration of H1N1 was measured. With increasing H1N1 gene concentration, Fig. 4c shows the enhanced fluorescence intensity at the emission wavelength of 607 nm. The calibration plot exhibits a linear relationship between F F0 values and the H1N1 concentrations ranging from 10 nM to 400 nM with a correlation coefficient of 0.9986 (Fig. 4d). The linear regression equation is expressed as F F0 ¼ 0.48 Ce1.78 with a detection limit of 10 nM. In addition, the performance of this assay
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
6
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
Fig. 4. (a) Fluorescence emission spectra of ThT for detection of H5N1 with different concentrations: (1) 0 nM, (2) 0.5 nM, (3) 1 nM, (4) 5 nM, (5) 10 pM, (6) 25 nM, (7) 50 nM, (8) 100 nM, (9) 200 nM; (b) Linear relationship between DF ¼ F F0 (where F and F0 are the fluorescence intensity with and without the presence of H5N1, respectively) and the concentration of target from 0.5 nM to 200 nM; (c) Fluorescence emission spectra of AgNCs for detection of H1N1 with different concentrations: (1) 0 nM, (2) 10 nM, (3) 25 nM, (4) 50 nM, (5) 100 pM, (6) 200 nM, (7) 300 nM, (8) 400 nM; (d) Linear relationship between DF and the concentration of target from 10 nM to 400 nM. The error bar represents the standard deviation of three measurements.
Table 3 Comparison of different methods for simultaneous detection. Methods
Detection limit
Quencher
Label signal
Ref.
Fluorescence Fluorescence Fluorescence Electrochemical Fluorescence
50 pM 2.4 nM 25 nM 0.1 nM 0.45 nM
TaS2 N,S-rGO Quencher-free Quencher-free Quencher-free
FAM; Texas Red Dual QD Label-free Label-free Label-free
[28] [29] [30] [31] This work
was compared with other existing methods for simultaneous detection in Table 3. Next, this versatile platform was used to detect multiple miRNAs. As shown in Fig. 5, the FeF0 value exhibited a linear dependence (R2 ¼ 0.9947) on the miRNA-141 concentration over the range from 1 to 400 nM (Fig. 5a and b). The detection limit was estimated to be 1 nM. Moreover, with the miRNA-21 concentrations ranging from 10 nM to 400 nM, Fig. 5c and d shows a linear relationship with a correlation coefficient of 0.9957 and a detection limit of 10 nM. The above results demonstrate that the proposed method possesses excellent sensitivity for simultaneous detection of multiple targets.
3.5. Selective detection of targets for the assay The developed strategy was further implemented for selective detection of viral DNA and miRNA. The variances in fluorescence intensity were recorded with DNA strands that possessed different mismatched bases. Fig. 6 shows the fluorescence change values toward different targets with concentrations of 25 nM. The response difference caused by single-base mismatched (SM),
double-base mismatched (DM), three-base mismatched (TM), and non-complementary (NC) DNA strands was significantly lower than that caused by the virus DNA. As displayed in Fig. 7, the FeF0 values of other miRNAs with high sequence homology were observably lower, whereas in the presence of target miRNA-141 and miRNA-21, significant fluorescence changes were observed. These results demonstrated the excellently selective of the proposed method for distinguishing other types of interference.
3.6. Real sample application To demonstrate the feasibility of the proposed method in the analysis of real samples, a series of various concentrations of target virus DNAs was added to 100-fold-diluted human serum provided by the Hospital of Xiangtan University. As illustrated in Fig. 8, the responses generated by H5N1 and H1N1 were similar to those obtained in the control buffer. At the same time, miRNA-141 in the cell lysates including 22Rv1 cells (human prostate cancer cell with overexpression of miRNA-141) and HeLa cells (human cervical cancer cell with low level expression of miRNA-141), and miRNA-21 in the cell lysates including LO2 (normal hepatic cells) and MCF-7
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
7
Fig. 5. (a) Fluorescence emission spectra of ThT for detection of miR-141 with different concentrations: (1) 0 nM, (2) 1 nM, (3) 5 nM, (4) 10 nM, (5) 25 pM, (6) 50 nM, (7) 100 nM, (8) 200 nM, (9) 300 nM, (10) 400 nM; (b) Linear relationship between DF ¼ F F0 (where F and F0 are the fluorescence intensity with and without the presence of miR-141, respectively) and the concentration of target from 1 nM to 400 nM; (c) Fluorescence emission spectra of AgNCs for detection of miR-21 with different concentrations: (1) 0 nM, (2) 10 nM, (3) 25 nM, (4) 50 nM, (5) 100 pM, (6) 200 nM, (7) 300 nM, (8) 400 nM; (d) Linear relationship between DF and the concentration of target from 10 nM to 400 nM. The error bar represents the standard deviation of three measurements.
Fig. 6. Selectivity of the sensing assay for virus DNAs. (a) The concentrations of H5N1, single-base mismatched (SM), double-base mismatched (DM), three-base mismatch (TM) and non-complementary (NC) DNA strands are both 25 nM; (b) The concentrations of H1N1, SM, DM, TM and NC DNA strands are both 25 nM. The error bar represents the standard deviation of three measurements.
Fig. 7. Selectivity of the sensing assay for target miRNAs. (a) The concentrations of miR-141, miR-200b, miR-429, and miR-21 are both 100 nM; (b) The concentrations of miR-21, miR-122, miR-141, and miR-26a are both 100 nM. The error bar represents the standard deviation of three measurements.
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
8
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
Fig. 8. Results for the detection of virus DNAs in buffer and human serum. Experimental conditions: 500 nM probe, 37 C, 40 min. The error bar represents the standard deviation of three measurements.
Fig. 9. Results for the detection of miRNAs in the lysates cell. Experimental conditions: 500 nM probe, 37 C, 40 min. The error bar represents the standard deviation of three measurements.
