Multiple Functions of an Evolutionarily Conserved RNA Binding Domain

Molecular Cell, Vol. 5, 761–766, April, 2000, Copyright 2000 by Cell Press

Multiple Functions of an Evolutionarily Conserved RNA Binding Domain Josep Vilardell, Shaoqing J. Yu, and Jonathan R. Warner* Department of Cell Biology Albert Einstein College of Medicine Bronx, New York 10461

Ribosomal protein L30 of Saccharomyces cerevisiae binds to a distinct RNA structure to inhibit the splicing and the translation of its own transcript. Remarkably, the ortholog of L30 from the archaeon Sulfolobus acidocaldarius binds specifically to the same RNA fragment and inhibits splicing both in vitro and in vivo. Indeed, expression of Sulfolobus L30 in yeast severely reduces growth by limiting production of the endogenous L30. This conservation of binding specificity implies that the target of regulation in the RPL30 transcript mimics a site in the rRNA that has been conserved for more than a billion years. We identify this site, whose location suggests that L30, which has no apparent eubacterial ortholog, is responsible for establishing the orientation of a key bridge between the large and small ribosomal subunits.

the mammalian L30 is 63% identical; the archaeal L30 of Sulfolobus acidocaldarius is 33% identical. Perhaps more important, these L30 proteins have highly conserved structural elements with no insertions or deletions in the body of the molecule (Figure 1A). No apparent L30 is encoded in the E. coli genome. The paradigm of the regulation of ribosomal protein synthesis in eubacteria is the binding of a ribosomal protein to a structure in the mRNA, thereby blocking translation (Nomura et al., 1984). The interactions of individual ribosomal proteins with specific operons has been widely, but not universally, conserved among related eubacteria (Allen et al., 1999). In some cases, the mRNA structure resembles that of the site in rRNA to which the protein binds; in some cases, it does not (reviewed in Zengel and Lindahl, 1994). Nothing is known about such interactions in eukaryotes. The evolutionary conservation of L30 over more than a billion years is undoubtedly due to its interaction with rRNA, and perhaps with other proteins, within the ribosome, but those interactions remain unknown. We predicted that if the interaction of L30 with its pre-mRNA mimics its interaction with rRNA within the ribosome, then the archaeal ortholog of L30 would bind to the yeast RPL30 transcript and would inhibit splicing.

Introduction

Results

Ribosomal protein L30 of S. cerevisiae (formerly L32 [Mager et al., 1997]) plays a dual role in the cell. Not only is it an indispensable component of the ribosome (Dabeva and Warner, 1987), but also it binds to the transcript of its own gene both to inhibit splicing to mature mRNA (Eng and Warner, 1991; Vilardell and Warner, 1994) and to reduce translation (Dabeva and Warner, 1993). This provides a sensitive, biologically important feedback loop to prevent the accumulation of L30 in excess of that needed to assemble ribosomes (Li et al., 1996). The primary and secondary structural elements of the pre-mRNA to which L30 binds were identified both genetically and biochemically (Figure 1B) (Eng and Warner, 1991; Vilardell and Warner, 1994; Li et al., 1995). Very recently, these elements have been confirmed in an atomic resolution structure of the L30–RNA complex solved by NMR methods (Mao et al., 1999). A novel RNAbinding motif used by the protein induces a sharp bend in the bound RNA. The ribosomal proteins have been highly conserved through evolution. The ribosome of S. cerevisiae has 78 different proteins, each of which has an identifiable ortholog in the mammalian ribosome (Wool et al., 1995; Mager et al., 1997). Furthermore, most of the yeast ribosomal proteins have orthologs in the archaea, although only approximately 25% have identifiable orthologs in the eubacteria (Mager et al., 1997). In the case of L30,

