Multiple initiation and polyadenylation sites for the chicken ovomucoid transcription unit

Multiple Initiation and Polyadenylation Chicken Ovomucoid Transcription

Laboratoire C’,titp

Fnrult4

Sites for the Unit

de Ge’ne’tipe

183 de Biologic

dr MAderinr,

Moleculnire des Eucaryotes dir CNRA ct de Gnie GCwitiqrrr de I’ILVSERM 11, RILP ffumann, 67085 ~Wmbortrg Cldex. Frmcr Molbcrhire

(&wived

6 J14ly 1982)

A chicken genomir DNA fragment of about 15 x lo3 bases containing all the ovomucoid gene coding srciuences was isolated frorn a chirkrn erythrocyte USA library. The flanking sequences of t)hc ovomucoid genr were analysrd by DNA st~(lu~~ncing. and ovomucoid gent> transcripts wertl characterized by nuclease S, mapping. Transcription initiates at t’wo sites separ&d 1)~ 85 base-pairs. each site t)(aing preceded by a specifir promoter seyurncr for RSA polymerasc K. l’olyadenylation occurs at three different sites. in all cases downstream from an A-X-T-AA-A or equivalent signal. The major ovomucoid messenger RNA species has the shortest untranslated regions at both 5’ and 3’ ends. The presence of two promoters, altwnative to wwral

three splicing functional

polyadenytat,ion sites and one previously characterized possibility. all functioning apparently independent.ly, give riw ovomucoid mRK\‘Xs.

1. Introduction The expression of the four major egg-white proteins (ovalbumin, conalbumin, oromucoid and Jysozyme) by the tubular gland cells of the magnum portion of the oviduct is controlled at the transcriptional level by steroid hormones (see Palmite et ccl., 1981 : Evans et al., 1981 : Compere et al., 1981 : and references therein). As necessary steps toward the understanding of the hormonal control of transcription, we have previously cloned the ovalbumin gene family (ovalbumin, X and Y genes (Breathnach et al., 1978; Gannon et al., 1979; Chambon et al., 1979: Royal et al., 1979: Heilig et al.. 1980,1982)). and the conalbumin gene ((‘ochet et al.. 1979a,b). LS:e have studied the 5’ ends of the transcription units of these genes with the hope that a comparison of the DNA flanking sequences will provide a means of testing the idea that steroid hormones act, (at least in part) through interaction of steroid receptor complexes with the genome (for references, see Mulvihill et a,l., 1982). We report here a similar study with the ovomucoid gene. We have sequenced the 5’ and

316

3’ end

I’. (:EKI.IS(:E:K

regions

Unexpectedly.

of t’his gene we have

and

found

mapped that

and t’hree polyadenylation minor ovomucoid mRNAs in addition by Tsai it al. (1980). initiation

ET

.-II,

the 5’ and

the ovomucoid

3’ ends of its messenger transcription

unit

contains

RSA. two

sites accounting for the existence of several to the major species previously characterized

2. Materials and Methods The sources of enzymes for complerrlrlrtal,~ I)iXA sequencing ~vere dcsrrilwd by Cachet it trl. (I 979h).

synthesis.

I)SX

cloning.

mapping

and

I’oly(A)+ RNA was prepared from laying-hell oviduct (LeMeur rt (11.. 1981) and subjected to preparative electrophoresis on agarosr/urea gels (iVeil B Hampel. 1973 : modified by Woo et ol., 1975). I’sing a reticwlocyt~e tell-free system (Rhoads ef ~1.. 1973) t,reated with micwcoccal nucleast (Pelham B Jackson. 1976). ovomucoid mRSA was identified b> immunoprecil)itatirrg the translational products of the pooled RNA peaks. Synthesis of ovomucoid single-stranded (o\-on-sscT)NA) and double-stranded (ovom-dwI)NA) complrmrntary I)NA. preparation of a pRR322 vector with Taql sites at its extremities. ligation of the vector to ovom-dscDS.4. t,r,znsforllr~ttion and identification of recombinant clones and preparation of TINA plasmids were performed as described earlier (Cachet et II/.. 1979h) for conalbumin cDNA. (c) ('lo~tiny

nttd

crr~c~lysis of owv,

ucoid

pr,or,r

ic l),V.-l

Ovomucoid clones were isolated from a chicken erythrocytr I)XA library constructed 1)) Dodgson rt (III. (1979). The clones wcw isolated after it/ sit/l hybridization with [ 32P]ovoncI)NA (Perrin et (11.. 1!)79). The chicken genomic l)NA and the recombinant genomic clones were mapped I)y restriction enzyme analysis. The I)NA fragments generated were separated 1)~ electrophoresis in 07S”,, to 2”+) agarose slal) gels. transferred to tlitrocellulose filters ovom-cI)NA probe (Maniatis rt al.. (Southern, 1975) and hybridized to a 321’-Ilick-translatrd 1975). Several DNA fragmetlts wt>w sul~lorwd ink) pRR322 for further analysis and scquenoing (Maxam & (:illwrt. 1980).

Electron recombinant

microscopic pictures I)SA \vere oljtained

of hybrid molecules as described earlier

bet,wren oven-mRNA and genomic by Garapin rl nl. (1978).

Oviduct, RSA was electrophorescd on agarosr slab gels containing 10 mwmethylmercuq hydroxide (Bailey & Davidson. 1976). transferred t,o freshly prepared IIBM-paper (Alwine it (11.. 1977) and hybridized to various owmuroid nick-translated I)NA probes using the conditions described by Wahl rt nl. (1979). Methylmerwry hydroxide was used under a fume hood.

DNA restriction fragments labelled either at. their 5’ ends with polynucleotide kinase and [y-321>lAT1’ or at their 3’ ends with TIXA polymerwe I and [~-32P]deoxgnucleotide triphosphates. \vcre purified by polyaerylamide gel rlertrophoresis (Maxam & Gilbert. 1980). A tot,al of IO to 50 ng of denatured fragments \VHS hybridized with 2 to 500 pg of total or poly(A)+ oviduct RNA and treated with nuclease S, under the conditions described by Heilig

(‘HIVKEN

OVOMI’(‘OID

MI~LTII’l,E

TRrZNSVRII’TS

347

at nl. (1980). Thea sizes of the nuclease HI-resistant DNA fragments were determined b? analysis on .5% to 15% polyacrylamide sequencing gels. Biohazards associated with the experiments described in this publication were examined previously by the French National Control Committee. The experiments wt‘re carried out under L2-BI conditions.