(human breast adenocarcinoma) were monitored. As shown in Fig. 9a, because of the lysate from the growing number of 22Rv1 cells, a gradually enhanced fluorescence intensity was observed, whereas the cell lysates of HeLa cells caused slight increases in the fluorescence response. The obtained results proved that there was obviously different miRNA-141 content in the two type of cells, which is consistent with previous studies [32,33]. In addition, as shown in Fig. 9b, the lysate from MCF-7 led to an obvious increase compared with LO2, indicating a high content of miRNA-21 in the MCF-7 cells and that miRNA-21 is overexpressed in MCF-7 cells rather than in other cells, which is in good agreement with previous reports [34,35]. Therefore, our simultaneous detection method had been successfully applied to monitoring of real samples and holds considerable potential for further application in clinical diagnosis. 4. Conclusions In this work, we have successfully proposed a rapid, label-free, multifunctional fluorescent probe for simultaneous detection of multiple virus DNAs and miRNAs based on G-quadruplexes and AgNCs. This method exhibited high sensitivity and selectivity, and quickly detected targets in 40 min. Furthermore, with our method, targets in biological fluid were effectively recognized. What is more important is that this method possesses some remarkable advantages compared to previously reported strategies. First, our method is low-cost and simple because no complicated labels are required. Then, simultaneous detection of multiple targets improved the detection efficiency so that more targets were detected during the same amount of time. Therefore, this rapid, simple, sensitive, and label-free detection strategy might provide new insight into the
simultaneous detection of multiple targets. Notes The authors declare no competing financial interest. Declaration of interest statement No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. Acknowledgment This work was supported by the National Natural Science Foundation of China (No. 21775132, 21505112), Scientific Research Foundation of Hunan Provincial Education Department (No. 16A204), Hunan 2011 Collaborative Innovation Center of Chemical Engineering & Technology with Environmental Benignity and Effective Resource Utilization, the project of innovation team of the Ministry of Education (IRT_17R90) and “1515” academic leader team program of Hunan Agricultural University. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.aca.2018.11.062. References [1] D.M. Morens, G.K. Folkers, A.S. Fauci, The challenge of emerging and re-
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx emerging infectious diseases, Nature 430 (2004) 242e249. [2] J.F. Perz, G.L. Armstrong, L.A. Farrington, Y.J.F. Hutin, B.P. Bell, The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide, J. Hepatol. 45 (2006) 529e538. ~es-Wüst, B. Baumann, S.H. Leech, D. Fabbro, R.A. Stahel, [3] R.A. Olie, A.P. Simo U. Zangemeister-Wittke, A novel antisense oligonucleotide targeting survivin expression induces apoptosis and sensitizes lung cancer cells to chemotherapy, Cancer Res. 60 (2000) 2805e2809. [4] A. Ashkenazi, P. Holland, S.G. Eckhardt, Ligand-based targeting of apoptosis in cancer: the potential of recombinant human apoptosis ligand 2/tumor necrosis factorerelated apoptosis-inducing ligand (rhApo2L/TRAIL), J. Clin. Oncol. 26 (2008) 3621e3630. [5] D.M. Parkin, The global health burden of infection-associated cancers in the year 2002, Int. J. Canc. 118 (2006) 3030e3044. [6] L. Wang, J. Zhu, L. Han, L. Jin, C. Zhu, E. Wang, S. Dong, Graphene-based aptamer logic gates and their application to multiplex detection, ACS Nano 6 (2012) 6659e6666. [7] J. Wang, G. Liu, A. Merkoçi, Electrochemical coding technology for simultaneous detection of multiple DNA targets, J. Am. Chem. Soc. 125 (2003) 3214e3215. [8] C. Wu, D. Fan, C. Zhou, Y. Liu, E. Wang, Colorimetric strategy for highly sensitive and selective simultaneous detection of histidine and cysteine based on G-quadruplex-Cu (II) metalloenzyme, Anal. Chem. 88 (2016) 2899e2903. [9] H. Katano, M. Kano, T. Nakamura, T. Kanno, H. Asanuma, T. Sata, A novel realtime PCR system for simultaneous detection of human viruses in clinical samples from patients with uncertain diagnoses, J. Med. Virol. 83 (2011) 322e330. [10] C.F. Ryschkewitsch, P.N. Jensen, E.O. Major, Multiplex qPCR assay for ultrasensitive detection of JCV DNA with simultaneous identification of genotypes that discriminates non-virulent from virulent variants, J. Med. Virol. 57 (2013) 243e248. [11] S. Ishii, G. Kitamura, T. Segawa, A. Kobayashi, T. Miura, D. Sano, S. Okabe, Microfluidic quantitative PCR for simultaneous quantification of multiple viruses in environmental water samples, Appl. Environ. Microbiol. 80 (2014) 7505e7511. [12] X. Chen, X. Jia, J. Han, J. Ma, Z. Ma, Electrochemical immunosensor for simultaneous detection of multiplex cancer biomarkers based on graphene nanocomposites, Biosens. Bioelectron. 50 (2013) 356e361. [13] L. Yang, N. Huang, Q. Lu, M. Liu, H. Li, Y. Zhang, S. Yao, A quadruplet electrochemical platform for ultrasensitive and simultaneous detection of ascorbic acid, dopamine, uric acid and acetaminophen based on a ferrocene derivative functional Au NPs/carbon dots nanocomposite and graphene, Anal. Chim. Acta 903 (2016) 69e80. [14] C. Wang, J. Du, H. Wang, C. Zou, F. Jiang, P. Yang, Y. Du, A facile electrochemical sensor based on reduced graphene oxide and Au nanoplates modified glassy carbon electrode for simultaneous detection of ascorbic acid, dopamine and uric acid, Sensor. Actuator. B Chem. 204 (2014) 302e309. [15] H. Zhang, X. Ma, Y. Liu, N. Duan, S. Wu, Z. Wang, B. Xu, Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus, Biosens. Bioelectron. 74 (2015) 872e877. [16] Y. Li, X. Qi, C. Lei, Q. Yue, S. Zhang, Simultaneous SERS detection and imaging of two biomarkers on the cancer cell surface by self-assembly of branched DNA-gold nanoaggregates, Chem. Commun. 50 (2014) 9907e9909. [17] L. Xu, W. Yan, W. Ma, H. Kuang, X. Wu, L. Liu, Y. Zhao, L. Wang, C. Xu, SERS encoded silver pyramids for attomolar detection of multiplexed disease biomarkers, Adv. Mater. 27 (2015) 1706e1711. [18] Z. Cheng, N. Choi, R. Wang, S. Lee, K.C. Moon, S. Yoon, L. Chen, J. Choo, Simultaneous detection of dual prostate specific antigens using surface-
[19]
[20] [21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32] [33] [34]
[35]
9
