Multiple alternatively spliced transcripts of the receptor tyrosine kinase MuSK are expressed in muscle

Gene 360 (2005) 83 – 91 www.elsevier.com/locate/gene

Multiple alternatively spliced transcripts of the receptor tyrosine kinase MuSK are expressed in muscle Rosemarie Kuehn, Sallee A. Eckler, Medha Gautam * Department of Pharmacological and Physiological Science, St. Louis University School of Medicine, 1402 S. Grand Blvd., St. Louis, MO 63104, United States Received 13 March 2005; received in revised form 16 June 2005; accepted 11 July 2005 Available online 16 September 2005 Received by D.A. Tagle

Abstract We have cloned and characterized five distinct mouse cDNAs encoding isoforms of MuSK, a receptor tyrosine kinase required for the development of the neuromuscular synapse. Comparison of the cDNA sequences with each other and with the mouse genomic sequence revealed that the cDNAs differ by the presence or absence of three alternatively spliced exons encoding an additional 10, 15 and 8 amino acids respectively. The location and sequences of these exons are conserved in MuSK cDNAs from different species. Examination of mouse genomic sequences revealed that the 15 aa exon sequence is present in a 52 bp exon with a non-canonical 3Vsplice acceptor site at its 5Vend and an internal 3Vsplice acceptor site consensus 45 bp downstream. Transcripts containing each of the alternatively spliced exons were detected in neonatal and adult mouse muscle, as well as in C2 myotubes. The presence of transcripts encoding MuSK isoforms with distinct extracellular domains in developing mouse muscle suggests that alternative splicing could potentially introduce additional complexity to the activity of MuSK in muscle. D 2005 Elsevier B.V. All rights reserved. Keywords: Alternative conserved exon; Splice variants; Ectodomain

1. Introduction Formation of neuromuscular synapses involves a series of interactions between motor neurons and their target muscle fibers (Sanes and Lichtman, 2001). During late embryonic development signaling between agrin released by the nerve, and MuSK a receptor tyrosine kinase in the muscle membrane is essential for the clustering of acetylcholine receptors (AChRs) at the developing neuromuscular junction (NMJ) (Reist et al., 1992; Ferns et al., 1993; Valenzuela et al., 1995). Knockout mice lacking either of

Abbreviations: AChR, Acetylcholine receptor; NMJ, Neuromuscular junction; RT, Reverse transcription; PCR, Polymerase chain reaction; dNTP, Deoxynucleotide triphosphate; DMEM, Dulbecco’s Modified Eagle’s Medium; CHO, Chinese Hamster Ovary. * Corresponding author. Tel.: +1 314 977 6353; fax: +1 314 977 6411. E-mail address: [email protected] (M. Gautam). 0378-1119/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2005.07.009

these proteins die perinatally and display similarities in the nature and severity of neuromuscular defects (Gautam et al., 1996, 1999; Glass et al., 1996; DeChiara et al., 1996). AChR clusters fail to aggregate synaptically in MuSK knockout mice. These and other studies have also shown that MuSK plays important roles in other aspects of motor neuron and muscle development, including synaptic gene expression, patterning of skeletal muscle, anchoring of acetylcholinesterase and guidance of motor axons (Moore et al., 2001; Yang et al., 2001; Cartaud et al., 2004; Zhang et al., 2004; Dimitropoulou and Bixby, 2005). From its location in the muscle membrane, MuSK has the capacity to activate multiple developmental pathways, in myotubes as well as in motor neurons. However, a detailed understanding of MuSK function and regulation remains unclear. The mouse Musk gene consists of at least 15 exons distributed over 90 kb on chromosome 4 (Valenzuela et al., 1995, Fig. 1). Analysis of the promoter region of the Musk

84

R. Kuehn et al. / Gene 360 (2005) 83 – 91

(A) APPPWFSMDTSFLWTEWS DYKKENIT

EDREPEQDAK 1

2

3

4

5

6

7

9

8

10 11

12

13

MuSK

14

100 aa transmembrane domain

frizzled domain

immunoglobulinlike domain

signal peptide sequence

*10 aa 1

2 3

45

*15aa 6

7

kinase domain

MuSK gene

*8aa 8-10

11-13 14 15

10 kb

(B) MuSK isoform

Similar to

# of cDNA isolates

MuSK (10,15,8)

-

1

MuSK (0,0,0)

nsk1

4

MuSK (0,0,8)

nsk2/rMuSK/ tMuSK

5

MuSK (10,0,8)

hMuSK

1

MuSK (10,0,0)