Activity of Sulfolobus L30 In Vitro We first asked if the L30 ortholog from Sulfolobus would bind to the Saccharomyces RPL30 transcript. Biochemical analyses were performed using an MBP–L30 fusion protein, as described previously (Vilardell and Warner, 1994). An MBP–L30 fusion gene was prepared from the Sulfolobus sequence, and the protein was expressed in E. coli. As shown in Figure 1C (lane 3), the Sulfolobus protein binds to the pre-mRNA. Indeed, the Sulfolobus protein appears to bind even more avidly than the Saccharomyces protein, although that may be due to the increased stability of the protein derived from a thermophilic organism that thrives at 80⬚C (Schmidt et al., 1999). A single nucleotide change in the RNA, C9→U, that prevents binding by the Saccharomyces L30, also prevents binding by the Sulfolobus ortholog (Figure 1C, lanes 4–6). Since the Sulfolobus L30 binds to the RPL30 transcript, can it inhibit splicing? Substrates derived from ACT1 and from RPL30 were subjected to in vitro splicing (Figure 1D). It is apparent that, like the Saccharomyces L30 (lanes 7 and 8) (Vilardell and Warner, 1994), the Sulfolobus L30 inhibits splicing of the RPL30 transcript (lanes 9 and 10) but has no effect on splicing of the ACT1 transcript (lane 4) or of the RPL30U9 transcript (data not shown). Thus, the archaeal L30 binds to RPL30 mRNA in a way that is indistinguishable from that of the S. cerevisiae L30.

Summary

* To whom correspondence should be addressed (e-mail: warner@ aecom.yu.edu).

Activity of Sulfolobus L30 In Vivo If Sulfolobus L30 can replace yeast L30 in regulating splicing, can it do so in the formation of ribosomes? In

Molecular Cell 762

Figure 2. Homo, but Not Sulfolobus, L30 Will Support Growth of S. cerevisiae In strain JV7-2a of S. cerevisiae, the RPL30 gene has been disrupted by HIS3. The necessary L30 is supplied from a L30 transcript under control of the GAL1 promoter in the CEN vector pYEUra3. Note that the transcript of this fusion includes extra nucleotides upstream of the usual L30 start site that interfere with folding shown in Figure 1B and render the transcript largely immune from binding L30. JV72a was transformed with a vector, pRS314 (CEN, TRP1) (Sikorski and Hieter, 1989), and three derivatives, carrying the L30 ORF of Saccharomyces, of Sulfolobus, or of Homo in the context of the RPL30 gene (see Experimental Procedures). Growth was assayed on ⫺Ura dropout plates containing 2% galactose (A) or 2% glucose (B).

Figure 1. The Sulfolobus L30 Binds to and Inhibits the Splicing of the Saccharomyces RPL30 Transcript (A) Sequence alignment of ribosomal protein L30 from S. cerevisiae, H. sapiens, and S. acidocaldarius. The numbers at the top refer to the S. cerevisiae sequence. Residues highly conserved among all proteins are in black boxes, and those conserved between two sequences are in gray. The alignment was performed with Clustal:X (Thompson et al., 1997). (B) The RNA motif bound by L30 in the transcript of its own gene (Vilardell and Warner, 1994). The position of the C9→U mutation is indicated. (C) In vitro binding activity of S. acidocaldarius L30. 32P RNA molecules representing the first 75 nt of the wild-type (wt) RPL30 transcript and of the C9→U mutant were prepared by T7 RNA polymerase transcription of a truncated template. These were mixed with 10 ng of MBP–L30 of Saccharomyces (Sc, lanes 2 and 5), with 10 ng of MBP–L30 of Sulfolobus (Sa, lanes 3 and 6), or with no protein (lanes

the yeast strain JV7-2a, the essential RPL30 gene has been replaced by HIS3; the necessary L30 is supplied by a gene under the control of the GAL1 promoter. Such cells grow on galactose but not on glucose (Figures 2A and 2B). An RPL30 gene whose coding sequences were replaced by Sulfolobus sequences, or, as a control, by Homo sequences, was introduced on a CEN plasmid. The Homo sequence supports growth on glucose; the Sulfolobus sequence does not (Figure 2B). Both chimeric genes produced mRNA as detected on a Northern blot (data not shown). We conclude that the human L30 will substitute for the Saccharomyces L30 in ribosome formation and function but that the Sulfolobus L30 will not. Why does the Sulfolobus L30 not support growth of S. cerevisiae? The ribosome is a complex assemblage; evolutionary change is very slow, presumably because it requires covariation, as in the replacement of one base pair with another in helical regions of the rRNA (Gutell et al., 1985). Although the rRNA-binding site of L30 may have changed little between the Archaea and the Eukarya, it is likely that during such a long period differences