enhanced Raman scattering-based immunoassay for accurate diagnosis of prostate cancer, ACS Nano 11 (2017) 4926e4933. M.S. Hizir, M. Balcioglu, M. Rana, N.M. Robertson, M.V. Yigit, Simultaneous detection of circulating oncomiRs from body fluids for prostate cancer staging using nanographene oxide, ACS Appl. Mater. Interfaces 6 (2014) 14772e14778. M. Zhang, Y. Liu, C. Yu, B. Yin, B. Ye, Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters, Analyst 138 (2013) 4812e4817. J. Zhang, Y. Xia, M. Chen, D. Wu, S. Cai, M. Liu, W. He, J. Chen, A fluorescent aptasensor based on DNA-scaffolded silver nanoclusters coupling with Zn (II)ion signal-enhancement for simultaneous detection of OTA and AFB 1, Sensor. Actuator. B Chem. 235 (2016) 79e85. Y. Zhang, C. Li, B. Tang, C. Zhang, Homogeneously sensitive detection of multiple DNA glycosylases with intrinsically fluorescent nucleotides, Anal. Chem. 89 (2017) 7684e7692. M. Luan, N. Li, W. Pan, L. Yang, Z. Yu, B. Tang, Simultaneous detection of multiple targets involved in the PI3K/AKT pathway for investigating cellular migration and invasion with a multicolor fluorescent nanoprobe, Chem. Commun. 53 (2017) 356e359. N. Parvin, Q. Jin, Y. Wei, R. Yu, B. Zheng, L. Huang, Y. Zhang, L. Wang, H. Zhang, M. Gao, H. Zhao, W. Hu, Y. Li, D. Wang, Few-Layer graphdiyne nanosheets applied for multiplexed real-time DNA detection, Adv. Mater. 29 (2017), 1606755. G. Liu, J. Li, D. Feng, J. Zhu, Wei Wang, Silver nanoclusters beacon as stimuliresponsive versatile platform for multiplex DNAs detection and aptamersubstrate complexes sensing, Anal. Chem. 89 (2016) 1002e1008. J. Mohanty, N. Barooah, V. Dhamodharan, S. Harikrishna, P.I. Pradeepkumar, A.C. Bhasikuttan, Thioflavin T as an efficient inducer and selective fluorescent sensor for the human telomeric G-quadruplex DNA, J. Am. Chem. Soc. 135 (2013) 367e376. J. Liu, Y. Lu, L. Feng, S. Wang, S. Zhang, X. Zhu, L. Sheng, S. Zhang, X. Zhang, Pinpoint the positions of single nucleotide polymorphisms by a nanocluster dimer, Anal. Chem. 89 (2017) 2622e2627. Y. Zhang, B. Zheng, C. Zhu, X. Zhang, C. Tan, H. Li, B. Chen, J. Yang, J. Chen, Y. Huang, L. Wang, H. Zhang, Single-layer transition metal dichalcogenide nanosheet-based nanosensors for rapid, sensitive, and multiplexed detection of DNA, Adv. Mater. 27 (2015) 935e939. L. Chen, L. Song, Y. Zhang, P. Wang, Z. Xiao, Y. Guo, F. Cao, Nitrogen and sulfur codoped reduced graphene oxide as a general platform for rapid and sensitive fluorescent detection of biological species, ACS Appl. Mater. Interfaces 8 (2016) 11255e11261. Y. Zhang, C. Zhu, L. Zhang, C. Tan, J. Yang, B. Chen, L. Wang, H. Zhang, DNAtemplated silver nanoclusters for multiplexed fluorescent DNA detection, Small 11 (2015) 1385e1389. D. Zhang, Y. Peng, H. Qi, Q. Gao, C. Zhang, Label-free electrochemical DNA biosensor array for simultaneous detection of the HIV-1 and HIV-2 oligonucleotides incorporating different hairpin-DNA probes and redox indicator, Biosens. Bioelectron. 25 (2010) 1088e1094. S.D. Selcuklu, M.T.A. Donoghue, C. Spillane, miR-21 as a key regulator of oncogenic processes, Biochem. Soc. Trans. 37 (2009) 918e925. M.-L. Si, S. Zhu, H. Wu, Z. Lu, F. Wu, Y.-Y. Mo, miR-21-mediated tumor growth, Oncogene 26 (2007) 2799e2803. B.C. Yin, Y.Q. Liu, B.C. Ye, One-step, multiplexed fluorescence detection of microRNAs based on duplex-specific nuclease signal amplification, J. Am. Chem. Soc. 134 (2012) 5064e5067. W. Zhou, W. Liang, X. Li, Y. Chai, R. Yuan, Y. Xiang, MicroRNA-triggered, cascaded and catalytic self-assembly of functional DNAzyme ferris wheel nanostructures for highly sensitive colorimetric detection of cancer cells, Nanoscale 7 (2015) 9055e9061.
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Contents lists available at ScienceDirect
Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca
Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs Yunpeng Han a, Feng Zhang b, Hang Gong a, **, Changqun Cai a, * a
Key Laboratory for Green Organic Synthesis and Application of Hunan Province, Key Laboratory of Environmentally Friendly Chemistry and Application of Ministry of Education, College of Chemistry, Xiangtan University, Xiangtan, 411105, China College of Science, Hunan Agricultural University, Changsha, 410128, China
b
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
A rapid, label-free and multifunctional fluorescent probe was fabricated to overcome cumbersome labeling procedures. The system based on G-quadruplexes and DNA-templated silver nanoclusters (AgNCs) was designed for improving the sensitivity for simultaneous detection of virus DNA and microRNA. The proposed strategy exhibited special selectivity in similar oligonucleotides and could be well applied in biological fluids. The detection limit for H5N1 and H1N1 was estimated to be 0.45 nM and 10 nM respectively, and for miRNA-141 and miRNA-21was 1 nM and 10 nM respectively.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 September 2018 Received in revised form 26 November 2018 Accepted 30 November 2018 Available online xxx
A rapid, label-free, and multifunctional fluorescent probe for simultaneous detection of multiple targets was fabricated based on G-quadruplexes and DNA-templated silver nanoclusters (AgNCs). In this work, a probe with two capitated recognized regions was coupled with a locked G-quadruplex at the 50 -terminus and dark AgNC at the 30 -terminus. Upon the addition of the virus subtype H5N1 gene or microRNA-141, only the sequence of the G-quadruplex was released and bound with Thioflavin T (ThT) for a specific fluorescent response. On the contrary, with the presence of the influenza virus subtype H1N1 gene or microRNA-21, the fluorescence intensity was enhanced because of two split AgNCs approaching closely to produce a nanocluster dimer. Subsequently, with multiple target addition, fluorescence signals were produced for both G-quadruplexes and AgNCs. Moreover, this single and duplex detection for virus DNAs and microRNAs, which provides a versatile platform for different targets, was sufficiently sensitive for the expected detection limit, and still possessed unique selectivity with similar oligonucleotides. The
Keywords: Multifunctional G-quadruplex-based DNA-Templated AgNCs Fluorescent Simultaneous detection
* Corresponding author. ** Corresponding author. E-mail address: [email protected] (C. Cai). https://doi.org/10.1016/j.aca.2018.11.062 0003-2670/© 2018 Elsevier B.V. All rights reserved.
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
2
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
simultaneous detection of targets in biological fluids indicated that there is great opportunity for this strategy to be further applied in biomedical research and clinical diagnosis. © 2018 Elsevier B.V. All rights reserved.