-

3

Fig. 1. Organization of mouse MuSK exons and cDNAs. (A) The organization of MuSK exons is shown at the top and bottom of the schematics representing the mouse MuSK protein and genomic sequences respectively. Exon numbers refer to the exons listed in the annotated sequence of the mouse Musk gene obtained from the Ensembl Genome Browser (Ensembl Gene ID ENSMUSG00000057280). Exon 15 codes for an alternatively spliced sequence of 13 aa at the C-terminus that was found in the MuSK cDNA isolates from tumor cells (Ganju et al., 1995). The sequence and position of each alternatively spliced exon identified in this study are as shown. The 8 aa exon corresponds to exon 10 in the annotated sequence; the 10 and 15 aa exons are not numbered and are located in intron 5 and 7 of the annotated sequence respectively. The last 7 bp following the 15 aa sequence encode 3 aa (EWS) and are present in all MuSK transcripts. (B) MuSK cDNAs cloned by RT-PCR using RNA from cultured C2 myotubes. cDNAs diverged in sequence at one of three positions as a result of inclusion or exclusion of exons encoding an additional 10, 15 and 8 amino acids (aa) respectively. Similarities to previously isolated MuSK cDNAs and the number of individual clones encoding a particular isoform are indicated. nsk1, nsk2 = mouse MuSK [16, NM 010944]; rMusk = rat MuSK; hMuSK = human MuSK (Valenzuela et al., 1995), tMuSK = Torpedo MuSK (Jennings et al., 1993). cDNAs for the mouse MuSK variant lacking the third Ig-like domain are smaller in size and were not obtained under these conditions (Hesser et al., 1999).

gene showed that it has multiple transcription start sites and is activated by multiple signals (Lacazette et al., 2003; Kim et al., 2003). Studies on isolation and analysis of MuSK cDNAs from different species showed that MuSK mRNA levels are high in developing skeletal muscle until shortly after birth when they decrease to low levels. MuSK mRNA also increases during myotube formation in cultured cells, in response to denervation, muscle paralysis, and after exposure to agrin or activation of MuSK in the muscle membrane (Valenzuela et al., 1995; Ganju et al., 1995; Bowen et al., 1998; Hesser et al., 1999). However these studies examined the combined expression levels of all MuSK transcripts at individual developmental stages

and did not distinguish between transcripts with variations in the coding region. Conversely, MuSK cDNAs isolated from muscle and other tissues from rats, mice and humans contained small variations in the coding sequence, but it was not established that these differences were a result of alternative splicing of particular exons (Valenzuela et al., 1995). Alternative splicing could result in the expression of MuSK isoforms with differential functions during synapse development; expression of particular MuSK isoforms may be associated with specific stages in synapse formation such as before and after innervation. To determine the extent of variation among MuSK transcripts as a result of alternative splicing we isolated and analyzed

R. Kuehn et al. / Gene 360 (2005) 83 – 91

MuSK cDNAs by RT-PCR from C2 cells, a mouse muscle cell line. We report the isolation of MuSK cDNAs that differed by the presence or absence of exons encoding 10 aa, 8 aa, and a novel exon encoding 15 aa. All three sequences were also present at appropriate locations in the mouse genome, consistent with the idea that they are included or excluded from MuSK transcripts as a result of alternative splicing. We show that MuSK transcripts containing each of the alternatively spliced exons are present in muscle from neonatal and adult mice. The inclusion or exclusion of alternatively spliced exons could potentially generate MuSK isoforms that differ in function, thereby regulating clustering of AChRs and other functions of MuSK at the neuromuscular synapse.

2. Materials and methods 2.1. MuSK cDNA isolation cDNAs were obtained by polymerase chain reaction (PCR) amplification of MuSK transcripts present in RNA from C2 myotubes. First strand cDNA was synthesized by reverse transcription (RT) using a reverse primer containing sequences complementary to the 3V end of the coding sequence of MuSK. The RT reaction was performed by incubating 2 Ag of mRNA with 400 units MMLV-reverse transcriptase (Promega) in a 50 Al reaction mixture according to the manufacturer’s instructions at 37 -C for 3 h. The enzyme was heat inactivated by heating at 65 -C for 5 min, and the samples were stored at 20 -C. An aliquot (5%) of the reverse transcription mix was amplified using the polymerase chain reaction (PCR) using forward and reverse primers that contained sequences from the 5Vand 3V ends of MuSK cDNAs. EcoRI and XbaI restriction enzyme sequences were introduced for cloning purposes at the 5Vend of the forward and reverse primers respectively (forward primer: 5VG GAATTCACCATGAGAGAGCTCGTCAACATTCC3V; reverse primer: 5VGCTCTAGA-TTAGACACCCACCGTTCCCTCT3V). PCR was performed in a 50 Al reaction mixture containing 250 AM dNTPs, and 200 ng of each primer using Pfx DNA polymerase (Invitrogen) according to the manufacturer’s instructions. Cycling conditions were 94 -C, 1 min, followed by 30 cycles at 94 -C 30 s, 42 -C 45 s, 68 -C 3.5 min, and a final incubation at 68 -C for 10 min. The resulting 2.6 kb fragment was gel purified and a second round of PCR amplification was performed with 5% of the original fragment as template using Expand Long Taq Polymerase (Roche Diagnostics). Cycling conditions were 94 -C 2 min; followed by 30 cycles at 94 -C 30 s, 57 -C 30 s, 68 -C 5 min, and a final incubation at 68 -C for 7 min. PCR products were run out on gels, and the expected band of ¨2.6 kb was purified, digested with Xba1 and EcoR1, and ligated into the plasmid BlueScript (Stratagene). Individual clones were sequenced by automated sequencing using ABI PRISM Model 377 and