1 and 4) and assayed by gel shift (Vilardell and Warner, 1994). (D) Sulfolobus L30 inhibits specifically RPL30 splicing in vitro. Substrate RNAs derived from ACT1 (lanes 1–4) and RPL30 (lanes 5–10) were incubated with yeast splicing extracts (Vilardell and Warner, 1994). MBP–L30 of Saccharomyces (Sc) was added to the samples in lanes 3, 7, and 8 (1.0, 0.5, and 1.0 ␮g, respectively). MBP–L30 of Sulfolobus (Sa) was added to samples in lanes 4, 9, and 10 (0.5, 0.25, and 0.5 ␮g, respectively). At the completion of the splicing reaction, the samples were analyzed by polyacrylamide gel. The migration of the splicing intermediates and products are indicated.

Evolutionary Conservation of an RNA Binding Domain 763

Figure 3. Expression of Sulfolobus L30 Inhibits Yeast Growth by Limiting Production of the Endogenous L30 (A) Strains W303a and BL1 differ in a single nucleotide; BL1 carries a C9→T mutation of the RPL30 transcription unit (Figure 1B) (Li et al., 1996). Each strain was transformed with a CEN URA3 vector, or with the vector carrying the Sulfolobus L30 ORF under the control of the GAL1 promoter, and assayed on ⫺Ura dropout plates containing 2% galactose. All four strains grow normally in glucose. (B) The strains described in (A) were grown in ⫺Ura dropout medium containing raffinose as a carbon source. A sample was taken, and galactose was added to the remaining culture to a final concentration of 2%. At intervals, samples were taken, RNA prepared, subjected to Northern analysis, and probed with an oligonucleotide JW61L specific for Saccharomyces RPL30 (upper panel), and, after stripping, with a riboprobe for the Sulfolobus L30 sequence (lower panel). M and P indicate, respectively, the mature and the unspliced precursor mRNA encoding the Saccharomyces L30.

have evolved in the “fit” of L30 with other parts of the rRNA and/or with other ribosomal proteins. Difficulty in developing an expression system for the Sulfolobus L30 in yeast, with many spontaneous rearrangements and deletions, suggested that the expression of Sulfolobus L30 might be deleterious for the growth of S. cerevisiae. As a test of this hypothesis, a plasmid expressing Sulfolobus L30 from the GAL1 promoter was introduced into wild-type S. cerevisiae. On plates containing glucose, the transformant grows well, using L30 derived from the genomic RPL30 (data not shown). On plates containing galactose, the Sulfolobus L30 is expressed and growth almost ceases (Figure 3A). With extended incubation, microcolonies become visible, suggesting that the Sulfolobus protein inhibits growth but does not kill the cells. The Sulfolobus protein could be toxic for the yeast cell either because it prevents the splicing of the yeast RPL30 transcript, thereby limiting the cell for L30, or because it interferes with proper ribosome assembly. To distinguish between these alternatives, we introduced the GAL1-driven Sulfolobus sequence into strain BL1, whose genomic RPL30 carries the mutation of C9→T (Li et al., 1996), which greatly reduces binding of L30 (Figure 1C) and, thus, its ability to inhibit splicing. The transformed cells grow in galactose at a nearly normal rate (Figure 3A). Thus, the Sulfolobus protein is toxic because it causes the cells to be starved for L30, with apparently little direct affect on ribosome assembly. It is remarkable that the alteration of a single noncoding nucleotide in the RPL30 gene renders yeast resistant to the specific binding of a protein it has not seen for more than a billion years! Figure 3B demonstrates that the expression of Sulfolobus L30 in vivo inhibits splicing of the genomic RPL30 transcript. Within 1 hr after transcription of the Sulfolobus gene has been activated by galactose (lower panel), the unspliced mRNA from the genomic RPL30 begins to accumulate, while the spliced mRNA is diminished