3. Results (a) Clonilq

of th,e ovomucoid gr’nr

The chicken library of Dodgson et al. (1979) was screened with an ovornucoid double-stranded cDNA probe cloned in pBR322 (Chambon et al.. 1979; Krust. 1981). One phage, hC4ovom5. with a chicken DNA insert of about 15 kb. was extensively analysed and found to contain all the ovomucoid gene coding sequences. Figure I(a) and (b) indicates the location of the hC4ovom.5 insert (b). 5,

Tronscriptlon

H/d4

Hhd3 H/m32

3, I hb

Hmd5

&uui> -116

~~Gii

-1 io -50 -i4

(e) A. AATAAA

Fit:. I Organization of the ovomuooid gene in chicken erythrocytr I)NA and in genomic DSA clones. (a) Restriction endonuclease map of genomic DNA coding for ovomucoid mRNA. The heavy line reprtwnts the restriction enzyme genomic DNA fragments containing sequences that hvbridize to a 321’labelled ovom-dscDNA probe. Hi?l,d, Eco. Kpn and Barn correspond to HindIII, &zoRI. Kp”I and BarnHI enzymes. respectively. (b) Localization of the 5’ and 3’ extremities of the 15 kb genomic recombinant clone hC4ovom5. (c) Schematic representation of hybrid molecules between ovom-mRNA and h(‘4ovom.i l)KA as measured by electron microscopy (Fig. 2(a)). Heavy lines refer to exonic I)SA~ RNA hybrid regions. Axon sequences numbewd 1 to 8 and intron sequencrs ,4 to (: are positioned \vit,h respect to some restriction sites of the recombinant DNA. Lengths are given in the legend to Fig. 2(a). (d) Restriction map around the 5’ end of the ovomucoid gene. The restriction enzyme sites shown in this map are underlined in the corresponding sequenw shown in Fig. 3. The heavy line represents the ovomucoid exon 1. The localization of 2 TAT.4 box sequences is indicated. Numerology is negative upstream from the 5’ end of the exon I. Arron s indiratrs the looat,ion of the transcription initiation sites (1’ corwsponds to nucleotides -83 to -89. see Fig. 3). (e) Restriction map around the 3’ end of the oromucoid gene. The heav,v line represents the 3’ part of exon 8. The arrows point to polyadenylation sites of the various ovomucoid RN&. as determined by S, nuclease mapping analysis (see Fig, 8): the location of the corresponding A-A-T-A-A-A I’k 1 t’ sequences (see Fig. 1 I ) is shown but the hyphens haw been omitted for clarity. Fragments ROW:&:MholI. MhoTI -Htrrl II and Horll I-HrrrIIl used as probes (SW b&a-) are indicated.

34X

I’. (:~RI,IN(:EK

BT

.-II,.

with respect to a restriction map of chicken DNA4 established with the ovomdscDNA probe (a). The ovomucoid exons and introns (Fig. 1(c)) were positioned by electron microscopy of hybrid molecules between ovom-mRNA and the recombinant DNA. either intact (Fig. 2(a). (‘hambon it al.. 1979) or cut with KpnI or EcoRI (not, shown, Krust. 1981). A4ll these results concerning the organization of the chicken ovomucoid gene are in good agreement with those reported by Lai et al. (1979).

FIG:. 2. E:lrvtron micrographs of hybrids betwren ovomwoid RSA and the genomic I)SA cloned in XC4ovom:i. The hybrid molecules were prepared as described (Garapin et al.. 1978). In the line drawings. thr broken lint, rrpresrnts the RKA and the solid lint, the I)SA. (“apital letters refer to intronic s~~luen~cs and numbers of rxorric RXA-DSA hybrid sequenrrs. Thr 5’ and 3’ ends of the ovomucoid RNA molecules are indicated with arrows. Ham represent WI pm. (a) A typical hybrid molecule. hybrid segments 1 to 8 are (in The length of intronir loops A to ( : and of exonir DNA-RNA 1036+109 (A). 822f80 (R). 443k94 (C). 253+100 (D). T5irt98 (IX), nwleotidrs or basr-pairs) I131 ill;, (F). 382f93 (G). 12X+50 (1). 30 (2). 16’)f:E (3). 87+22 (4). 153&28 (5). 96+30 (6). I3OJ148 (7) and 201 +44 (8). rrsp+ctivrly. (I)) A hybrid mol~wlt~ showing an rxtended 3’ region. The length of thv t*xonic DNA -RX.4 hybrid segment, 8 is ahout !LX hp.

(‘HIC’KEN

OVOM1~(‘Oll)

M~I,TIl’I,F:

(b) Two 5’en,dsfor ovomucoid

TR.\SS(‘RIPTS

349

R~1:-l

The sequence of the 575 bp immediately upstream from the Hind4 site (see by the method of Maxam & Gilbert (1980). Fig. l(a). (c) and (d)) was determined This sequence (Fig. 3) contains at its 3’ end the exon sequences coding for amino acids -24 to -6 of the preprotein (Thibodeau et al., 1978) and the 5’ end of intron PstI ( +31 to - 393) fragment A. When a hybrid between a 5’ 32P-end-labelled (Figs 1 (d) and 3) and oviduct poly(A)+ RNA was digested with nuclease S,. t,wo labellad fragments of 29+1 and 114+5 nucleotides were obtained (Fig. 4(a). lane 4). The presence of the 29 bp fragment suggests that some ovom-mRNA species have 6’ ends that correspond to nucleotide + 1 of the sequence shown in Figure 3. These species would correspond to the ovom-dscDNA clone sequenced 1)~ d al. (1980), since the sequence of the 5’ end of their full-length ovon(‘atterall vI)SA is 5’ A-T-C-T-C’-A-G-G. . The presence of the 114 bp fragment) was unexpected and suggests the existence of a second KSA species with its 5’ end in the - 80 to -90 region. 5’...,

GAGGTGAATATCCAAGAATGCAGAACTGCATGGAAAG

-8.00 CAGAGCT(iCAGGCACGATGGTGCTGAGCCTTAGCTGCTTCCTGClGGGAG PSfI -350 ATGTGGATGCAGAGACGAATGAAGGACCTGTCCCTTACTCCCCTCAGCGT -?OO TCTGTGCTATTTAGGGTTCTACCAG~CCTAAGAGGTTTTTTTTTTTT f/mfI -{SO TTiGGTCCAAAAGTCTGTTTGTTTGGTTTTGACUCTSRGCATGTGAc -200 ACTTcJTCTCAAGiTdTTAACCAAGTGTCCAGCCAAAniCCCTAGG -!iO -_-AGACGCAGACCATTACCTTGGAGGTCAGGACCT@A~A~A~A~TjCCAGC I,00 CTCATTGTGCC -“P CTGACAGATTCAGCTGGCTGCTCTGTGTTCCAGTCCAA “flpvun

CTTCCTCCCA$TGAGTAACTCCCAGAGTGCTGXXX~. Hmd4 I intron A

Flc:. 3. Son-coding strand srqurncr of thv 5’ end region of the ovomuaoid gene. Subcloning of 1)NA fragments from the hC4ovom5 wcombinant I)NA and seyuencing stratrgy. using the method of Maxanr &Gilbert (1980), have been describedelsewhere (Krust. 1981). The aminoacid sequenceencoded in exon 1 (underlined) is shown and corresponds t)o the amino acids Met -14 to Pro -6 of the owmucoid pwcursor (Thibodeau et nl.. 1978). The nucleotidr numbered 1 corresponds to the first nuclrotidr present in the classical ovomucoid mRNA species ((latterall et 01.. 1980). The two TATA regions are boxed. thr junction between Peon 1 and intron A is indicated (Stein it nl.. 1980: our unpublished results). Thv hyphens have been omitted from the sec(wnw for clarity.