85

BigDye terminator cycle sequencing ready reaction kit (PerkinElmer), or manually with the Thermo sequenase radiolabeled terminator cycle sequencing kit (US Biochemicals). 33P-labeled nucleotides were purchased from Amersham. The Genbank accession numbers for the mouse MuSK cDNAs identified in this study are AY955296 (MuSK10, 15, 8), AY955297 (MuSK 10, 0, 8), AY955298 (MuSK 10, 0, 0), AY956403 (MuSK 0, 0, 8) and AY956404 (MuSK 0, 0, 0). 2.2. Analysis of genomic sequences The mouse, rat and human genomic sequences containing MuSK were downloaded from the Ensembl Genome Browser (Sanger Institute, www.ensembl.org). Gene IDs were ENSMUSG00000057280 (mouse), ENSRNOG00000013188 (rat), and ENSG00000030304 (human). The locations of the three alternatively spliced exons in the mouse Musk gene were determined by searching the intron sequence where they would be expected to occur with the sequence of each alternatively spliced exon. For example, the location of the 15 aa exon was identified by searching the intron sequence between the exon upstream and downstream of the 15 aa exon (intron 7 in the annotated mouse gene sequence). The 10 aa exon is located in intron 5 in the annotated mouse genome sequence; the 8 aa exon was previously identified in mouse and is exon 10 in the annotated genome sequence (Fig. 1, Ganju et al., 1995). The location and flanking intron sequence of the previously published exon sequences were also obtained using a similar strategy (rat and human 8 aa). The human 10 aa exon was located by searching for its amino acid sequence after translation of the appropriate intron sequences in all three reading frames, because its nucleotide sequence was not available from GenBank (Valenzuela et al., 1995). The remaining orthologous sequences (rat 10 and 15 aa, human 15 aa) were obtained by a different strategy. We reasoned that the exon sequence may be less well conserved across species at the nucleotide level and that the sequence at the exon – intron boundaries would be better conserved in order for appropriate splicing to occur. We therefore searched the rat and human intron sequences with sequences spanning the 3Vend of each exon and the adjacent intronic splice site sequences that were identified by analysis of exon positions in the mouse Musk gene. Using these methods we were able to identify the sequence and positions of all three putative alternatively spliced exons in rat and human MuSK that contain sequences which have substantial homology to those identified by isolation and analysis of mouse MuSK cDNAs. 2.3. PCR amplification and sequencing of mouse genomic DNA Mouse DNA was extracted from the liver of a mouse with a 129 SV/BL6 hybrid background. Human and rat

86

R. Kuehn et al. / Gene 360 (2005) 83 – 91

genomic DNAs were isolated from HeLa cells and cells from the H4IIE rat hepatocyte cell line respectively. Liver tissue was frozen in liquid nitrogen and ground in lysis buffer (10 mM Tris – Cl pH 8.0, 0.1 mM EDTA, 20 Ag/ml RNAse, 0.5% SDS). DNA was extracted by incubation of cells in lysis buffer containing Protease K (100 Ag/ml) for 3 h at 50 -C. Samples were purified by extraction with phenol (equilibrated with 0.5 M Tris –Cl pH 8.0) and genomic DNA isolated by precipitation with an equal volume of ethanol. PCR was performed on genomic DNA from all three species under the same conditions using sequences flanking the 15 aa exon-containing region as primers, which would generate amplification products that were ¨450 bp (mouse and rat) or 340 bp (human). Forward (fwd) and reverse (rev) primers for the PCR on genomic DNAs were as follows. Mouse genomic DNA: fwd, 5V GGTGCCCATGGCTGCTATTGTCTGAAA 3V, rev 5VGATCTGCTGAACAGC-ATCCAACACATGG 3V; rat genomic DNA: fwd 5V GCTCAT-GGCTGCTCCTGCCTGAAA 3V, rev 5VGATCTGCTGAACAGCATCCAACACATGG 3V; human genomic DNA: fwd 5V TCTTCATTTCCTCCGAATCTGCCCA 3V, rev 5V GGCAACA-CAAGACCCTCTCACAGACAA 3V. PCR was performed using Titanium Taq polymerase (Clontech) and 500 ng DNA template according to the manufacturer’s instructions. The cycling profile used was 95 -C 3 min, followed by 35 cycles of 95 -C 30 s, 60 -C 30 s, and 68 -C 1 min. Amplified fragments were gel purified using Geneclean II Kit (Midwest Scientific) and sequenced directly as described previously. 2.4. Culture of C2 myotubes C2 myoblasts were cultured in growth medium containing Dulbecco’s Modified Eagle’s Medium (DMEM) with 20% fetal calf serum, penicillin 100 units/ml and gentamycin 50 Ag/ml on 15 cm plates. When the cells were confluent, the medium was changed to differentiation medium (DMEM with 5% horse serum and antibiotics as above). Myotube cultures were maintained for 4 – 6 days with replacement of medium every 2 – 3 days.