(Figure 3B, lanes 7–10). By 6 hr, the ratio of spliced to unspliced mRNA has been reduced from nearly 50:1 to 0.6:1. By contrast, in cells whose genome carries the C9→T mutation, the expression of Sulfolobus L30 leads to no accumulation of unspliced transcript (Figure 3B, lanes 17–20). Furthermore, sucrose gradient analysis shows (1) that the translation of what little Saccharomyces RPL30 transcript that remains is inhibited by the Sulfolobus protein, leading to severe deprivation of L30, and (2) that there is no accumulation of 60S ribosomal subunits, as might be expected if the Sulfolobus L30 were incorporated into nonfunctional particles (S. J. Y. and J. R. W., upublished data). Identification of the Site of L30 Binding to rRNA As pointed out above, the mRNA regulatory sequences bound by a ribosomal protein in eubacteria sometimes resemble the corresponding binding sites on rRNA and sometimes do not. In this case, Sulfolobus L30 and Saccharomyces L30 bind the yeast RPL30 transcript with the same specificity. Since no similar site was found in a search of the Sulfolobus transcript, a rational explanation for the conservation of specificity through more than 109 years of evolution is that this site resembles the site within the large rRNA to which L30 binds. Careful inspection of the predicted 25S rRNA secondary structure led to the identification of four potential stem–bulge–stem–loop candidates that resemble the L30-binding site on the RPL30 transcript (Figure 4A). RNA oligonucleotides corresponding to each of these were tested for binding with L30. It is clear from the band shift experiment in Figure 4B that L30 binds avidly to fragment 4 but barely, if at all, to the others. The specificity of this interaction is apparent from Figure 4D, which shows that stem–loop 4 can be cross-linked to the L30 of Saccharomyces, Sulfolobus, and Homo. These data clearly point to stem–loop 4 as the site in the ribosome at which L30 binds. That the same site on L30 binds both to the rRNA and the mRNA is apparent

Molecular Cell 764

Figure 5. The Putative Secondary Structures of Site 4 of Several Organisms Note the conservation not only of the secondary structure, but especially of the primary structure within the internal bulges. Compare with the L30-binding site in Figure 1B. This small sequence is one of the most conserved in the whole rRNA.

from a mutual competition experiment (Figure 4C). Each competes with the other for limiting L30. As would be predicted from the compact folding and complex binding site of L30 (Mao and Williamson, 1999), we observed no band that might represent the two RNAs binding to a single protein molecule. Both the competitive binding experiment of Figure 4C and quantitative binding analyses (data not shown) suggest that the in vitro affinity of the rRNA fragment is less than that of the mRNA fragment. However, this may not be an accurate reflection of the effective affinities in vivo because the assembly of the ribosome is a multistep, cooperative phenomenon

Figure 4. Identification of the rRNA Site to which L30 Binds (A) The secondary structure map of the 25S rRNA of S. cerevisiae (Gutell et al., 1993) was examined for elements that resemble the binding site for L30 in its mRNA. Four potential sites were identified, all in the “left half” of the 25S rRNA as shown: site 1, positions 752–778; site 2, positions 1706–1731; site 3, positions 720–749; site