(a)

tb)

7 298 221 220 154

8

9 10

,180 .147

k? 114

,110 90 78

75

87

29 28

VI{:. 4. Nuclrnw S, mapping of the 5’ ends of ovomucoid mRNAs. The I’stt~/‘stt (f31 to - 393) DNA with ~~-“Z1’~A’~I’ and t~ot~nucteotide kinaw and fragmrnt (Figs t(d) a.nd 3) was 5’.em-tabetlrd hybridized with oviduct RNA. Nuctease S, treatment was described in the legend to Fig. 6. the nuolease S,-resistant DNA fragments were run on a lV,!,YOpolyacrylamide/7 ~-urea get. (a) Lane 1. DNA size markers (in nucleotides): lane 2, hybridization with RNA purified by hybrid selection using the Ha&IHaeITI fragment (Fig. t(e)): lane 3. hybridization with to0 pg of Esc!wichin coli ribosomal RNA; lane 4. hybridization with 14 pg of oviduct poly(A)+ RNA. (b) Lane 1. DNA probe used for hybridization (P&I DN4 fragment): lane 2, hybridization with 100 ~g of P. coli ribosomal RSA: lanes III t,hese hybridization 3 to 9. 1. 2.5. 5. 7.5. 10. 20 and .‘,Opg of oviduct t~)I~(.i\)’ RNA wqwtively. mixtuws K. w/i ribosomal RN.4 was added to reach a tinnl amount of 100 +g of RKA: lane 10. I)XA size markers (in nwtrotides)

To investigate further the nature of these two RNA species, oviduct poly(A)+ RNA was fractionated by denaturing gel eleetrophoresis (Fig. 5) and probed with fragments Hind4-AvuI (Fig. 5, lane 1) of Avnl-I%uII (lane 2) (see Fig. l(d)) 32Plabelled by nick-translation. As expected from the previous results of Tsai et al. (1980). the Hind4-Ava,I probe revealed a major band of about 1000 nucleotides (lane 1) (which corresponds to the “classical’? ovom-mRNA with 5’ end at position + 1 of Fig. 3) and several larger minor bands, which may correspond to the primary transcript (about 5700 nucleotides in length, see Fig. l(c)), and some of its intermediate splicing products. However. the AvaI-P~u11 probe also revealed a band (lane 2) of about the same size as the classical ovom-mRNA, consistent with the hypothesis that two RNA species differing at their 5’ ends are transcribed from

(‘H ICKEN

OVOMI‘COID

hlI~I~TIPLE

TRANSCRIPTS

FIG. 5. Electrophorrtic characterization of ovomucoid RNA sequences in laying-hen oviduct. Totals of IO pg of poles (lanes 1, 2. 6 and 6). 40 pg of polysomal (lanes 4 and 8) or 40 pg of total (lanes 3 and 7) RNA were electrophoresed on methylmercury hydroxide/agarose slab gels, blotted onto DBM-paper and hybridized to specific probes labelled with 3*P bv nick-translation. Lane I rlvtrl-Hind4 probe specific for exon I (Figs l(d) and 3). Lanes 2, 3 and ~.‘PvuII-Av~I probe (Fig. l(d)) specific for transcripts starting upstream from nucleotide numhemd 1 in Fig. 3. Lane 5. Rnrrt3-MhoII probe specific for cxoii 8 (Fig. l(e)). Lanes 6. 7 and 8, HaeIII-Hue111 probe specific for the largest 3’ extended RNA molecules (Fig. 1(e)). The rlzwI-Hind4 and HoeIII-HnrIII DSA fragments (see Fig. I(d) and (e)) were subcloned. Prohrs which were not subcloned were purified by polyacrylamide gel rlectrophoresis. Autoradiograph? was performed with Kodak XRI films with an intensifying screen for 60 h in all the lanes except in lanes 3 and 4. which were exposed for 2-weeks. Sizes in nucleotides are indicated on the left.

the ovomucoid gene. The 5’ end of the major species, the “classical” ovom-mRliA. is located at or close to position + 1 of Figure 3, whereas that of the minor one is located in the -80 to -90 region. Both these species are polyadenylated. To investigate whether the 5’ end of these two RNA species could coincide with the 5’ end of their primary transcripts, a different probe starting in intron A was used for nuclease S, mapping. The Hi,rLd4-BgZI fragment, (Fig. l(d)) 5’ 32P-endlabelled at the Hind4 site, was hybridized with total oviduct poly(A)’ RNA under conditions where the formation of RiYA-DNA hybrids is favoured, digested with nuclease S, and run on a DXA sequencing gel (Fig. 6, lane 1) along with sequence ladders of t’he same fragment. There are clearly two sets of resistant bands (I and II in (a)). Set I corresponds to RKA species with 5’ ends located at position + 1 (the main band a in (a)) or very close to it, Set II corresponds to RNA species with 5’ ends in the -83 to -89 region (bands a to e in (b)). We did not find any S, nuclease-resistant band in the -83 to - 89 region when total oviduct poly(A)RNA was hybridized to the labelled probe (not shown). The location of the 5’ ends

1

G

G ;

c ;

-92 -85

-2 a

I

[

-1

l 1

(b)

PII:. 6. Nucleaw S, mapping of the 5’ end of putative ovon~ur:oid primar:\- transcripts. A portion with [y-32t”]ATP arld (05 pmol) of the By/I-Hi//d4 fragments (we Fig. l(d)) 5.end-IabtGd polynucleotide kinase at the Hind4 site was hybridized with 1 mg of poly(A)+ (lane 1) oviduct RNA. Hybridization (16 h at 42°C) was performed in 0.01 M-HEPES (pH 6.5), 0.4 M-NaCI and 80% formamide (250 ~1). Nuclease S, digestion was as described by Heilig rt al. (1980). The same labelled DXA fragment was sequenced wing the Maxam & (:illwrt mrthtrd (( :. (: +A and (‘+T IHIWS. coding strand. A sequencing gel was used to positi(m the prot.wted I )S.-\ st~~uwrw #-it.h rtspwt. to the srqwnaing ladder and to wad the 5’ end base of the RNA. knowing that it corresponds to thts sequencing band situated immrdiat,ely below the nucleaw S, band. (a) I, set of resistant bands c~lrwsponding to hybridization of the probe from the Hind4 sitr up to positimr + I (we I$. 3) Il. Set of resistant bands revealing the existence of RN.4 species whose transcription initiates around position -R5. (b) An enlargment of this region. Sumbers (+ 1. - 1, -2, - 84. -85. -91. -92) refer to the numbering of the sequence shown in Fig. 3. a in set I and a to e in set II indicate t,he major nuclease S,-resistant bands.

of the ovomucoid RNA species are therefore identical, irrespective of the location of the labelled end of the probe, whether it is situated in exon 1 (Pat1 probe; see above) or intron A (the Hind4-BgZI probe). In both cases we found two sets of RNA species with 5’ ends in the - 83 to - 89 region and at. or close to, position + 1. From these results we conclude that initiation of transcription on the ovomucoid gene could take place in two regions separated by about 85 bp. Comparison of the hybridization intensity of increasing amounts of poly(A)+ RNA fractionated by methylmercury hydroxide/agarose gels and hybridized with the PwuII-AvaI or the AwaI-Hind4 probes (Fig. l(d)) demonstrates that the

(‘HIC’KES

O\~OMI’(‘OII)

M~‘I,TII’LlX

TR.AXS(‘KI

PTS

353

molecules initiated upstream from the main cap site represent about 05:/, of the total transcription of the ovomucoid gene (Fig. 7). However. the nuclease Si,resistant bands corresponding to molecules initiated in the -83 to -89 region in Figure 6 are much more intense than those situated in the +l region. This observation does not mean that there are more precursor molecules for this former species (which should then be seen in Fig. 5. lane 2), but rather reflects t,he conditions of hybridization before the nuclease S, treatment. We have observed the formation of the longer hybrid that, under our hybridization conditions, molecules is strongly favoured when both RNA species are present in excess. When various amounts of poly(A)+ RNA were hybridized with the 5’.end-labelled PstI DNA fragment (Fig. 4(b), lanes 2 to 9) the smaller 29 bp hybrid molecule, whicah corresponds to initiation of transcription at position + 1, became preponderant at low RNA to probe ratios (lanes 2 and 3) in agreement with the blotting results shown in Figure 7 (see below).