1. Introduction Threats to human health caused by viral infectious diseases or cancers still have a tremendous influence on human society [1e5]. The appearance of diseases may be accompanied by changes in many diagnostic indexes, leading to difficulties in early and accurate diagnosis for disease therapy. Compared to single detection, simultaneous detection of multiple biomarkers, such as DNAs, microRNAs, small molecules, and proteins [6e8], is more desirable because of the higher detection efficiency and more accurate diagnosis. However, the complexity of the detection system and the inability to generate unique signals without interference often result in difficulty in simultaneously detecting targets. Thus, the development of highly sensitive and simultaneous detection for multiple biomarkers of critical diseases is challenging. At present, many methods have been applied for multiple detection. For example, polymerase chain reaction (PCR) [9e11] is frequently used to detect multiple targets because of its exquisite sensitivity and specificity, but it is difficult to design experiments to test short-length oligonucleotides. Electrochemical sensors [12e14] have been widely applied for sensitive and simultaneous detection of multiple biomarkers, because of time-saving, simple, and inexpensive analysis. However, their use in various applications has not expanded due to their instability and the difficulty in modification of their electrodes, which limit development. Surfaceenhanced Raman spectroscopy (SERS) [15e18] is feasible for simultaneous detection, because samples can be rapidly detected with high accuracy and without the necessity of sample pretreatment. However, it would be necessary for SERS probes to be combined with metal nanoparticles for this type of detection, leading to complicated synthetic steps. In addition, fluorescent methods, with the advantage of simple operation, stability, and fast detection, have also been developed for simultaneous detection based on molecular beacon and fluorescence quenching methods [19e23]. For example, Wang et al. has developed few-layer graphdiyne nanosheets that are used as novel sensing platforms for a variety of fluorophores for real-time detection of DNA with low background and high signal-to-noise ratio [24]. Nevertheless, experiments are complex and difficult to perform because of the synthesis of quencher and modification of fluorophores. Zhu's group has synthesized a silver nanocluster beacon that can be activated as a stimuli-responsive versatile platform for multiplex target detection [25]. However, some limits, such as requiring additional quencher and cumbersome modification, also exist with these methods. To address these difficulties mentioned above, we sought to design a label-free and quencher-free simultaneous detection strategy for multiple targets. In our work, rapid, quencher-free, and label-free simultaneous detection of multiple targets is proposed in combination with Gquadruplexes and DNA-templated silver nanoclusters (AgNCs). Genes of influenza A virus subtypes H5N1 and H1N1 were chosen as the models in this study for simultaneous detection. First, thioflavin T (ThT), which is a water-soluble benzothiazole salt fluorescent dye that is cell-permeable with superior selectivity for Gquadruplex [26], was selected for label-free detection of H5N1. A nanocluster dimer produced by two closely split AgNCs [27] was selected for label-free detection of H1N1. Next, with the H5N1
addition, only the G-quadruplex/ThT duplex was formed for specific and enhanced fluorescence response. In addition, an increase in the fluorescence intensity of AgNCs only occurred with the presence of H1N1 because dark AgNCs became bright nanocluster dimers. Then, with the addition of H5N1 and H1N1, the probe with two capitated recognized regions was hybridized with targets. Additionally, a G-quadruplex/ThT duplex and nanocluster dimer was formed, and the corresponding fluorescence was produced. Moreover, this label-free simultaneous detection possessed good sensitivity with a detection limit of 0.45 nM (H5N1) and 10 nM (H1N1). MicroRNA-141 (miR-141) and microRNA-21 (miR21) are both biomarkers of prostate cancer and indicators for identifying the stages of prostate cancer [19]. MiR-141 is significantly elevated in advanced prostate cancer, but its expression is normal in the early stages of the cancer. However, miR-21 is overexpressed in the early stage, but not in advanced prostate cancer. The versatile label-free method described above was also performed for the simultaneous detection of miR-141 and miR-21 with great sensitivity and selectivity. This approach also had various advantages, such as rapid detection in 40 min, low cost without the need for labeling procedures, and process simplicity without requiring large precision instruments. This simultaneous detection method would also be able to detect targets in biological fluids, and there is great potential application for its use in clinical diagnostics and biomedical research. 2. Materials and methods 2.1. Materials and reagents The DNA and microRNA oligonucleotides were synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China). The sequences of oligonucleotides used in the study are listed in Table 1 and Table 2. Silver nitrate (AgNO3) and sodium borohydride (NaBH4) were purchased from Energy Chemical (Shanghai, China). ThT (4-(3,6dimethyl-1,3-benzothiazol-3-ium-2-yl)-N,N-dimethylaniline chloride) was provided by J&K Scientific Co., Ltd. (Beijing, China). All reagents were of analytical grade and used without further purification. Ultrapure water (18.2 MU) was supplied from a water purification system (Aquapro, DE, USA). A reaction buffer (pH 6.8) containing 20 mM phosphate buffered saline (PBS), 20 mM KNO3 and 5 mM Mg(NO3)2 was used in the experiment unless otherwise stated. Each DNA oligonucleotide was heated to 95 C for 5 min and then slowly cooled to room temperature for 1 h before use. 2.2. Apparatus Fluorescence measurements were obtained with an RF-5300PC spectrofluorometer (Shimadzu Corporation, Kyoto, Japan). ThT was excited at 420 nm with a wavelength range of 450e600 nm, and the AgNCs were excited at 560 nm with a wavelength range of 575e680 nm. The slit widths of the excitation and emission were both 5 nm. Circular dichroism (CD) analysis was recorded on a Chirascan™ CD chiroptical spectrometer (Applied Photophysics Ltd., Leatherhead, UK). Absorbance spectra measurements were obtained on a UV-2450 spectrophotometer (Shimadzu Co., Ltd.,
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx Table 1 Sequences used in our experiments. name
sequences (50 to 30 )
Probe
GGGTGGGTGGGTGGGTAGACTCTTGAGTTCTCAGTATGT CTTGTCTACCCACCATACGGACGTTCTTCATCGAGAGTGT AGTCGCTAGAAGAACGTCCGTCCTCCTTCCTCC CCCTAACTCCCCACGGACGTTCTTCTAG CGACTACACTCTCGATGAAGAA CGACTACACTCTAGATGAAGAA
cDNA H1N1 DNA Single-base mismatch SM1 Double-base mismatch DM1 Three-base mismatch TM1 Non-complementary NC1 H5N1 DNA Single-base mismatch SM2 Double-base mismatchDM2 Three-base mismatch TM2 Non-complementary NC2
CGACTACACTCTAGATTAAGAA CGACTATACTCTAGATTAAGAA ATCAGCACAGATGAGTCTGCTC CATACTGAGAACTCAAGAGTCT CATACTGAGAATTCAAGAGTCT CATACTTAGAATTCAAGAGTCT CATACTTAGAATTCAAGATTCT TGCGACTGTCCAGTGGACTCAC
a The boldfaced letters represent the sequence to form G-quadruplexes; the italic letters are the DNA template for forming AgNCs; the underlined italic letters are the complementary sequence of target DNAs; the underlined letters indicate the mismatched base sequence.