4, positions 830–862. (B) Site 4 binds L30. RNA oligonucleotides representing the four sites in (A) were synthesized and 5⬘ labeled with 32P. Each (0.25 pmol) was incubated with MBP–L30 (10 ng) and subjected to band shift analysis (see Figure 1C). (C) rRNA and pre-mRNA compete for binding. Kinased 32P probe (1.6 fmol), representing either the first 75 nt of the wild-type RPL30 transcript or the rRNA site 4, was incubated with 10 and 35 ng of MBP–L30, respectively, in the presence of the indicated amounts of cold competitor and analyzed as in Figure 5B. The results were analyzed using a PhosphorImager (Molecular Dynamics). With no competitor, approximately 30% of the mRNA fragment and 15% of the rRNA fragment were bound. The dashed line (circles) indicates binding of the rRNA probe when competed with the cold pre-mRNAbinding site. The continuous line (triangles) shows the binding of the pre-mRNA probe when competed with cold rRNA-binding site. (D) Site 4 cross-links to Saccharomyces, Sulfolobus, and Homo L30. RNA oligonucleotides representing the four sites (50 fmol) were incubated with no protein (lanes 1–4) or with 1 ng of MBP–L30 of Saccharomyces (lanes 5–8), of Sulfolobus (lanes 9–12), or of Homo (lanes 13–16), as in Figure 3B, for 15 min. The samples were then placed on ice, irradiated at 254 nm for 15 min, and then analyzed by SDS PAGE (12%) (Moore and Query, 1998). By Phosphorimager quantitation, the binding to stem–loop 4 in both assays was about 10-fold greater than to stem–loop 2.

Evolutionary Conservation of an RNA Binding Domain 765

(Held et al., 1973), where the binding of a protein depends substantially on its neighbors. Discussion We have shown that the RNA binding specificity of the ribosomal protein L30 has been preserved through the evolutionary divergence of the Archaea and the Eukarya, and we have used this observation to identify the site on the ribosome to which L30 appears to bind. This example of molecular mimicry between two eukaryotic RNA molecules has both biological and structural implications. The autoregulation of synthesis of L30 is essential for optimal growth (Li et al., 1996). The simple interaction between L30 and stem–loop 4 seems ideally suited as a model for the selection of sequences within the 5⬘ leader of RPL30 that mimic the rRNA structure. Nevertheless, it is extraordinary that the specificity of this RNA–protein interaction has been so well conserved that the expression of an archaeal protein can block the growth of a yeast cell, a blockage that can be eliminated by the mutation of a single noncoding nucleotide (Figure 3A). The eubacterial ribosome has been the subject of intensive study over the past 40 years, culminating in recent crystal structures (Ban et al., 1999; Cate et al., 1999; Clemons et al., 1999; Tocilj et al., 1999), that will undoubtedly soon improve to reveal each protein and its interaction with rRNA and with each other. Yet, in spite of their common function, eukaryotic ribosomes differ substantially from eubacterial ones. Indeed, the mammalian ribosome is nearly 50% larger in mass and has 50% more proteins. We are almost entirely ignorant of the structure of eukaryotic ribosomes beyond that which can be inferred from the structure of eubacterial ones. While in the case of yeast L25 (L23 of E. coli) the orthologous proteins will bind to the relevant regions of each others’ rRNA (El-Baradi et al., 1986), such demonstrations are rare. The data of Figure 4 represent the localization of a eukaryotic ribosomal protein that has no ortholog in the eubacterial ribosome. The primary sequence of stem– loop 4 is unusually highly conserved (Figure 5). Recently, this stem–loop has been identified as part of an RNA– protein bridge that participates in joining the large and small subunits of eubacterial ribosomes (Culver et al., 1999). The eubacterial stem–loop is kinked so that the terminal loop is available to penetrate the 30S subunit, where it interacts with ribosomal protein S15. This kink resembles strongly that induced in the RPL30 transcript by the binding of L30 (Mao et al., 1999). Therefore, we suggest that L30 contributes to ribosome structure by ensuring that this helix extends from the 60S subunit to stabilize its interface with the 40S subunit. The identification of L30 binding to a site on the 25S rRNA that appears to have a specific function provides an opportunity to explore the structural and functional basis of those differences in this specific region of the ribosome. The differences are substantial. Eubacterial ribosomes are missing L30. Conversely, eukaryotic ribosomes are missing S15, the small subunit protein that interacts with stem–loop 4 in eubacterial ribosomes