2.6. Detection of MuSK transcripts by RT-PCR To generate first strand cDNA, reverse transcription (RT) was performed in a 50 Al reaction containing 2 Ag of RNA, 10 mM dNTPs, 1.0 Ag of oligo (dT)16 primer, (Roche Scientific), 20 units RNAsin (Promega), and 400 units MMLV reverse transcriptase (RT, Promega). Samples were heated to 65 -C, and chilled on ice before adding the reverse transcriptase. Reactions were incubated at 37 -C for 3 h, incubated at 65 -C to inactivate the RT, and stored at 20 -C. An aliquot (¨2.5 –5%) of the RT reaction was used for amplification of MuSK transcripts by PCR. Adult tissue cDNA in some experiments was obtained from a mouse cDNA panel (Clontech). PCR was performed using MuSK primers that spanned the region containing the alternatively spliced exons and, in parallel, with primers for glyceraldehyde phosphate dehydrogenase (GAPDH) using Titanium Taq polymerase according to the manufacturer’s instructions (Clontech). Primers for the MuSK PCR were fwd 5V CAGGGAAAATTCCAGAATCGCAGTTC 3V, rev 5V CCTGGAGGACGTTATTGACGGGA 3V; primers for GAPDH amplification were fwd 5VTGAAGGTCGGTGTGAACGGATTTGGC 3V, rev 5VCATGTAGGCCATGAG-GTCCACCAC 3V. The amount of RT mix from each tissue used as template in the PCR reaction was adjusted so that the PCR product obtained with GAPDH primers was similar among the samples. An aliquot of the PCR products (20% of the PCR reaction for GAPDH, 80% for MUSK) was run out on gels, and for the MuSK RT-PCR, was transferred to Hybond-N membranes (Amersham). Membranes were probed with MuSK primers, which had sequences corresponding to one of the three alternatively spliced exons or a constitutively expressed exon. Primer sequences were as follows: 15 aa exon 5VCTATGGAT-ACTTCTTTCCTATGGACAG 3V, 8 aa exon 5VTTGTTATGTTTTCTTTTTTATAAT 3V, 10 aa exon 5VAGCGTCCTGCTCAGGTTCTCTGTC 3V, constitutive exon 5VCAAGAGAGTGTGA-AAGAC 3V. Primers were non-radioactively labeled using the biotin 3Vendlabeling kit (Pierce) and hybridizations performed using the North2South Chemiluminescent Hybridization and Detection Kit (Pierce).

2.5. Total RNA isolation RNA was isolated from C2 myotubes cultured on 15 cm plates and treated with or without recombinant agrin for 18 h. The source of agrin was conditioned medium from Chinese Hamster Ovary (CHO) cells stably expressing a recombinant fragment of agrin [x = 12, y = 4, z = 8 isoform, Ferns et al., 1993]. Total RNA from adult tissues (heart, liver, brain, muscle) was isolated from ¨0.4 to 0.8 g of each tissue using the RNAgents total RNA isolation system (Promega). RNA from P0 animals was obtained by extraction from pooled forelimb and hindlimb muscles dissected from newborn pups. All animals were derived from a 129 SV/BL6 hybrid background. Care and handling of animals were in accordance with NIH guidelines.

3. Results 3.1. Alternative splicing results in a diversity of MuSK transcripts in cultured C2 myotubes To obtain full-length MuSK cDNAs from muscle cells, we amplified MuSK-containing sequences by PCR using primers from the 5V and 3V ends of the coding region of MuSK. The template for the PCR reaction was first strand cDNA synthesized by reverse transcription of mRNA from C2 muscle cells using a reverse primer from the 3V end of MuSK. The expected product of ¨2.6 kb was purified and ligated into the plasmid BlueScript

R. Kuehn et al. / Gene 360 (2005) 83 – 91

87

(A) 10 aa exon sequences species

intron

exon

intron

mouse cctgttcctattaacag

AA GAC AGA GAA CCT GAG CAG GAC GCT AAA G E D R E P E Q D A K

gtattttccccttctctctg

rat

cctgttcctattaacag

AA GAC AGT GAA CCC GAG CGG GAC GCT AAA G E D S E P E Q D A K

gtatttttccctctttctgc

cttgtttttattaacag

AA GAA AGT GAA CCC GAA CAA GAT ACT AAA G E E S E P E Q D T K

gtatttttttttctttctgc

human

(B) 8 aa exon sequences species

intron

exon

intron

mouse tatcctttccccctcag

AT TAT AAA AAA GAA AAC ATA ACA A D Y K K E N I T

gtaagtaattttgtttgtgc

rat

tatcctttccccctcag

AT TAT AAA AAA GAA AAC ATA ACA A D Y K K E N I T

gtaagtaattttgtttgtgc

human tatcctttccccttcag

AT TAT AAC AAA GAA AAC CTA AAA A D Y N K E N L K

gtaagtaattgtgtttgtgc

(C) 15 aa exon sequences intron mouse

exon

intron

*

tctctttcttccttcctg C C CCT CCT CCG TGG TTT TCT ATG GAT ACT TCT TTC CTA TGG ACA GAA TGG AG gtaagcatccattattattcc

A**

P

P

P

W

F

S

M

D

T

S

F

L

W

T

E

W

S

rat tctctttcttcctcctccc CG CCT CCC CCG TGC TCT CCT ATG GAC TCT TCT TTC TGA TTA CCA GAA TGG AG gtaagcatccattattcca

X

E

W

S

human ctaacgttctttcttttc TC CTT TAA TTT GAC TTC CTG TGG GAA CTT CCT TTC CTG TTA ATA GAA TGG AG gtaagaaactgttattgta

X

E

W

S

Fig. 2. Nucleotide sequences of alternatively spliced exons and flanking intron sequences are conserved across species. Mouse, rat and human sequences corresponding to the 10 aa exon (A), 8 aa exon (B), and 15 aa exon (C) and flanking regions were confirmed by sequencing of cDNA isolates (mouse sequences only), and by analysis of genomic contigs. Sequences containing the 15 aa exon were also confirmed by PCR amplification of this region using mouse, rat and human genomic DNA, followed by sequencing of amplification products. The encoded amino acids are represented in single letter code below each exon sequence. (*T in mouse contig, C in cDNA and genomic PCR; **valine from mouse contig, alanine from cDNA and genomic PCR). The location of the non-consensus splice acceptor site (TG) at its 5V end and the internal consensus splice acceptor site (AG) 45 bp downstream are in bold letters. Use of the internal consensus site excludes the novel 15 aa sequence and retains a 7 bp sequence present in all MuSK cDNA isolates. In both rats and humans, the 7 bp sequence and flanking splice site sequences are highly conserved but the open reading frames corresponding to the 15 aa coding region are interrupted by stop codons (shown as X). Sequences corresponding to the 15 aa exon were identified in rats and humans by homology searches (see Section 3.2).