Kyoto, Japan). 2.3. Synthesis of DNA-templated AgNCs In this study, 25 mL of 10 mM DNA template was dissolved in 195 mL of 20 mM PBS buffer (pH 6.8). Then, 15 mL of 300 mM freshly prepared AgNO3 aqueous solution was added, followed by the vigorous shaking of the reaction mixture for 60 s and then incubation for 30 min at 4 C in the dark. Finally, 15 mL of 300 mM freshly prepared NaBH4 was added with vigorous shaking for 60 s, and then, the mixture was incubated in the dark at 4 C for 4 h before use. The final concentrations of DNA template, AgNO3, and NaBH4 were 1 mM, 18 mM, 18 mM, respectively (molar ratio of 1:18:18). 2.4. Fluorescence assay for simultaneous detection The measurements were performed in 250 mL of reaction buffer containing 500 nM probe, 500 nM cDNA-AgNCs, 1 mM ThT and different concentrations of two target virus DNAs or miRNAs at 37 C for 40 min. The fluorescence signals were collected at room temperature under optimal experimental conditions.
Table 2 Sequences used in our experiments for miRNAs detection. name
sequences (50 to 30 )
Probe
GGGTGGGTGGGTGGGTTAACTCATCCATCTTTACC AGACAGTGTTAACCCACCATACGGACGTCAACATCA GTCTGATAAGCTACTATGTTGACGTCCGTCCTCCTTCCTCC CCCTAACTCCCCACGGACGTCAACATAG UAACACUGUCUGGUAAAGAUGG UAGCUUAUCAGACUGAUGUUGA UUCAAGUAAUCCAGGAUAGGCU UGGAGUGUGACAAUGGUGUUUG UAAUACUGUCUGGUAAAACCGU UAAUACUGCCUGGUAAUGAUGA
cDNA miRNA-141 miRNA-21 miRNA-26a miRNA-122 miRNA-429 miRNA-200b
a The boldfaced letters represent the sequence to form G-quadruplexes; the italic letters are the DNA template for forming AgNCs; the underlined italic letters are the complementary sequence of target miRNAs.
3
2.5. CD analysis The CD spectra of DNA oligonucleotides were measured at room temperature in PBS buffer (20 mM, pH 6.8). The optical chamber was deoxygenated with dry purified nitrogen (99.99%) before use and maintained under a nitrogen atmosphere during the measurements. The CD spectra were recorded at the wavelength range of 220e320 nm in a quartz cuvette with a 1-mm path length. Spectra were measured at 100 nm/min scanning mode with 0.5 s response time and 1.0 nm band width. Three scans were averaged to produce each spectrum. The buffer blank was subtracted from the CD data. 3. Results and discussion 3.1. Principle of the fluorescence assay The principle of the label-free, simultaneous detection of multiple targets based on G-quadruplexes and AgNCs is illustrated in Scheme 1. In this strategy, a multifunctional probe with two capitated recognized regions for simultaneous detection was artfully designed. The sequences of capitated region I (blue) and region II (purple) were complementary to Target 1 and Target 2, respectively. In the absence of targets, the G-quadruplex-forming sequence was locked at the 50 end of the probe. Additionally, the dark AgNC at the 30 end was sufficiently far from the free cDNA/AgNC in solution so that it could not form a nanocluster dimer. Therefore, low fluorescent emissions as background were expected. When the targets were added, the two capitated recognized regions hybridized with the targets, and then the probe structure switch followed. The G-quadruplex-forming sequence was released and then was folded into the G-quadruplex, leading to an association with ThT to form a G-quadruplex/ThT duplex and yield a significant fluorescence signal for Target 1 detection. Region III (red) of the probe, which was completely complementary with the hybridization sequence of cDNA, was also exposed so that it would hybridize with cDNA/AgNC, with two AgNCs closely approaching to produce a nanocluster dimer. The fluorescence intensity of the nanocluster dimer was markedly enhanced for the sensitive monitoring of Target 2. Herein, the proposed label-free simultaneous fluorescence detection of virus DNA and microRNA was developed. 3.2. Experimental feasibility for simultaneous detection To further verify the feasibility of this method, the fluorescence spectra were applied and tested. As indicated in Fig. 1, the probes only responded to the specific targets, and emitted at the corresponding wavelength. In the presence of H5N1, only a specific fluorescence signal derived from the G-quadruplex/ThT duplex with a characteristic peak of 487 nm was recorded, but no remarkable AgNC fluorescence signal at the emission wavelength of 607 nm was observed (Fig. 1a). On the contrary, no fluorescence signal of the G-quadruplex/ThT duplex and significant AgNC fluorescence signal was observed with the presence of H1N1 (Fig. 1b). The coexistence of H5N1 and H1N1 might lead to the simultaneously enhanced fluorescence signals of both G-quadruplex/ThT duplex and AgNCs (Fig. 1c). The results indicated the effectiveness of simultaneous detection for multiple virus genes. Next, mutual interference of target virus genes was also investigated. Fig. 2a shows that the fluorescent signal of the G-quadruplex/ThT duplex for detecting H5N1 was not subject to interference when H1N1 was present at various concentrations. Accordingly, as shown in Fig. 2b, the presence of various concentrations of H5N1 would not affect the response signal of AgNCs for monitoring H1N1. Overall, the
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
4
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
Scheme 1. Schematic representation of label-free and simultaneous detection of multiple targets.
proposed approach was feasible and successfully used for simultaneous detection. In addition, circular dichroism (CD) was applied to validate the G-quadruplex conformation. As illustrated in Fig. 3, there was a characteristic peak of parallel G-quadruplexes near 270 nm and a trough near 245 nm. When H5N1 was added, the characteristic
peak was significantly increased because more G-quadruplexes were released and formed. Subsequently, UVeVis spectroscopy was used to characterize AgNCs. Fig. S1 shows the UVeVis absorption responses of DNA/AgNCs in the presence and absence of H1N1. There was only one peak at 430 nm for dark AgNCs, as a result of the surface plasmon resonance peak of the Ag nanoparticles (curve a).
Fig. 1. Fluorescence intensity of samples under different conditions: (a) 500 nM probe, 200 nM H5N1; (b) 500 nM probe, 400 nM H1N1 (c) 500 nM probe, 200 nM H5N1, 400 nM H1N1, 1 mM ThT.