(Culver et al., 1999). We presume that some element of the eukaryotic small subunit fulfills the function of the eubacterial S15. Has the somewhat tighter configuration of the loop (i.e., a tetraloop with one additional base pair in the stem) (Figure 5) coevolved with the difference in small subunit proteins of this region? What, in the eubacterial ribosome, plays the role of L30 in effecting the kink necessary for the proper projection of the stem– loop? Identifying the structural changes that have developed during evolution may lead to insight into the critical aspects necessary for ribosome function. An intriguing protein of Bacillus subtilis, encoded by the ORF YBXF found in an apparent operon with several ribosomal proteins, is very similar to L30 (Boor et al., 1995), although with substitutions for a few of the key amino acids involved in RNA binding (Mao et al., 1999). It binds neither to the RPL30 structure nor to stem–loop 4 (data not shown). While YBXF has never been identified as a ribosomal protein, it is perhaps the fossil of a eubacterial L30.

Experimental Procedures Strains W303a (MATa leu2-3,112 his3-11 trp1-1 ura3-1 ade2-1 can1-100 ssd1-1) (Vilardell and Warner, 1994) is the wild-type strain. Strain BL1 differs from W303 in a single nucleotide, a C9→T mutation of the RPL30 transcription unit (Li et al., 1996). In strain JV7-2a, the RPL30 gene has been disrupted by HIS3. The necessary L30 is supplied from a L30 transcript under control of the GAL1 promoter. JV7-2a was transformed with a vector, pRS314 (CEN, TRP1) (Sikorski and Hieter, 1989), and three derivatives, carrying the L30 ORF of Saccharomyces, of Sulfolobus, or of Homo in the context of the RPL30 gene. Growth was assayed on ⫺Ura dropout plates containing 2% galactose or 2% glucose.

Plasmid Constructs and Fusion Proteins Preparation of MBP–L30 of Saccharomyces is described in Vilardell and Warner (1994) under the name of MBP–L32. MBP–L30 of Sulfolobus was constructed as follows. The L30 ORF was obtained by PCR from Sulfolobus acidocaldarius DNA with the oligonucleotides JW1208 GGTAGGCCTTCTCAAAGTTTTGAGG and JW1209 CTGGTC GACACTCATTGCTTCACCT, digested with StuI and SalI and cloned into pMALc (Biolabs). The plasmid expressing the Sulfolobus L30 sequences under the GAL1 promoter was made as follows. A PCR product containing the transcribed region of S. cerevisiae RPL30 was cloned downstream of the GAL1 promoter in pYEUra3 (Clontech, CEN, URA3) opened by BamHI and XhoI. A PCR product of the Sulfolobus acidocaldarius L30 ORF with BamHI and XhoI linkers was cloned into pYEUra3 as above. This construct, which contains no intron, was sequenced to verify accurate PCR. Constructs in which the L30 ORF of Sulfolobus or Homo could be expressed entirely in the context of the RPL30 gene were made as follows. Starting with the complete RPL30, including upstream promoter and downstream terminator sequences, exon 2 was modified to include an in-frame KpnI site at its 5⬘ end and a BamHI site just downstream of the termination codon. (Note that the initiator AUG is the only codon in exon 1.) This gene was cloned into pRS314 (CEN, TRP1) (Sikorski and Hieter, 1989). To introduce the human and Sulfolobus sequences, the Saccharomyces KpnI-BamHI fragment was replaced with a PCR product generated from the human clone Image:1412266 (Research Genetics, Inc.) using primers JW1028 (AGT GGTACCGTGGCTGCAAAGAAG, KpnI) and JW1025 (CTGAGATCT TGTTTACTTCTCAC, Bgl2) or from the pMBP–L30Sulfolobus construct using primers JW1206 (GTCGGATCCCTATCATTGCTTCACCTCT TTA, BamHI) and JW1207 (GCAGGTACCTCTCAAAGTTTTGAGGG, KpnI). All three constructs were sequenced.