(Stratagene). We analyzed 14 individual clones and obtained 5 distinct cDNA sequences, which differed by the inclusion or exclusion of additional sequences at three sites as shown in Fig. 1A. We have named the MuSK isoforms generated by these sequences by referring to these exons in the order of their site of insertion; e.g. MuSK (10, 15, 8) refers to a MuSK isoform containing all three alternatively spliced exons encoding 10, 15 and 8 amino acids. The frequency of occurrence of each cDNA variant is shown in Fig. 1B. Ten out of the 14 (70%) MuSK cDNA clones contained at least one alternatively spliced exon. The number of isolates containing 10 aa and 8 aa exons was approximately equal; MuSK cDNAs containing the 15 aa exon were less abundant.

3.2. Location and sequence of alternatively spliced exons Of the three alternatively spliced exons, only the 8 aa exon sequence has been reported previously in mice (Ganju et al., 1995). We used two methods to confirm that the distinct sequences of mouse MuSK cDNAs resulted from alternative splicing. First, we compared the location and sequence of the unique exon sequences found in mouse cDNA variants with those found previously in rat and human MuSK cDNA variants (Valenzuela et al., 1995). The 10 aa exon in mouse MuSK cDNAs was located at the same position as a similar sequence in human MuSK, and the sequence and location of the 8 aa exon were identical to that in previously isolated MuSK cDNAs (Ganju et al., 1995; Valenzuela et al., 1995). Furthermore, as shown in Fig. 2A,

88

R. Kuehn et al. / Gene 360 (2005) 83 – 91

the amino acid sequences encoded by the mouse and human 10 aa exons shared 70% identity. The amino acid sequences encoded by mouse and rat 8 aa exons shared 100% identity; between mouse and human 8 aa exons the identity was 63%. No rat or human counterpart for the 15 aa exon has been published thus far, but in mouse MuSK this sequence is inserted precisely at a splice site reported for a MuSK variant lacking an Ig-like domain (Hesser et al., 1999). Thus the location and/or translated sequence of these alternatively spliced exons displays a substantial degree of conservation among species. Second, we examined whether the alternatively spliced exon sequences were present in the right position and linear order in the mouse genome. The position of the mouse gene for MuSK was previously localized to chromosome 4 (Valenzuela et al., 1995). The coding sequences for MuSK are distributed over at least 15 exons spanning over 90 kb of the genome (Fig. 1). To identify exon/intron boundaries, we searched the appropriate intron of the mouse Musk gene with each alternatively spliced exon sequence. The results of this analysis showed that the sequences for the 10, and 8 aa exons were present in the intervening sequences between their respective flanking exons (introns 5 and 10 respectively of the annotated Musk gene sequence, Ensembl Gene ID ENSMUSG00000057280). These sequences are therefore unlikely to represent cloning artifacts. In addition, the 10 aa and the 8 aa exon sequences had the appropriate AG and GT splice site signals at their 5V and 3V ends respectively (Fig. 2A). We also searched the appropriate introns in rat and human Musk genes for these sequences. The rat and human 8 aa exons were located using the nucleotide sequence from previously isolated MuSK variants (Valenzuela et al., 1995). The nucleotide sequence of the human 10 aa exon was not available in public databases; this exon was located by searching for the encoded aminoacids after translation of the appropriate intron sequence in all three reading frames. We reasoned that the short exon sequences of the remaining exons (rat 10 aa, human and rat 15 aa) may lack sufficient homology at the nucleotide level making it difficult to locate them. We therefore used a different strategy in which we first compared splice junction sequences for mouse and human 10 aa exons. As shown in Fig. 2A, the splice junction sequences flanking the 10 aa exon pairs were highly conserved at the nucleotide level; we therefore used intron –exon junctional sequences to successfully identify sequences corresponding to a putative 10 aa exon in the rat MuSK gene. Our findings together with earlier studies show that amino acid sequences encoded by the 10 and 8 aa exons are conserved among mice, rats and humans, and that each exon is flanked by conserved consensus 5V and 3V splice sites in all three species (Ganju et al., 1995; Valenzuela et al., 1995). These exons appear to be subject to evolutionarily conserved alternative splicing; alternative conserved exons have been identified in genes expressed in the brain and in genes involved in