I+(:. 7. Quantitative estimation of the amount of ovomucoid mRNA rnolcc~ules that RW initiated around the -8.5 position. Several concentrations of oviduct poly(A)+ RNA \pew run on the same methylmercury hydroxide/agarose gel for hybridization either with the AwnI~Hind4 probe (Fig. l(d)) specific for the 1000 nucleotide classical ovomucoid mRX.4 (laws I to 6) or with the I’~~u11-Av~c1probe (Fig. l(d)) specific for the 1090 nuclrotidc V-end-extended molrwlrs (lanes i to 12). The amorlnt of poly(A)+ RNA in each slot was 04,0-2, O.l( ~05,025,0012, 1.25, 25.5. 10. 20 and 40 fig, in lanes 1 t.o 12. wspwtiwly. Thr same intensit,y 011the xutoradiogram is obtained \\-it,h 20 pg of RX.4 hybridized with t,he /‘lull -rlwrl probe and O@I pg of RNA hj-bridized with thr AvnI-Hiud4 probe (arro~rs). Taking into account the length of the probes. about O+;,, of the ovomunoid nrRN.4 rnoleculrs are init.iatt*tl upstream from the main cap site.

(c) Three 3’ ends of ovomucoid

kL1=l

The first evidence for multiple 3’ ends was obtained by electron microscopy. When total oviduct poly(A)+ RNA was hybridized to the genomic clone X4ovom5. some molecuIes were seen with RNA-DNA hybrids extending for about 840 bp downstream from the position of the 3’end of exon 8 (Fig. 2(a) and (b)). N&ease S, mapping was used to localize the position of t)his additional 3’ end. Various amounts of total oviduct poly(A)’ Rh‘A were hybridized to the BumSBum4 fragment (Fig. I(a) and (e)) labelled at its 3’ ends with DNA polymerase I and [Lu-32P]deoxynucleoside triphosphates. The hybrid molecules were digested with nuclease S, and analysed by gel electrophoresis. Three bands (Fig. 8) of about 110, 280 and 900 nucleotides are seen. indicating the presence of RNA species polyadenylated at about 110, 280 and 900 nucleotides downstream from the Barn3 site (arrows in Fig. l(e)). The smaller 110 nucleotide band corresponds to the 3’ end of the classical ovom-mRKA as deduced from electron microscopic results (serb

351

I'. (:bIKl,IS(:E:R

ET

.4i,.

12345678 1631 910 659 655 520

516 506

403

396 344 298

261 257 226

100 89

Fig. l(c) and (e)) and Dh’A sequencing (Catterall rt ccl., 1980; see also below). The band of about 900 nucleotides corresponds to the longer molecule observed by electron microscopy (Fig. Z(b)). The 280 and 900 nucleotide bands were not observed when poly(A)RKA was hybridized to the labelled probe. whereas the 110 nucleotide band was barely detectable (not shown). It appears therefore that most, if not all, of the 3’ extended ovomucoid R?;A species are polyadenylated. To compare the relative amounts of these ovom-RNA molecules with distinct 3’

(‘HIVKEN

OVOhlI~(‘OII)

I\l~~I~TlI’I,F:

TKANS(‘KII’TS

3.55

RXA was separated by denaturing agarose gel ends. oviduct poly(A)’ electrophoresis and hybridized with two different 32P-labelled DK4 probes (Fig. l(e)). either the BumS-Mb011 fragment of about 150 bp (Fig. 5. lane 5) or the HaeIII-HnrIII fragment of about 400 bp (Fig. 5, lane 6). As expected. hybridization with the HaeIII-HarIII probe specifically reveals a band of about 1750 nuclrotides. which corresponds to the molecule seen by electron microscopy (Fig. 2(b)). and also the precursors of this mRNA, the longest one being about 6500 nucleotides long. The longer 800 nucleotide species does not’ appear to represent (Fig. 5, lane 5; and result not shown of more than SC?;, of total ovom-mRNA hybridization curves with increasing amounts of oviduct poly(A)+ RKA). That the classical ovom-mRNA is the predominant species is also evident from thtl examination of the nuclease 8, mapping results at low ovom-mRNA to probe rat’ios (Fig. 8. lane 3). At these ratios the 110 nucleotide band is clearly much more intense than the 280 and 900 nucleotide bands. However, the longer 280 and 900 nucleotide bands become predominant at increasing RNA concentrations (lanes 3 to 7) and their intensities do not reflect their relative amount any more. These result,s indicate clearly that the formation of the longer hybrid molecules is st’rongly favoured under the hybridization condit’ions’ used for nuclease S, mapping. In order to caonfirm the existence of the 170 nucleotide 3’.end-extended RNA species, oviduct. poly(A)’ RNA was hybridized to the MboII-HaeIII probe (Fig. l(e)). As expected, this probe reveals an RNA species of about 1200 nucleotides in addition to the larger 1750 nucleotide species (Fig. 9. lane 2). This I200 nucleotide RXA species is clearly distinct from the main ovomucoid mRZJA species (see lanes 2, 3 and 4). The relative intensity of the 1750 and 1200 nucleotide bands in lane 2

FIG:. 9. Analysis of the S-end-extended ovorn-mRNA moleculrs. A portion (@l pg) of poly(A)’ RX.4 was electrophoresed on methylmercury hydroxide/agarosr slab grls. blotted onto DBM-paper and hybridized to specitic probes Ialwllcd with ‘* 1’ by rli(,k-trarlslatior1. I,ww I H~PIII-HnrIII probe sIw3ic for the 17.50 nucleotide 3’ extended RNA molecules (Fig. l(e)). Lane 2. MboII-HaeIII probe specific for the 1750 and 1200 nuclpotide 3’ extended molecules (Fig. I ((a)). Law 3. sanw probe mixed with the Ron,iMboI1 probe’ specific for exon 8 (Fig. l(c)). Lane 1. .-lwrI-Hi//d4 probe specific for axon 1 (Fig. i(d)). Autoradiograph>, was performtld for I da>. (laws I. 3 and 1) and for A days (lane 2).

356

I’. (:ERI,IS(:ER

(b)

123

E7’ 24L.

45

1631 -1245

-

625

-

176

51 6 506 396 344 298

221 220

suggests that the two 3’.end-extended ovomucoid RNA species are present in about the same amount in oviduct poly(A)+ RNA. From the nuclease S, mapping data shown in Figure 8 and from other DNA mapping results (Fig. I(e)) the two additional polyadenylation sites can be approximately positioned on the DSA sequence as indicated in Figure 11. It. is noteworthy that in both cases the putative polyadenylation sites are preceded by a typical A + T-rich region (see Discussion).

(‘HIC’KES

OV()MI’(‘OII)

iIl~I,TIl’l,E

TRAXSC’RIPTS

355

50

GGATCCACTGGCGAACCCCAGCGAGAGGTCTCACCTCGGTTCATCTCGCA Born3

exon

8

200 ~GATTTGTTGGAcGGT~ATAc~AG~AATATGTTC~ATG~TCGTGG HIl?fI MboII 250 CTCTGGA(~TI~TAACAAGAPCAPCAT~TTGCTCCCATCCCT~TCATI~AAA~ 300 GCAGAA~ACAGATGCAC~CCTCWTGTGTAACTTTGCGC~ 35q TAAATGACAGT~AG~CTCCATTAGTGTTCAGAGCCTTTTAGA~~AA PWII

. . . . . . . . ..ACATT6TCCGTGAAATATATTTTGCTTTTGTCCTTTGTTG

PIG:. 1 1 Sequenw (non-coding strand) of thv 3’ end region of the ovomucoid gene. Subcloning of I)NA fragments from h(‘lovom5 recombinant I)?;A and the sequencing strategy followed to partly sequence the Hom3-Brml DNA fragment using the hlaxam C (iilbrrt method has been described elsewhrrr~ (Krust. 1981). The approximate position of the 2 additional poly(A) sites. as deduced from nuclease S, mapping (Fig. 8) is indicated by double lines above the sequence. Tht, .4-A-T-A-A-A-type sequences located some tIuclrotides upstream from the polyadenylatiml sites aw boxed. The underlined restriction enzyme sites are those shown in the map of Fig. l(e). The sequence of exon 8 of the classical worn RN.4 is also underlined. Hyphens have been omitted for clarity.