Molecular Cell 766

In Vitro Analysis Techniques were as described in Vilardell and Warner (1994), except as indicated. Gel Mobility Assays 32 P RNA molecules representing the first 75 nt of the wild-type RPL30 transcript and of the C9→U mutant were prepared by T7 RNA polymerase transcription of a truncated template. These were mixed with 10 ng of MBP–L30 of Saccharomyces or with 10 ng of MBP–L30 of Sulfolobus, as indicated. In Figure 4, RNA oligoribonucleotides representing the four sites in the 25S rRNA were synthesized on a Perseptive synthesizer and 5⬘ labeled with 32P. Each (0.25 pmol) was incubated with 10 ng of MBP–L30 and subjected to band shift analysis. In Vitro Splicing Substrate RNAs derived from ACT1 and RPL30 were incubated with yeast splicing extracts. MBP–L30 of Saccharomyces or MBP–L30 of Sulfolobus were added as indicated. At the completion of the splicing reaction, the samples were analyzed as described. Cross-Link RNA oligoribonucleotides (50 fmol) representing each of the four sites were incubated with 1 ng of MBP–L30 of Saccharomyces, Sulfolobus or of Homo, as indicated, as for the gel mobility assays. The samples were then placed on ice, irradiated at 254 nm for 15 min, and then analyzed by SDS-PAGE (12%) (Moore and Query, 1998). Northern Analysis Oligodeoxynucleotide JW61-L (CATCTCTGCGTATATTGATTAA) hybridizes to RPL30 exon 1. An antisense riboprobe for Sulfolobus L30 was made by T7 RNA polymerase transcription of a PCR product made using pMALc–L30Sulfolobus as template. Quantification was carried out with a PhosphorImager. Acknowledgments We are grateful to Pat Dennis for the Sulfolobus acidocaldarius DNA, to Elizabeth Glatz for Bacillus subtilis DNA, to Charles Query for help with synthesis of oligoribonucleotides, and to Regina Raz, Charles Query, Uma Maitra, and Pat Dennis for comments on the manuscript. This research was supported in part by NIH grants GM25532 to J. R. W. and CA13330 to the Albert Einstein Cancer Center. Received November 8, 1999; revised February 29, 2000.

is controlled principally by rapid degradation of excess protein. Curr. Genet. 10, 733. Eng, F.J., and Warner, J.R. (1991). Structural basis for the regulation of splicing of a yeast messenger RNA. Cell 65, 797–804. Gutell, R.R., Weiser, B., Woese, C.R., and Noller, H.F. (1985). Comparative anatomy of 16S-like ribosomal RNA. Prog. Nucl. Acid Res. Mol. Biol. 32, 156–216. Gutell, R.R., Gray, M.W., and Schnare, M.N. (1993). A compilation of large subunit (23S and 23S-like) ribosomal RNA structures: 1993. Nucleic Acids Res. 21, 3055–3074. Held, W.A., Mizushima, S., and Nomura, M. (1973). Reconstitution of Escherichia coli 30S subunits from purified molecular components. J. Biol. Chem. 248, 5720–5730. Li, H., Dalal, S., Kohler, J., Vilardell, J., and White, S.A. (1995). Characterization of the pre-mRNA binding site for yeast ribosomal protein L32: the importance of a purine-rich internal loop. J. Mol. Biol. 250, 447–459. Li, B., Vilardell, J., and Warner, J.R. (1996). An RNA structure involved in feedback regulation of splicing and of translation is critical for biological fitness. Proc. Natl. Acad. Sci. USA 93, 1596–1600. Mager, W.H., Planta, R.J., Ballesta, J.P., Lee, J.C., Mizuta, K., Suzuki, K., Warner, J.R., and Woolford, J.L., Jr. (1997). A new nomenclature for the cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Nucleic Acids Res. 25, 4872–4875. Mao, H., and Williamson, J.R. (1999). Local folding coupled to RNA binding in the yeast ribosomal protein L30. J. Mol. Biol. 292, 345–359. Mao, H., White, S.A., and Williamson, J.R. (1999). Structure of the yeast RPL30-autoregulatory RNA complex revealing a novel loop– loop recognition motif. Nat. Struct. Biol. 6, 1139–1147. Moore, M.J., and Query, C.C. (1998). Use of site-specific modified RNAs constructed by ligation. In RNA-Protein Interactions: A Practical Approach, C. Smith, ed. (Oxford: Oxford Universiy Press), pp. 75–108. Nomura, M., Gourse, R., and Baughman, G. (1984). Regulation of the synthesis of ribosomes and ribosomal components. Annu. Rev. Biochem. 53, 75–117. Schmidt, K.J., Beck, K.E., and Grogan, D.W. (1999). UV stimulation of chromosomal marker exchange in Sulfolobus acidocaldarius: implications for DNA repair, conjugation and homologous recombination at extremely high temperatures. Genetics 152, 1407–1415.