transcriptional regulation, RNA processing, and development (Yeo et al., 2005). The 15 aa exon sequence was also found to be present in the intervening sequence between its flanking exons (in intron 7, Ensembl Gene ID ENSMUSG00000057280). However, this exon had a non-canonical 3Vsplice acceptor site (TG) at the 5Vend and a consensus 3Vsplice acceptor site (AG) 45 bp downstream. (Fig. 2B). The 15 aa exon is thus a novel exon with a non-canonical splice site at its 5V end. There is growing evidence for the use of alternatively spliced exons with non-canonical splice sites in modulating protein expression and function (Burset et al., 2000; Pollard et al., 2002). The genomic region containing sequences with homology to this exon was also identified in rat and human Musk genes using sequences at the 3Vexon– intron boundary of the 15 aa mouse exon (Fig. 2B). However the noncanonical TG splice site was not present in either the rat or human genomic region that was homologous to the 15 aa exon, and in the absence of cDNA evidence we were unable to determine the 5Vboundary of a putative 15 aa-like exon in human or rat MuSK genes. 3.3. Alternatively spliced exons are present in RNA transcripts from mouse muscle and C2 myotubes To determine whether the 15 amino acid exon is indeed present in MuSK mRNAs, we amplified MuSK transcripts from neonatal mouse muscle and from cultured C2 myotubes. RNA from these tissues was reverse transcribed and the first strand cDNA was amplified by PCR using MuSK primers. The primer pair was selected such that the expected ¨1 kb PCR product would be amplified from transcripts containing all three alternatively spliced exon sequences. An aliquot of each PCR reaction was run out on gels and analyzed by Southern blotting with alternative exon-specific probes. As shown in Fig. 3, MuSK transcripts were present in mouse muscle, cultured C2 myotubes, and at lower levels in brain, and heart. Primers specific for the 10, 15 and 8 aa exons hybridized to MuSK RT-PCR products in neonatal muscle, adult muscle and cultured C2 myotubes (Fig. 3). No amplification products were detected in samples from RT reaction mixes in which the reverse transcriptase was omitted, confirming that these products are derived from mRNAs (not shown). The results suggest that levels of transcripts with 15 aa exon sequences may be lower in P0 than in adult muscle, and appear to be selectively decreased in myotubes treated with agrin. Transcripts with the 10 aa exon were more abundant, and showed less variation between muscle samples. Transcripts with the 8 aa exon were also more abundant than those containing the 15 aa exon, and were increased in adult muscle. The 15 aa exon primer did not show detectable hybridization to amplified products from brain and heart samples; however, the amounts of amplified products from MuSK transcripts were substantially lower in these tissues. To determine whether the 15 aa exon was present in rat and human RNAs, MuSK

R. Kuehn et al. / Gene 360 (2005) 83 – 91

Fig. 3. MuSK transcripts containing alternatively spliced exons are present in cultured myotubes and muscle tissue. mRNA from tissue samples was analyzed by RT-PCR amplification with either MuSK primers or control primers. Amplified products (80% of total) from the MuSK RT-PCR reactions were separated by gel electrophoresis, stained with ethidium bromide (MuSK panel), transferred to nitrocellulose and probed with biotin-labeled, exon-specific MuSK primers (10, 15 and 8 aa respectively). Bottom panel shows ethidium bromide-stained amplification products (30% of total) obtained by RT-PCR using control primers (GAPDH). Levels of amplified MuSK products were comparable between C2 cells grown with or without agrin; and between adult and P0 muscle tissue. This panel is representative of three experiments. Sources of RNA are shown at the top of each lane. [C2 MT = C2 myotubes, Ag = agrin, B = brain, H = heart, L = liver, Ad M = adult muscle, P0M = post-natal day zero (P0) muscle, Blk = no RNA].

sequences were amplified by RT-PCR of rat and human muscle RNA obtained from commercial sources, and probed separately with labeled primers specific for the human and rat F15 aa_ sequences. We detected the 15 aa exon sequence in the PCR products from human RNA samples, indicating that 15 aa-encoding inserts are present in human MuSK transcripts (data not shown). To determine the sequence of transcripts with the 15 aa insert, we tried direct sequencing of the PCR products. However, the sequence of such fragments could not be separated from sequences lacking the 15 aa exon, which were much more abundant. We did not detect a 15 aa-encoding insert in RT-PCR products from rat RNA (data not shown).

4. Discussion Analysis of the mouse gene and cDNAs for MuSK revealed features that may be important in the regulation of MuSK gene expression. In summary, we isolated cDNAs encoding five different isoforms of MuSK from muscle cells including a novel cDNA containing a unique alternatively spliced exon. The 8 and 10 aa exons were present in MuSK transcripts from cultured myotubes and muscle tissues, had consensus splice sites at their 5Vand 3Vends, and appeared in MuSK cDNAs in the same linear order as they were present in the Musk gene. The data suggest that inclusion or exclusion of these exons in MuSK transcripts is a result of