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
5
With the addition of H1N1, an absorption peak at 560 nm corresponding to the characteristic absorption of DNA/AgNCs appeared (curve b). 3.3. Optimization of experimental conditions To achieve the maximum fluorescent sensing performance, the reaction parameters that should be necessarily optimized are pH and the reaction ratio for AgNCs, the concentrations of potassium ions (Kþ), magnesium ions (Mg2þ) and ThT for G-quadruplexes, and hybridization temperature and reaction time. First, in order to obtain optimal fluorescence signal for bright AgNCs, the pH and reaction ratio were properly optimized. As shown in Fig. S2 and S3, when the pH was at 6.8 and reaction ratio (DNA template: Agþ: NaBH4) was chosen as 1: 18: 18, the response signal showed the most optimal performance due to the relatively stable formation of AgNCs. Moreover, the concentrations of Kþ, Mg2þ, and ThT played important roles in the fluorescence intensity of the G-quadruplex/ ThT duplex. Figs. S4 e S6 depict the fluorescence responses to the concentrations of Kþ, Mg2þ, and ThT, respectively. The (F/F0)-1 values (where F and F0 represent the fluorescence intensity in the presence and absence of targets, respectively) were employed to evaluate the sensitivity of the method. With increasing concentrations, the (F/F0)-1 values initially increased and then decreased. Thus, the optimum concentrations of Kþ, Mg2þ, and ThT were selected as 20 mM, 5 mM, and 1 mM, respectively, in the following experiments. The hybridization temperature and reaction time were also vital for this assay. Measurements of the fluorescence of AgNCs and the G-quadruplex/ThT duplex with increasing time and temperature displayed remarkable changes. Fig. S7 illustrates that the fluorescence change (F/F0) gradually increased and reached plateaus within 30 min for H5N1 detection and 40 min for H1N1 detection. Therefore, 40 min was comprehensively chosen for subsequent study. The fluorescence intensity could be influenced by the hybridization temperature as well. As shown in Fig. S8, the F/F0 values arrived with peaks at 37 C with the increase in temperature, and 37 C was the most optimal choice for simultaneous detection. Under the above optimized conditions, a detection protocol was attained that resulted in more optimal response performance for simultaneously monitoring multiple influenza A virus DNA. Fig. 2. Mutual interference of target virus genes for fluorescence response. (a) The fluorescent signal of G-quadruplex/ThT duplex for detecting H5N1 with the presence of H1N1 at various concentrations; (b) The fluorescent signal of AgNCs for detecting H1N1 with the presence of H5N1 at various concentrations.
Fig. 3. CD spectra of the probe with absence and presence of H5N1 virus DNA.
3.4. Sensitivity investigation for the assay Under the optimized conditions discussed above, targets were simultaneously monitored by the probe integrated with G-quadruplexes and AgNCs. As displayed in Fig. 4a, the fluorescence intensity at the emission wavelength of 487 nm increased with increasing concentration of the H5N1 gene. Moreover, the fluorescence change value (FeF0) showed a clear linear dependence (R2 ¼ 0.9954) on the H5N1 concentration over the range from 0.5 to 200 nM (Fig. 4b). The regression equation used was F F0 ¼ 1.65 C þ 11.55, where F0 and F denote the fluorescence intensities without and with the presence of target, respectively, and C denotes the concentration of H5N1. The detection limit was estimated to be 0.45 nM (3s/slope, s denotes the standard deviation of the blank solution, n ¼ 11). Then, the variance of the fluorescence emission spectra with the concentration of H1N1 was measured. With increasing H1N1 gene concentration, Fig. 4c shows the enhanced fluorescence intensity at the emission wavelength of 607 nm. The calibration plot exhibits a linear relationship between F F0 values and the H1N1 concentrations ranging from 10 nM to 400 nM with a correlation coefficient of 0.9986 (Fig. 4d). The linear regression equation is expressed as F F0 ¼ 0.48 Ce1.78 with a detection limit of 10 nM. In addition, the performance of this assay
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
6
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
Fig. 4. (a) Fluorescence emission spectra of ThT for detection of H5N1 with different concentrations: (1) 0 nM, (2) 0.5 nM, (3) 1 nM, (4) 5 nM, (5) 10 pM, (6) 25 nM, (7) 50 nM, (8) 100 nM, (9) 200 nM; (b) Linear relationship between DF ¼ F F0 (where F and F0 are the fluorescence intensity with and without the presence of H5N1, respectively) and the concentration of target from 0.5 nM to 200 nM; (c) Fluorescence emission spectra of AgNCs for detection of H1N1 with different concentrations: (1) 0 nM, (2) 10 nM, (3) 25 nM, (4) 50 nM, (5) 100 pM, (6) 200 nM, (7) 300 nM, (8) 400 nM; (d) Linear relationship between DF and the concentration of target from 10 nM to 400 nM. The error bar represents the standard deviation of three measurements.
Table 3 Comparison of different methods for simultaneous detection. Methods
Detection limit
Quencher
Label signal
Ref.
Fluorescence Fluorescence Fluorescence Electrochemical Fluorescence
50 pM 2.4 nM 25 nM 0.1 nM 0.45 nM
TaS2 N,S-rGO Quencher-free Quencher-free Quencher-free
FAM; Texas Red Dual QD Label-free Label-free Label-free
[28] [29] [30] [31] This work
was compared with other existing methods for simultaneous detection in Table 3. Next, this versatile platform was used to detect multiple miRNAs. As shown in Fig. 5, the FeF0 value exhibited a linear dependence (R2 ¼ 0.9947) on the miRNA-141 concentration over the range from 1 to 400 nM (Fig. 5a and b). The detection limit was estimated to be 1 nM. Moreover, with the miRNA-21 concentrations ranging from 10 nM to 400 nM, Fig. 5c and d shows a linear relationship with a correlation coefficient of 0.9957 and a detection limit of 10 nM. The above results demonstrate that the proposed method possesses excellent sensitivity for simultaneous detection of multiple targets.
3.5. Selective detection of targets for the assay The developed strategy was further implemented for selective detection of viral DNA and miRNA. The variances in fluorescence intensity were recorded with DNA strands that possessed different mismatched bases. Fig. 6 shows the fluorescence change values toward different targets with concentrations of 25 nM. The response difference caused by single-base mismatched (SM),
double-base mismatched (DM), three-base mismatched (TM), and non-complementary (NC) DNA strands was significantly lower than that caused by the virus DNA. As displayed in Fig. 7, the FeF0 values of other miRNAs with high sequence homology were observably lower, whereas in the presence of target miRNA-141 and miRNA-21, significant fluorescence changes were observed. These results demonstrated the excellently selective of the proposed method for distinguishing other types of interference.