References

Sikorski, R.S., and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19–27.

Allen, T., Shen, P., Samsel, L., Liu, R., Lindahl, L., and Zengel, J.M. (1999). Phylogenetic analysis of L4-mediated autogenous control of the S10 ribosomal protein operon. J. Bacteriol. 181, 6124–6132.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997). The CLUSTAL:X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Ban, N., Nissen, P., Hansen, J., Capel, M., Moore, P.B., and Steitz, T.A. (1999). Placement of protein and RNA structures into a 5 A˚-resolution map of the 50S ribosomal subunit. Nature 400, 841–847. Boor, K.J., Duncan, M.L., and Price, C.W. (1995). Genetic and transcriptional organization of the region encoding the beta subunit of Bacillus subtilis RNA polymerase. J. Biol. Chem. 270, 20329–20336. Cate, J.H., Yusupov, M.M., Yusupova, G.Z., Earnest, T.N., and Noller, H.F. (1999). X-ray crystal structures of 70S ribosome functional complexes. Science 285, 2095–2104. Clemons, W.M.J., May, J.L., Wimberly, B.T., McCutcheon, J.P., Capel, M.S., and Ramakrishnan, V. (1999). Structure of a bacterial 30S ribosomal subunit at 5.5 A˚ resolution. Nature 400, 833–840. Culver, G.M., Cate, J.H., Yusupova, G.Z., Yusupov, M.M., and Noller, H.F. (1999). Identification of an RNA–protein bridge spanning the ribosomal subunit interface. Science 285, 2133–2135. Dabeva, M.D., and Warner, J.R. (1987). The yeast ribosomal protein L32 and its gene. J. Biol. Chem. 262, 16055–16059. Dabeva, M.D., and Warner, J.R. (1993). Ribosomal protein L32 of Saccharomyces cerevisiae regulates both splicing and translation of its own transcript. J Biol. Chem. 268, 19669–19674. El-Baradi, T.T., van der Sande, A.F.M., Mager, W.H., Raue, H.A., and Planta, R.J. (1986). The cellular level of yeast ribosomal protein L25

Tocilj, A., Schlu¨nzen, F., Janell, D., Glu¨hmann, M., Hansen, H.A., Harms, J., Bashan, A., Bartels, H., Agmon, I., Franceschi, F., and Yonath, A. (1999). The small ribosomal subunit from Thermus thermophilus at 4.5 A˚ resolution: pattern fittings and the identification of a functional site. Proc. Natl. Acad. Sci. USA 96, 14252–14257. Vilardell, J., and Warner, J.R. (1994). Regulation of Splicing at an Intermediate Step in the Formation of the Spliceosome. Genes Dev. 8, 211–220. Wool, I.G., Chan, Y.-L., and Gluck, A. (1995). Structure and evolution of mammalian ribosomal proteins. Biochem. Cell. Biol. 73, 933–947. Zengel, J.M., and Lindahl, L. (1994). Diverse mechanisms for regulating ribosomal protein synthesis in Escherichia coli. Prog. Nucl. Acid Res. Mol. Biol. 47, 331–370.