89

alternative splicing. The degree of homology between amino acid sequences encoded by the 8 and 10 aa exons among mice, rats and humans suggests that they have a conserved function. A third exon encoding a novel, alternatively spliced sequence of 15 aa was found in the MuSK cDNAs, and was detected in MuSK transcripts from muscle cells and tissues. Inclusion of the 52 bp exon sequence by alternative splicing results in the presence of a novel sequence encoding 15 aa followed by 7 bp of sequence encoding 3 aa in the MuSK ectodomain; use of the internal 3V splice acceptor consensus results in the inclusion of only the 7 bp sequence, which is present in all MuSK cDNAs. The region corresponding to the mouse 52 bp exon sequence was located in the rat and human genes by homology searches of the appropriate introns. However, the non-canonical splice site (TG) at the 5Vend of this sequence was not conserved in rats and humans. The 45 bp sequence in frame and upstream of the conserved 7 bp was also interrupted by stop codons in both rat and human sequences. We were able to detect 15 aa exon sequences in human MuSK transcripts, but we could not isolate human and rat MuSK cDNA fragments with this exon, possibly due to its small size and low abundance, or due to the variability in origin and type of muscle constituting muscle RNA from commercial sources. We therefore cannot rule out the possibility that the 15 aa exon is a species-specific, alternative exon in mice. However, in both rat and human sequences, there was high conservation at the 3Vend of the 15 aa sequence, including the internal 3Vsplice acceptor site, the 7 bp constitutively expressed sequence, and a 5Vsplice donor sequence in the adjacent flanking intron. Splicing of exons as currently delineated in the annotated genome sequence for this region results in transcripts that show sequence incompatibilities with the corresponding position in MuSK cDNA isolates. Our findings indicate that the 7 bp sequence most likely represents a constitutively expressed exon of MuSK in mice, rats and humans, and are also consistent with the presence of this sequence in MuSK cDNAs from all three species. All three exons identified in this study encode sequences located in the MuSK ectodomain. To determine whether the inclusion of these exons introduced additional protein modification/binding sites within the ectodomain we searched these sequences for the presence of known protein modification/binding motifs. The presence of the 8 aa exon introduces a serine threonine kinase active site motif (ProSite ID PS00108) in the ectodomain of MuSK. The significance of its presence in the MuSK ectodomain is unknown. No other motifs were detected in any of the alternatively spliced exons. We cannot rule out the possibility that the additional amino acids alter distance between other domains in MuSK thereby regulating their function; alternatively, these sequences could affect processing and/or stability of MuSK RNA or protein.

90

R. Kuehn et al. / Gene 360 (2005) 83 – 91

The presence or absence of small exons encoding only a few amino acids can significantly change the biological properties of a protein (Burset et al., 2000; Pollard et al., 2002). The induction of AChR clustering by recombinant agrin increases dramatically in the presence of agrin isoforms containing alternatively spliced sequences encoding 8 and 11 aa compared with isoforms lacking these sequences (Ruegg et al., 1992; Tseng et al., 2003; Stetefeld et al., 2004). Mice in which these exons are selectively deleted suffer from severe neuromuscular defects (Gautam et al., 1996). Similarly, MuSK isoforms generated by alternative splicing may have differences in their ability to be activated by agrin and thereby add complexity to the induction of postsynaptic differentiation. However, recombinant MuSK isoforms with different insert combinations were phosphorylated, and colocalized with rapsyn aggregates when expressed with rapsyn in fibroblast cells, as described previously (Gillespie et al. (1996); SA Eckler, R Kuehn, and M Gautam, unpublished data). Thus the presence or absence of individual inserts did not alter the kinase activity of recombinant MuSK. Alternatively, MuSK isoforms may have differences in binding with other proteins and may be important for regulating pathways that are independent of the kinase and rapsyn dependent properties of MuSK (Moore et al., 2001; Yang et al., 2001; Cartaud et al., 2004; Zhang et al., 2004; Dimitropoulou and Bixby, 2005). Finally, regulation of alternative splicing of MuSK transcripts could potentially add complexity to the activities of MuSK during development. Neonatal lethality in MuSK knockout mice can be rescued by transgenic expression of full-length MuSK or a MuSKTrkA chimera composed of sequences from the MuSK ectodomain and juxtamembrane region, and the kinase and transmembrane domains of the neurotrophin receptor TrkA (Herbst et al., 2002). In the transgene positive MuSK mutants, many aspects of synaptic differentiation were restored sufficiently to rescue them from lethality, but rescued animals continue to display differences in synaptic zone width, AChR cluster density, and complexity of nerve terminal arbors. The authors contribute some of these defects to the delayed expression of MuSK from the MCK promoter, but it is possible that the particular isoform of MuSK expressed by the transgenes lacks sequences required for complete elaboration of wildtype MuSK activity. MuSK transcripts containing the 15 aa exon were present at higher levels in muscle from P0 animals compared to adult muscle, and decreased in cultured myotubes after treatment with agrin (Fig. 3), consistent with the idea that the presence of the 15 aa may be important for early functions of MuSK and/or restricted in later developmental stages. Expression levels of the 10 and 8 aa exons were higher and did not show as much variation under these conditions. These results will have to be substantiated in future studies by analyzing the levels of each of the alternatively spliced exons in cultured myotubes and in muscle tissue of different origins, at multiple

developmental stages and under different physiological conditions.

Acknowledgements We thank Kirsten Block, Rachel DeBold, and Tina Rose for technical assistance. This work was supported by a Grant-in-Aid from the Heartland Affiliate of the American Heart Association.