(d) Further

characterization

of the multiple

oztomucoid RA’A species

The above results raise the question as to whether ovomucoid RNA molecules that are initiated upstream from the main cap site can also be polyadenylated downstream from the main polyadenylation site. To answer this question, the longest 3’ extended RNA molecules were purified by hybridization to filters containing the cloned HaeIII-HaeIII DNA fragment (Fig. l(e)). After elution, the purified RNA was hybridized to the 5’.end-labelled P&I-PstI probe (Fig. l(d)), digested with nuclease Sr and analysed by gel electrophoresis. The 29 nucleotide band corresponding to initiation at posit’ion + 1 was much more intense than the I 14 nucleotide band corresponding to initiation in the - 85 region, which was very faint although clearly visible on the original autoradiogram (see Fig. 4(a), lane 2). It appears, therefore, that a small proportion of the longest 3’ extended ovomucoid RNA molecules is initiated upstream from the main cap site. In fact. this proportion does not’ seem very different from that observed for the ovomucoid RNA molecules that are polyadenylated at the main polyadenylation site (in Fig. 4, compare lane 2 in (a) with lane 3 in (b), where in both cases hybridization

35X

I’. (:ERI,IN(:EK

E!l’ dl,.

was carried out under conditions of excess probe). We therefore concluded that few ovomucoid mRNA molecules are extended at both their 5’ and 3’ ends. Could the longer ovomucoid RNA molecules be spliced differently from the main classical mRNA? A probe 5’.end-labelled at the E’coRI site of the ovomucoid cDNA (position 702 in the mRNA sequence (Catterall it al., 1980). the Eco2 site in exon 8 (Fig. l(a) and (c))) was hybridized either with total oviduct poly(A)+ RNA or with the ovomucoid 1750 nucleotide long RXA species purified by filt’er hybridization (see ahove). Since the cDKA clone used in this experiment (see Fig. 10(a)) does not ext,end upstream from position f81 of the mKNA, one expects that nuclease S, treatment of the hybrid molecules will generate a 625 nucleotide long fragment. Such fragment,s are present in Figure 10(b), lanes 2 and 3, for total PO@(A)+ RNA and the 1750 nucleotide long RNA species, respectively. Since t,he 5’ end of this DNA is located in exon 1 at position +81 (see Fig. 3). it appears that t,he same splicing events generate the main ovomucoid mRNA and the 1750 nucleotide long RKA species. An additional fragment of 176 nucleotides is also present in lanes 2 and 3 of Figure 10(b). This fragment was previously found by Stein et al. (1980). who concluded that it, corresponds to an ovotnucoid RNA species generat,ed by an alternative splicing between transcripts of exons 6 and 7. Therefore, the precursors of the 1750 nucleotide longer RNA species can also enjoy this splicing alternative. Are the 5’ and 3’ extended mRNA molecules functional! Total oviduct RNA (Fig. 5. lanes 3 and 7) or RNA extracted from purified polysomes (Fig. 5. lanes 4 and 8) were separated on denaturing agarose gels, and hybridized with the PvuIIAvaI probe (Fig. l(d)) specific for the transcripts starting upstream from the main cap site or the HarIII-Ha&II probe (Fig. 1(e)) specific for the 3’ longest transcripts. The same hybridization intensities were obtained with the same amount of total or polysomal RNA run on the gels. This suggests that all these extended molecules are not maturation intermediate but functional mRNA molecules.

4. Discussion We have used the ovomucoid gene previously cloned (Chambon et al., 1979) from the chicken erythrocyte DNA library of Dodgson et at. (1979) to analyse the organization of its transcription unit. In all respects this cloned gene appears to be identical to the ovomucoid gene that has been cloned and extensively studied by O’Malley and his collaborators (Lai et al., 1979: Stein et al., 1980). Unexpectedly, using the S, nuclease mapping technique described by Berk & Sharp (1977), as of mature modified by Weaver & Weissman (1979), we have found a multiplicity ovomucoid mRNAs that correspond to species differing in the lengths of their 5’ and/or 3’ untranslated sequences. (a)

Two promoter

sequences

at thr

5’ wd of the ovomucoid gene

S, nuclease mapping and RNA blots hybridized with specific 5’ end flanking probes reveal that about O-5?; of the ovomucoid mRNA molecules are longer by about 85 nucleotides at their 5’ end than the major species (the classical ovomucoid mRNA : Catterall et aZ., 1980). This length heterogeneity could result from distinct transcription initiation sites or from processing of a longer precursor. That the

('HI('KEN

OVOMI'COlI)

MI~LTIPLE

TR.4NSVRII'TS

xi!)

same 5’ ends are found, whether the nuclease S, probe is labelled at a site located within exon 1 or intron A (Figs 3, 4 and 6), suggests that precursors to omovucoid rnRN.4 could be initiated either at position + 1 or around position -85. This possibility is supported by examination of the DNA sequences upstream from these two putative startsites (Fig. 3). In both cases, an A + T-rich DNA sequence, related to the TATA box sequences common to many promoter regions of genes et al., transcribed by RNA polymerase B (II) (see Corden et al., 1980: Wasylyk 1980; Breathnach & Chambon, 1981). is found at the characteristic distance (about 30 bp) from the two mRNA 5’ ends (see Figs l(d) and 3). Moreover, RNA run-off transcription experiments in vitro have shown that a DNA fragment that contains the more upstream A + T-rich sequence can direct initiation of transcription from a region corresponding to the upper 5’ end in viva, whereas a DNA fragment containing the TATA box located at position -30 can promote initiation of transcription from a site located at the position of the main 5’ end in viva (unpublished results). Therefore, it seems most likely that the ovomucoid gene possesses two promoter regions that differ markedly in their efficiencies in vivo. In this respect, it is interesting to note that no such differences were seen in vitro (unpublished results). Lt is known for several class B promoters that. in addition to the TATA box region, sequences located further upstream, notably in the -60 to -80 region, are important for efficient transcription in viva, whereas their role is much less apparent in most of the systems commonly used in vitro (Corden et al.. 1980). It is therefore likely that the marked differences in the efficiency of the two promoter regions in viva is related to differences in these further upstream sequences. Since transcription of the ovomucoid gene is controlled by steroid hormones, possibly through binding of hormone receptor complexes to specific DNA sequences (see Mulvihill et al.. 1982), it is also possible that the much higher efficiency of one of the two promoter regions is related to its preferential interaction with such complexes. Further studies are required to establish the significance of the discrete resistant bands that are obtained by S, nuclease mapping in the + 1 and - 89 to -- 83 regions (Fig. 6. lane 1). They could correspond to S, nuclease digestion artefacts or to the existence of several mRXA startsites as previously demonstrated for several mRr\‘Xs of viral and cellular origins (see Malek et al., 1981 ; Grez PI al.. 1981). In an? ease. it is interest)ing to note that the presence of an atypical, unusually long, TATA box-like A + T-rich sequence in the upper promoter region is correlated with the more pronounced microheterogeneity of putative mRI$A startsites. Sequence homologies in the 100 bp region preceding the TATA boxes have already been sea,rched for. with the help of a aompuber program (Heilig rlt ccl., 1982). for thtl following chicken genes: ovalbumin, X, I’. conalbumin, lysozyme and ovomucoid. Although some homologies were found. they were not located at an approximately fixed distance from the 5’ end of the genes. Some of these sequence similarities were previously noticed by Benoist Pt al. (1980), Knoll et al. (1981) and (:rez Pt crl. (1981). The functional significance of such homologies, if any, is unknown. In this respect it is interesting to mention that Mulvihill et a,[. (1982) have forlnd that, the I’atI DNA fragment located at the 5’ extremity of the ovomllcoid gene (Figs 1(d) and 3) efficiently binds the progesterone--receptor complex in mho. 13