3.6. Real sample application To demonstrate the feasibility of the proposed method in the analysis of real samples, a series of various concentrations of target virus DNAs was added to 100-fold-diluted human serum provided by the Hospital of Xiangtan University. As illustrated in Fig. 8, the responses generated by H5N1 and H1N1 were similar to those obtained in the control buffer. At the same time, miRNA-141 in the cell lysates including 22Rv1 cells (human prostate cancer cell with overexpression of miRNA-141) and HeLa cells (human cervical cancer cell with low level expression of miRNA-141), and miRNA-21 in the cell lysates including LO2 (normal hepatic cells) and MCF-7
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
7
Fig. 5. (a) Fluorescence emission spectra of ThT for detection of miR-141 with different concentrations: (1) 0 nM, (2) 1 nM, (3) 5 nM, (4) 10 nM, (5) 25 pM, (6) 50 nM, (7) 100 nM, (8) 200 nM, (9) 300 nM, (10) 400 nM; (b) Linear relationship between DF ¼ F F0 (where F and F0 are the fluorescence intensity with and without the presence of miR-141, respectively) and the concentration of target from 1 nM to 400 nM; (c) Fluorescence emission spectra of AgNCs for detection of miR-21 with different concentrations: (1) 0 nM, (2) 10 nM, (3) 25 nM, (4) 50 nM, (5) 100 pM, (6) 200 nM, (7) 300 nM, (8) 400 nM; (d) Linear relationship between DF and the concentration of target from 10 nM to 400 nM. The error bar represents the standard deviation of three measurements.
Fig. 6. Selectivity of the sensing assay for virus DNAs. (a) The concentrations of H5N1, single-base mismatched (SM), double-base mismatched (DM), three-base mismatch (TM) and non-complementary (NC) DNA strands are both 25 nM; (b) The concentrations of H1N1, SM, DM, TM and NC DNA strands are both 25 nM. The error bar represents the standard deviation of three measurements.
Fig. 7. Selectivity of the sensing assay for target miRNAs. (a) The concentrations of miR-141, miR-200b, miR-429, and miR-21 are both 100 nM; (b) The concentrations of miR-21, miR-122, miR-141, and miR-26a are both 100 nM. The error bar represents the standard deviation of three measurements.
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
8
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx
Fig. 8. Results for the detection of virus DNAs in buffer and human serum. Experimental conditions: 500 nM probe, 37 C, 40 min. The error bar represents the standard deviation of three measurements.
Fig. 9. Results for the detection of miRNAs in the lysates cell. Experimental conditions: 500 nM probe, 37 C, 40 min. The error bar represents the standard deviation of three measurements.
(human breast adenocarcinoma) were monitored. As shown in Fig. 9a, because of the lysate from the growing number of 22Rv1 cells, a gradually enhanced fluorescence intensity was observed, whereas the cell lysates of HeLa cells caused slight increases in the fluorescence response. The obtained results proved that there was obviously different miRNA-141 content in the two type of cells, which is consistent with previous studies [32,33]. In addition, as shown in Fig. 9b, the lysate from MCF-7 led to an obvious increase compared with LO2, indicating a high content of miRNA-21 in the MCF-7 cells and that miRNA-21 is overexpressed in MCF-7 cells rather than in other cells, which is in good agreement with previous reports [34,35]. Therefore, our simultaneous detection method had been successfully applied to monitoring of real samples and holds considerable potential for further application in clinical diagnosis. 4. Conclusions In this work, we have successfully proposed a rapid, label-free, multifunctional fluorescent probe for simultaneous detection of multiple virus DNAs and miRNAs based on G-quadruplexes and AgNCs. This method exhibited high sensitivity and selectivity, and quickly detected targets in 40 min. Furthermore, with our method, targets in biological fluid were effectively recognized. What is more important is that this method possesses some remarkable advantages compared to previously reported strategies. First, our method is low-cost and simple because no complicated labels are required. Then, simultaneous detection of multiple targets improved the detection efficiency so that more targets were detected during the same amount of time. Therefore, this rapid, simple, sensitive, and label-free detection strategy might provide new insight into the
simultaneous detection of multiple targets. Notes The authors declare no competing financial interest. Declaration of interest statement No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. Acknowledgment This work was supported by the National Natural Science Foundation of China (No. 21775132, 21505112), Scientific Research Foundation of Hunan Provincial Education Department (No. 16A204), Hunan 2011 Collaborative Innovation Center of Chemical Engineering & Technology with Environmental Benignity and Effective Resource Utilization, the project of innovation team of the Ministry of Education (IRT_17R90) and “1515” academic leader team program of Hunan Agricultural University. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.aca.2018.11.062. References [1] D.M. Morens, G.K. Folkers, A.S. Fauci, The challenge of emerging and re-
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062
Y. Han et al. / Analytica Chimica Acta xxx (xxxx) xxx emerging infectious diseases, Nature 430 (2004) 242e249. [2] J.F. Perz, G.L. Armstrong, L.A. Farrington, Y.J.F. Hutin, B.P. Bell, The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide, J. Hepatol. 45 (2006) 529e538. ~es-Wüst, B. Baumann, S.H. Leech, D. Fabbro, R.A. Stahel, [3] R.A. Olie, A.P. Simo U. Zangemeister-Wittke, A novel antisense oligonucleotide targeting survivin expression induces apoptosis and sensitizes lung cancer cells to chemotherapy, Cancer Res. 60 (2000) 2805e2809. [4] A. Ashkenazi, P. Holland, S.G. Eckhardt, Ligand-based targeting of apoptosis in cancer: the potential of recombinant human apoptosis ligand 2/tumor necrosis factorerelated apoptosis-inducing ligand (rhApo2L/TRAIL), J. Clin. Oncol. 