References Bowen, D.C., et al., 1998. Localization and regulation of MuSK at the neuromuscular junction. Dev. Biol. 199, 309 – 319. Burset, M., Seledtsov, I.A., Solovyev, V.V., 2000. Analysis of canonical and non-canonical splice sites in mammalian genomes. Nucleic Acids Res. 28, 4364 – 4375. Cartaud, A., et al., 2004. MuSK is required for anchoring acetylcholinesterase at the neuromuscular junction. J. Cell Biol. 165, 505 – 515. DeChiara, T.M., et al., 1996. The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo. Cell 85, 501 – 512. Dimitropoulou, A., Bixby, J.L., 2005. Neurite outgrowth is selectively inhibited by cell surface MuSK and agrin. Mol. Cell. Neurosci. 28, 292 – 302. Ferns, M.J., Campanelli, J.T., Hoch, W., Scheller, R.H., Hall, Z., 1993. The ability of agrin to cluster AChRs depends on alternative splicing and on cell surface proteoglycans. Neuron 11, 491 – 502. Ganju, P., Walls, E., Brennan, J., Reith, A.D., 1995. Cloning and developmental expression of Nsk2, a novel receptor tyrosine kinase implicated in skeletal myogenesis. Oncogene 11, 281 – 290. Gautam, M., et al., 1996. Defective neuromuscular synaptogenesis in agrindeficient mutant mice. Cell 85, 525 – 535. Gautam, M., DeChiara, T.M., Glass, D.J., Yancopoulos, G.D., Sanes, J.R., 1999. Distinct phenotypes of mutant mice lacking agrin, MuSK, or rapsyn. Dev. Brain Res. 114, 171 – 178. Gillespie, S.K., Balasubramanian, S., Fung, E.T., Huganir, R.L., 1996. Rapsyn clusters and activates the synapse-specific receptor tyrosine kinase MuSK. Neuron 16, 953 – 962. Glass, D.J., et al., 1996. Agrin acts via a MuSK receptor complex. Cell 85, 513 – 523. Herbst, R., Avetisova, E., Burden, S.J., 2002. Restoration of synapse formation in Musk mutant mice expressing a Musk/Trk chimeric receptor. Development 129, 5449 – 5460. Hesser, B.A., Sander, A., Witzemann, V., 1999. Identification and characterization of a novel splice variant of MuSK. FEBS Lett. 442, 133 – 137. Jennings, C.G., Dyer, S.M., Burden, S.J., 1993. Muscle-specific trk-related receptor with a kringle domain defines a distinct class of receptor tyrosine kinases. Proc. Natl. Acad. Sci. U. S. A. 90, 2895 – 2899. Kim, C.H., Xiong, W.C., Mei, L., 2003. Regulation of MuSK expression by a novel signaling pathway. J. Biol. Chem. 278, 38522 – 38527 (Electronic publication Jul 28). Lacazette, E., Le Calvez, S., Gajendran, N., Brenner, H.R., 2003. A novel pathway for MuSK to induce key genes in neuromuscular synapse formation. J. Cell Biol. 161, 727 – 736 (Electronic publication 2003 May 19). Moore, C., Leu, M., Muller, U., Brenner, H.R., 2001. Induction of multiple signaling loops by MuSK during neuromuscular synapse formation. Proc. Natl. Acad. Sci. U. S. A. 98, 14655 – 14660. Pollard, A.J., Krainer, A.R., Robson, S.C., Europe-Finner, G.N., 2002. Alternative splicing of the adenylyl cyclase stimulatory G-protein G alpha(s) is regulated by SF2/ASF and heterogeneous nuclear ribonu-

R. Kuehn et al. / Gene 360 (2005) 83 – 91 cleoprotein A1 (hnRNPA1) and involves the use of an unusual TG 3Vsplice site. J. Biol. Chem. 277, 15241 – 15251. Reist, N.E., Werle, M.J., McMahan, U.J., 1992. Agrin released by motor neurons induces the aggregation of acetylcholine receptors at neuromuscular junctions. Neuron 8, 865 – 868. Ruegg, M.A., et al., 1992. The agrin gene codes for a family of basal lamina proteins that differ in function and distribution. Neuron 8, 691 – 699. Sanes, J.R., Lichtman, J.W., 2001. Induction, assembly, maturation and maintenance of a postsynaptic apparatus. Nat. Rev., Neurosci. 2, 791 – 805. Stetefeld, J., et al., 2004. Modulation of agrin function by alternative splicing and Ca2+ binding. Structure 12, 503 – 515. Tseng, C.N., Zhang, L., Cascio, M., Wang, Z.Z., 2003. Calcium plays a critical role in determining the acetylcholine receptor-clustering activities of alternatively spliced isoforms of agrin. J. Biol. Chem. 278, 17236 – 17245 (Electronic publication 2003 Mar 05).

91

Valenzuela, D.M., et al., 1995. Receptor tyrosine kinase specific for the skeletal muscle lineage: expression in embryonic muscle, at the neuromuscular junction, and after injury. Neuron 15, 573 – 584. Yang, X., et al., 2001. Patterning of muscle acetylcholine receptor gene expression in the absence of motor innervation. Neuron 30, 399 – 410. Yeo, G.W., Van Nostrand, E., Holste, D., Poggio, T., Burge, C.B., 2005. Identification and analysis of alternative splicing events conserved in human and mouse. Proc. Natl. Acad. Sci. U. S. A. 102, 2850 – 2855 (Electronic publication 2005 Feb 11). Zhang, J., Lefebvre, J.L., Zhao, S., Granato, M., 2004. Zebrafish unplugged reveals a role for muscle-specific kinase homologs in axonal pathway choice. Nat. Neurosci. 7, 1303 – 1309 (Electronic publication 2004 Nov 14).