YM)

I’.

although it does not exhibit regions of the other genes.

striking

(;EMI,IS(:EK

(b) Threr polyadenylation

/ST

sequence

.+I/,.

homologies

sitrs within

with

the corresponding

the ol*om,ucoid 9””

Our present, data demonstrate the existence of two minor ovomucoid mRNA species. which are contiguously extended by about 170 and 800 nucleotides beyond the poly(A) site of the classical ovomucoid mRSA. The lengths of these molecules. both of which are polyadenylated. are about 1200 and 1750 nucleotides. Each of them represents about 50/;, of the total ovomucoid RNA of laying-hen oviduct. The longer 1750 nucleotide species is found in the same concentration in total and polysomal hen oviduct RNA. It appears therefore t,o be a functional ovomucoid mRh’A and not a precursor of the two shorter species. It has been proposed that the hexanucleotide sequence A-A-U-A-A-A (Proudfoot & Brownlee, 1976) or a variation thereof. A-WV-A-A-A (Hagenbuchle et al., 1981 ; Nunberg et al.. 1980: Fraser et al.. 1982: Jung et ~1.. 1980: Cheng et aZ.. 1982), located approximately 11 to 30 nucleotides from the poly(8) tail of eukaryotic as a signal for polyadenylation. Using deletion mutations in mRNAs, functions simian virus 40 (SV40) DNA, Fitzgerald & Shenk (1981) have unequivocally shown that the hexanucleotide sequence belongs to the recognition site for polyadenylation, although it is not the entire recognit,ion site. It, is, however. reyuired for polyadenylation of late mRSAs and its location influences the selection of the poly(A) site. The poly(A) tail is added at a second site (the acceptor or oleavage/poly(A)-addition site), which is usually a (‘. G or T followed by an A residue in the genomic sequence (Fitzgerald K- Shenk. 1981). Examination of the genomic sequence beyond the 3’ end of the classical ovomucoid mRh’As reveals the presence of proper recognition and acceptor polyadenylation sequences in the two regions where the ends of the two 3’-end-extended ovomucoid mRNAs have been mapped (see Fig. 11). It has been suggested that the sequence A-A-U-U-A-A-A. which is present in the 1100 nucleotide species. may be a more efficient poly(A) recognition site than the hexanucleotide A-X-U-A-A-A (Cheng et al., 1982). Our since the two 3’.end-extended present data do not support this suggestion. ovomucoid mRNAs are present at about the same concentration in hen oviduct RNA. of transcription and &4t, t,he present, time the mechanisms for termination polgadenylation in eukaryotic cells are not clear and it is not known whether all mRNAs are polyadenylated by the same mechanism. In a number of cases (sv40 late RNAs. adenovirus type 2 late mRNAs from the major transrript’ion unit. adenovirus early regions 2 and 4, and the mouse #l-major globin mRNA). there is good evidence that most, if not all. of the transcribing RKA polymerase reads through poly(A) sites (see Sevins rt nl.. 1980: Fit,zgerald & Shenk. 1981 : Hofer R: I)arnell. 1981). This suggests that polyadenylation of t’hese mRNAs requires transcript’ followed by poly(A) an endonucleolytic cleavage of the primary addition. In contrast, using less sensitive test,s. Roop et (11. (1980) and Tsai et al. (1980) have not detected transcription distal to the polg(A) site of the ovalbumin using a nuclear run-off transcription assay. we and ovomucoid genes. However, have found. in collaboration with R. I’almit,er. t)hat transcription continues in

('HIC'KES

OVOYI‘('OII)

MI'l,TlPI,E

TKASS('KIPTS

3fi 1

equimolar amounts beyond the poly(A) site of the ovalbumin gene (unpublished result’s). Our present results demonstrate clearly that transcription can continue beyond the classical ovomucoid poly(A) site for at least 800 nucleotides. Further studies are required to establish whether this continuation involves only a fraction of the RSA polymerase molecules that transcribe through the ovomucoid gene or all of them with termination of transcription beyond the more 3’ poly(A) site.

(c) Why multiple

mRXA s from

orw ozxnnucoid

g~r8.e .F

The production from a single cellular gene of multiple mRh’As coding for the same protein has been reported previously. In some cases this results from a microheterogeneity at the 5’ end (chicken ovalbumin mRNA; Malek et al., 1981: chicken lysozyme mRNA; Grez et nE., 1981) or at the 3’ end (bovine prolactin only one promoter or mRSA; Sasavage et al., 1982): with apparently polyadenylation site. In other cases there is a true heterogeneity at the 5’ end (chicken lysozyme mRNA: Grez et al., 1981: mouse r-amylase la gene mRNA: Young et al., 1981) or at the S’end (mouse dihydrofolate mRNA; Setzer et al., 1980: mouse immunoglobulin 6 membrane mRPr’A; Cheng et al., 1982; mouse n-amylase 1X mRNA; Tosi et al., 1981). which appears to be correlated with multiple promoter or polyadenylation sites. The ovomucoid gene is the second example. after the mouse I\-amylase 1A gene, where heterogeneity is generated both at the 5’ and the 3’ ends from multiple promoter and polyadenylation sites. Moreover, as previously reported for the mouse a-amylase 1A gene and some adenovirus type 2 t’ranscription units (Fraser et al., 1982), the choice of the polyadenylation site appears to be independent from that of the initiation site. Alt.hough in some cases one can speculate that the multiplicity of 5’ ends (salivary gland wxsw liver mouse n-amylase 1A mRK,4: Young et al., 1981) or 3’ ends (mouse immunoglobulin 6 membrane mRNA; Cheng et al., 1982) could be related to differential expression of the same gene in different tissues or cells. in the other cases the possible physiological significance of t,he multiplicity of 5’ ends (chicken lysozpme mRSA; Grez et al.. 1981 ; mouse liver n-amylase 1A mRNA: Young et al.. 1981) or 3’ ends (mouse dihydrofolate reductase mRXA: Setzer et al.. 1980: mouse liver and salivary gland n-amylase 1A mRN,4: Tosi et al., 1981) is Wtally unclear. Since the expression of the ovomucoid gene can be induced by several steroid hormones, we have studied the appearance of the multiple ovomucoid mR,I’A species in withdrawn chicken after administration of estradiol. progest,erone. dcxamethasone and testosterone. alone or in corn bination, as previously described for ovalbumin, X and Y mRKA (LeMeur et al., 1981). In all cases t,he mult~iple mRSA species were found in about the same proportions (unpublished results), which indicates that the multiplicit’y of 5’ and 3’ ends is not due to the multiple hormonal regulation of the ovomucoid gene expression. The multiplicity of ovomucoid mRNAs is apparently not correlated with expression of the ovomucsoid gene in different chicken organs, since we did not find (unpublished observation) any significant amount of ovomucoid mRN,4 in a variety of tissues (liver. kidney. brain, pancreas. spleen. etc.), in agreement with the previous report by Sordst)rom of nl. (1979).