26 (2008) 3621e3630. [5] D.M. Parkin, The global health burden of infection-associated cancers in the year 2002, Int. J. Canc. 118 (2006) 3030e3044. [6] L. Wang, J. Zhu, L. Han, L. Jin, C. Zhu, E. Wang, S. Dong, Graphene-based aptamer logic gates and their application to multiplex detection, ACS Nano 6 (2012) 6659e6666. [7] J. Wang, G. Liu, A. Merkoçi, Electrochemical coding technology for simultaneous detection of multiple DNA targets, J. Am. Chem. Soc. 125 (2003) 3214e3215. [8] C. Wu, D. Fan, C. Zhou, Y. Liu, E. Wang, Colorimetric strategy for highly sensitive and selective simultaneous detection of histidine and cysteine based on G-quadruplex-Cu (II) metalloenzyme, Anal. Chem. 88 (2016) 2899e2903. [9] H. Katano, M. Kano, T. Nakamura, T. Kanno, H. Asanuma, T. Sata, A novel realtime PCR system for simultaneous detection of human viruses in clinical samples from patients with uncertain diagnoses, J. Med. Virol. 83 (2011) 322e330. [10] C.F. Ryschkewitsch, P.N. Jensen, E.O. Major, Multiplex qPCR assay for ultrasensitive detection of JCV DNA with simultaneous identification of genotypes that discriminates non-virulent from virulent variants, J. Med. Virol. 57 (2013) 243e248. [11] S. Ishii, G. Kitamura, T. Segawa, A. Kobayashi, T. Miura, D. Sano, S. Okabe, Microfluidic quantitative PCR for simultaneous quantification of multiple viruses in environmental water samples, Appl. Environ. Microbiol. 80 (2014) 7505e7511. [12] X. Chen, X. Jia, J. Han, J. Ma, Z. Ma, Electrochemical immunosensor for simultaneous detection of multiplex cancer biomarkers based on graphene nanocomposites, Biosens. Bioelectron. 50 (2013) 356e361. [13] L. Yang, N. Huang, Q. Lu, M. Liu, H. Li, Y. Zhang, S. Yao, A quadruplet electrochemical platform for ultrasensitive and simultaneous detection of ascorbic acid, dopamine, uric acid and acetaminophen based on a ferrocene derivative functional Au NPs/carbon dots nanocomposite and graphene, Anal. Chim. Acta 903 (2016) 69e80. [14] C. Wang, J. Du, H. Wang, C. Zou, F. Jiang, P. Yang, Y. Du, A facile electrochemical sensor based on reduced graphene oxide and Au nanoplates modified glassy carbon electrode for simultaneous detection of ascorbic acid, dopamine and uric acid, Sensor. Actuator. B Chem. 204 (2014) 302e309. [15] H. Zhang, X. Ma, Y. Liu, N. Duan, S. Wu, Z. Wang, B. Xu, Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus, Biosens. Bioelectron. 74 (2015) 872e877. [16] Y. Li, X. Qi, C. Lei, Q. Yue, S. Zhang, Simultaneous SERS detection and imaging of two biomarkers on the cancer cell surface by self-assembly of branched DNA-gold nanoaggregates, Chem. Commun. 50 (2014) 9907e9909. [17] L. Xu, W. Yan, W. Ma, H. Kuang, X. Wu, L. Liu, Y. Zhao, L. Wang, C. Xu, SERS encoded silver pyramids for attomolar detection of multiplexed disease biomarkers, Adv. Mater. 27 (2015) 1706e1711. [18] Z. Cheng, N. Choi, R. Wang, S. Lee, K.C. Moon, S. Yoon, L. Chen, J. Choo, Simultaneous detection of dual prostate specific antigens using surface-
[19]
[20] [21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32] [33] [34]
[35]
9
enhanced Raman scattering-based immunoassay for accurate diagnosis of prostate cancer, ACS Nano 11 (2017) 4926e4933. M.S. Hizir, M. Balcioglu, M. Rana, N.M. Robertson, M.V. Yigit, Simultaneous detection of circulating oncomiRs from body fluids for prostate cancer staging using nanographene oxide, ACS Appl. Mater. Interfaces 6 (2014) 14772e14778. M. Zhang, Y. Liu, C. Yu, B. Yin, B. Ye, Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters, Analyst 138 (2013) 4812e4817. J. Zhang, Y. Xia, M. Chen, D. Wu, S. Cai, M. Liu, W. He, J. Chen, A fluorescent aptasensor based on DNA-scaffolded silver nanoclusters coupling with Zn (II)ion signal-enhancement for simultaneous detection of OTA and AFB 1, Sensor. Actuator. B Chem. 235 (2016) 79e85. Y. Zhang, C. Li, B. Tang, C. Zhang, Homogeneously sensitive detection of multiple DNA glycosylases with intrinsically fluorescent nucleotides, Anal. Chem. 89 (2017) 7684e7692. M. Luan, N. Li, W. Pan, L. Yang, Z. Yu, B. Tang, Simultaneous detection of multiple targets involved in the PI3K/AKT pathway for investigating cellular migration and invasion with a multicolor fluorescent nanoprobe, Chem. Commun. 53 (2017) 356e359. N. Parvin, Q. Jin, Y. Wei, R. Yu, B. Zheng, L. Huang, Y. Zhang, L. Wang, H. Zhang, M. Gao, H. Zhao, W. Hu, Y. Li, D. Wang, Few-Layer graphdiyne nanosheets applied for multiplexed real-time DNA detection, Adv. Mater. 29 (2017), 1606755. G. Liu, J. Li, D. Feng, J. Zhu, Wei Wang, Silver nanoclusters beacon as stimuliresponsive versatile platform for multiplex DNAs detection and aptamersubstrate complexes sensing, Anal. Chem. 89 (2016) 1002e1008. J. Mohanty, N. Barooah, V. Dhamodharan, S. Harikrishna, P.I. Pradeepkumar, A.C. Bhasikuttan, Thioflavin T as an efficient inducer and selective fluorescent sensor for the human telomeric G-quadruplex DNA, J. Am. Chem. Soc. 135 (2013) 367e376. J. Liu, Y. Lu, L. Feng, S. Wang, S. Zhang, X. Zhu, L. Sheng, S. Zhang, X. Zhang, Pinpoint the positions of single nucleotide polymorphisms by a nanocluster dimer, Anal. Chem. 89 (2017) 2622e2627. Y. Zhang, B. Zheng, C. Zhu, X. Zhang, C. Tan, H. Li, B. Chen, J. Yang, J. Chen, Y. Huang, L. Wang, H. Zhang, Single-layer transition metal dichalcogenide nanosheet-based nanosensors for rapid, sensitive, and multiplexed detection of DNA, Adv. Mater. 27 (2015) 935e939. L. Chen, L. Song, Y. Zhang, P. Wang, Z. Xiao, Y. Guo, F. Cao, Nitrogen and sulfur codoped reduced graphene oxide as a general platform for rapid and sensitive fluorescent detection of biological species, ACS Appl. Mater. Interfaces 8 (2016) 11255e11261. Y. Zhang, C. Zhu, L. Zhang, C. Tan, J. Yang, B. Chen, L. Wang, H. Zhang, DNAtemplated silver nanoclusters for multiplexed fluorescent DNA detection, Small 11 (2015) 1385e1389. D. Zhang, Y. Peng, H. Qi, Q. Gao, C. Zhang, Label-free electrochemical DNA biosensor array for simultaneous detection of the HIV-1 and HIV-2 oligonucleotides incorporating different hairpin-DNA probes and redox indicator, Biosens. Bioelectron. 25 (2010) 1088e1094. S.D. Selcuklu, M.T.A. Donoghue, C. Spillane, miR-21 as a key regulator of oncogenic processes, Biochem. Soc. Trans. 37 (2009) 918e925. M.-L. Si, S. Zhu, H. Wu, Z. Lu, F. Wu, Y.-Y. Mo, miR-21-mediated tumor growth, Oncogene 26 (2007) 2799e2803. B.C. Yin, Y.Q. Liu, B.C. Ye, One-step, multiplexed fluorescence detection of microRNAs based on duplex-specific nuclease signal amplification, J. Am. Chem. Soc. 134 (2012) 5064e5067. W. Zhou, W. Liang, X. Li, Y. Chai, R. Yuan, Y. Xiang, MicroRNA-triggered, cascaded and catalytic self-assembly of functional DNAzyme ferris wheel nanostructures for highly sensitive colorimetric detection of cancer cells, Nanoscale 7 (2015) 9055e9061.
Please cite this article as: Y. Han et al., Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2018.11.062