362

1’. (:ERI,lK(:ER

87’ .-IL.

The possible biochemical significance of 5’ extended mRNA species is unknown. However. it is interesting to note that for the three known cases (chicken oviduct IA mRKA: Young et 0.1.. lysozyme mRNA; Qrez ef al., 1981 : mouse liver I-amylase 1981 ; our present work), where multiple mRNAs with different 5’ ends are produced in a given tissue from a single gene, the most abundant species possesses the shortest 5’ untranslated region. Whet,her this observation is related to a possible role of this region in the processing stability and/or efficiency of translation of the mRNL4 is unknown, but it is worth recalling that C”. Queen (personal communication. quoted by Young et ctf.. 1981) has found that. RNA containing long 5’ untranslated regions are translated in zdro much less efficiently than their t,runcated counterparts. It) is clear from our data that the classical ovomucoid mRKA and the 1750 nucleotide species are spliced in exactly the same way, including the alternative splicing possibility between exons 6 and 7. previously found for the classical ovomucoid mRNA by Stein et a,]. (1980). The significance of multiple mRXA species transcribed from a single gene and differing by the length of their 3’ untranslated region, in the absence of an alternative splicing that can generate a different mRNA (see Early et al., 1980: Breathnach & Chambon. 1981; Cheng et al., 1982), is totally obscure. In two cases (t,he present one: mouse salivary and liver kamylase 1A mRNAs: Tosi et a.Z., 1981) there is a strong preference for the poly(A) site that is the closest, to the coding sequences, whereas the more 3’ of the poly(A) sites is strongly preferred in the case of the mouse immunoglobulin 6 membrane mRNA (Cheng et al., 1982) and in the mouse dihydrofolate reductase case the less and the more 3’ of the poly(A) sites appear to be used equally. As mentioned in Results. this situation cannot be easily correlated wit,h t’he presence of the hexanucleotide sequences A-A-U-A-A-A or of its variant L4-U-U-A-A-A. Whether the length of the non-translated region may influence the rate of processing of mRNA, its stability and/or its efficiency of translation. remains purely speculative at the present time. In conclusion. the mature ovomucoid mRNA is highly polymorphic : besides the major classical ovomucoid mR?iA. there are several minor functional species that arc generated by the presence of two promot,er sites, t.hree polyadenylation sites and one alternative splicing possibility. all of them functioning apparently independently. In addition, this polymorphism seems to be an intrinsic property of the ovomucoid gene. since it appears to he constant. irrespect,ive of t,he nature of the inducing st,eroid hormone. Although it) is conceivable that the production, in a wit,h the same coding given cell and from a single gene, of several mRNAs caaparities could be advantageous for the (~11 or the organism for some reasons unknown at present,; it, is also possible that such a sit,uation is more related to the evolutionary history of the ovomucoid gene than to it’s present function. In other words, the more 5’ promoter site and the more 3’ end polyadenylation sites could just be evolutionary remnants. with no particular relevance to the present function of the ovomucoid gene. W’t are greatly indet)t,ed to Drs J. Dodgson. tJ. Stromm~r and I). Engel for providing thrx cahirkw 1il)rary and to R. Rrrat,hnach for critical reading of thr manuscript. We thank 1’.

(‘HICKEN

O\‘OM~(‘OII)

MI’LTIPLE

TKASS(‘RIPTS

xi3

Kourilsky and M. Cachet for facilities in initial screenings. The excellent technical assistance E. Sittler and 1’. Meyer is gratefully of P. Hickel. B. Boulay. E. Taubert. J. M. Gamier. acknolvledged. We thank C. WerIb. (‘. Kutschis and E. Badzinsky for preparation of the manuscript. This work was supported by grants from the Centre National de la Recherche Scientifique (ATP 006520/50), the Institut National de la Sante’et de la Recherche MBdicale (PRC 124,026). the Fondation pour la Recherche MBdicale Franc;aise and the Fondation S. et c’. Del Duca. REFERENCES Alnine. .J. C’.. Kemp. D. J. & Stark. (:. R. (1977). i’roc. ,Vnt. ;Icad. Sci.. I7.S.d 74. X350354. Bailey. ,J. M. di Davidson. N. (1976). /lr/al. Biocherrz. 70, 75-85. Henoist. C’.. O’Hare. K.. Breathnach, K. & (‘hambon, P. (1980). Sucl. ilcids RPS. 8, 127- 142. Berk. A. 8: Sharp. P. A. (1977). Crll, 12, 721-732. Hreathnach. R. 8r (“hambon, I’. (1981). =1~1rvu. Rev. Rio&m. 50. 349S383. Rreathnach. R.. Benoist, C.. O’Hare. K.. Cannon, F. & Chambon. P. (1978). I’roc. S,rt. =I&.

Sci.. ClS.,4. 75. 4853-4857. (latterall.

.J. F., S&in,

J. P., Kristo.

P.. Means. =1. R. & O’Malley.

B. W. (1980). ./. CC,// Rio/.

87. 48OG487. (‘hambon, I’.. Benoist. C.. Breathnach, R.. (‘ochet. M.. C:annon. F.. (:erlinger. P., Krust. A.. 1~eMeur.. M.. LePennec. J. P., Mandel. J. I,.. O’Hare. K. 8: Perrin. F. (1979). In Fran/ (:WP to P’rotrin. Proc. 11th Miami Il’intrr Symp. (Russel, T. R. et nl.. eds). pp. .%G+l. r\cademic Press. New York. (‘heng. H. L., Blattner, F. R., Fitzmaurice. L.. Mushinski. .J. F. & Tucker. 1’. W:. (1982). .Vatuw (London) 296, 410-415. (:ochet, M.. Gannon, F., Hen, It., Maroteaux, L.. Perrin. F. & Chambon. P. (1979n). 1Vntnre

(London) 1282, 567-574. (‘ochet. M.. l’errin, F.. Cannon. F.. Krust. A.. Chambon. I’. McKnight. G. S.. Lee. I). C’.. lMayo. K. E. 61 Palmiter. R. (1979b). ~Vucl. .4cids Rex. 6, 24352453. Compere. S. .J., hIcKnight, G. S. 8: Palmiter. R. I). (1981). J. Biol. Chem. 256, 6341-6347. (‘orden, ,J.. Wasylyk, B., Buchwalder. A.. Sassone-Corsi. P., Kedinger. C. & Chambon. 1’. (1980). Scirnc~, 209, 1406-1414. Dodgson. J. B., Strommer, J. & Engel, J. D. (1979). Cell, 17. X79-887. Early. P.. Rogers. ?J.. Davis. M . . Calame, K.. Bond. M . . Wall. R. & Hood, I,. (1980). (‘r/l. 20. 3 I 3-3 I 9. Evans. M. 1.. Hager, L. J. & McKnight. G. S. (1981). (‘r/l. 25. 187 193. Fitzgerald. M. & Shenk, T. (1981). (‘r/l, 24, 251.-260. Fraser. S. M’.. Baker, C. c’.. Moore. M. A. K: Ziff. E. B. (1982). .J. ,lIo/. Biol. 155. 207 -233. (:annon. F.. O’Hare, K.. l’errin. F.. Lel’ennec . J. P., Benoist. C.. Cachet. M., Breathnach. li.. Royal. A.. (iarapin. A.. (‘ami. R. B (‘hambon. I’. (1979). .Vatuw (London). 278. 428

134. (:arapin. A., (‘ami. 15.. Roskam. W.. Kourilsky. 1’. LePennec. .I. I’.. I’errin. F.. (:erlingcr. I’.. (‘o&t. 11. & Chambon 1’. (1978). &~ll. 14. 62%639. (;rez. hl.. J,and. H.. (iiesecke. K.. Schutz. (:. ,Jung. A. & Sippel. A. E. (1981). Crll. 25. 74% 7.X. Hagrnbuchle. 0.. Tosi, M.. Schibler. I’.. Covey. R.. Wellauer. 1’. K. & \‘oung. R. A. (1981 ).

.li~torr (Lio~don)

289, 643-646.

Heilig. Heilig. Hofer.

K.. l’errin. F.. (Cannon. F.. Mandel. J. I,. & Chambon. 1’. (1980). Cell, 20, 625-637. K.. Muuraskowsky. R. & Mandel, J. I,. (1982). J. Mol. Hiol. 156. l-19. E. DamelI. J. E. Jr (1981). CPU. 23. 585-593. Jung. ,4.. Sippel. A. E.. Grez. M. Rr Schutz. (:. (l!%O). I’roc. ~!‘u/. ;Icnrl. Sci.. I’.S.d. 77. 575% .i763.

Knoll.

B. .J.. 1Voo. S. I,. C.. Beattie.

7!L53,

W. & O’Malley.

B. W. (l!Nl).

J. Biol. Chum. 256. 794!$&

M-4

I’. (:l3lItl,IS(:bzli

E7’ .-I/,.

Krust, A. (I981 ). Ph.D. thesis. Strasbourg. Lai. JC.C’.. Stein. ,J. I’.. (‘atterall. .J. F.. Woo. S. I,. C”.. Maw. M. I,.. Means. A. R. & O’,Mallry. H. w. (1979). (‘e/l. 18. x29N%2. L&rur. $1.. (:lar~villv. S., ~tandd. .J. I,.. 1:erlinger. I’.. Palmiter. It. B Chambon. I’. (1981). (‘141. 23. .‘,lit~.‘57t, Al&k. I,. T.. F:scht~nf&tt. W. H.. Munns. T. W. B Rhoads. R. E. (1981). .VUC/. .Ads &w. 9. I 6.77 I 673. Maniatis. T.. .Jrffwy. A. K: Ktcid. I). (;. (1!)75). I’rw. LYut. .-Icrrd. Sci.. l’.S.,1. ‘72. 1184-t 18X. Maxam. A. M. & (:ittwrt. II’. (1980). In Mrthods in E~~ayyrrrology.vol. 65, part, I (Grossman. I,.. cd.). pp. 49%X0, Acaaclemic: Press, Ntw York. Mulvihill. E:. It.. lA(~l’wnrc+. .J. I’. Xr (Ihambon. I’. (1982). (‘v/l. 24. 62b632. Nrvins. ,l. Ii.. Kl;~~lchard. .I. M. 6 I)arndt. .I. E. ,lr (1980). J. 1Mol. Bid. 144. 377~386. Nordstrom. .I. I,.. ttoop. I). R.. Tsai. M. .I. & O’Malley. R. W. (1979). ,G~UTP (I;wrdorc). 278, 328-33 I r\‘utrtwrg. ,J. H.. tiaufman. R. .J.. (‘hang. A. (‘. \‘.. (‘ohen. S. S. & Schimke. R. T. (1980). Cell. 19. S.% 36-C. t’atn1it.c.r. It. I).. Mutvihitt. E. R.. Shrphvrtl. .I. .J. B McKnight. (1. S. (1981). ./. Rid. C’h~n. 256. 7!1tO 7!ftB. t’rlham. H. R. B. & ,Jacksoll. R. .J. (1976). Eur. ./. Rioch,c~rn.67. 217-256. t’crrirt. F.. (“ochct,. 11.. (:rrlinger. l’.. (‘ami. H.. l,t~l’t~nnw. .J. I’. & (‘hambon. 1’. (1970). AYwl. .4cids Rps. 6. 273 I-2748. Proudfoot. N. .I. & Rrowntw. (:. (:. (1976). iVcltur~ (Lortdon). 263. 21 l-211. Rhoadx. 1~. E.. McKnight. (:. S. bz Srhimktt. R. 1’. (1973). ./. Bid. Chum. 248. 2031-ZX~9). Root). I). I~.. Tsai. M. -1. k O’Ma.llcy. H. W. (t!180). Cell. 19. 63 68. Royal. .A.. (:arapin. A.. (“ami. K.. t’errin. F.. Mandet. .I. I,.. LeMeur. M.. Bregegerr. F.. (:annon. F.. Let’cwnrc. ,I. I’.. (‘hamt)on. I’. & Kouritsky, I’. (1979) ?Vuturr (London). 279. 125 132. Sasavagcs. X. I,.. Smith. M.. (:ittam. S.. Woychik. R. I’. B Kott.man. F. hl. (1982). Prof. Sut. .4cd. Sri., I ‘.X./I 79. 223-227. Setter. I). R.. Md:rogan. 11.. Nuntterg. ,I. H. & Schimkv. R. T. (1980). (‘PI/. 22. 3Slb370. Southrw. E:. 311.(197,‘). .1. A’d. Kid. 98. 50%517. Stt*in..J. I’.. (‘nt.t~c~rdl..J. IT.. Krido. I’.. Means. A. I<. K- O’Mallry. H. W. (1980). (‘~ii. 21. 681~ 687. Thitwdeau. S. X.. t’atrnit.c~r. It. I). & \Valsoh, K. A. (l!(7X). ./. Niol. C’hrm. 251. 9018GN)23. Tosi. 11.. Young. K. A.. Hqynbuchlt~. 0. 8 Svhit,tt~r. IT. (l!lSt ). .\‘7~cl. .3cids Rrs. 9. 231% -“:12x Tsai. M. .I.. Ting. A. (‘.. Sordstrom, .J. I,.. Zimrner. W. CyrO‘Malley. K. W. (1980). (‘~11.22. dl!)-2m. n’atll. (:. Al.. St,ern. hl. 8: Stark. (:. K. (t!Q!)). I’roc. .\‘r/f. =Iccrd. Ski., I’.S.d 76. 3683-3687. Wasylyk. K.. l)vrt)vshiw. R.. (:uy. A.. Motko. I).. Rogcd. X.. Twute. R. k C”hamlx>n. t’. (1980). I’m”. Ait. .4cod. AX.. I:.A’.;l 77. 7021 7028. R. I’. 8: Wrissmann. C’. (1979). Std. A4cids KPS. 7. Ili.5--1 I!):~. Wt~ilvc~r. Weit. I’. .A. & Hamprt. A. (1973). Hiochrrr/istry. 12. 436l 4367. \I’oo. S. I,. 1’.. Rosrt~, *J. >I.. l,ia,rakos. (‘. I).. (‘hoi. Y. C‘.. Rusvh. H.. Means. A. R. & O’htattr? I<. IV. (1975). .I. B’iol. (‘JLPw. 250. 7027 70X1. Young. I<. A.. Hagt~rrt)uc*htr. 0. & Schihlvr. I’. (t!Ml). (‘P/I. 23. 151 458.