Multiple low-affinity interactions support binding of human osteopontin to integrin αXβ2

Biochimica et Biophysica Acta 1854 (2015) 930–938

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbapap

Multiple low-affinity interactions support binding of human osteopontin to integrin αXβ2 Eva Kläning a,b, Brian Christensen a, Goran Bajic a, Søren V. Hoffmann c, Nykola C. Jones c, Morten M. Callesen a, Gregers R. Andersen a, Esben S. Sørensen a,d, Thomas Vorup-Jensen b,d,e,⁎ a

Dept. of Molecular Biology and Genetics Aarhus University, Aarhus, Denmark Dept. of Biomedicine, Denmark Institute for Storage Ring Facilities Aarhus (ISA), Dept. of Physics and Astronomy & Center for Storage Ring Facilities Aarhus, Denmark d Interdisciplinary Nanoscience Center (iNANO), Aarhus University, Aarhus Denmark e MEMBRANES Research Center, Aarhus University, Aarhus, Denmark b c

a r t i c l e

i n f o

Article history: Received 7 February 2015 Received in revised form 18 March 2015 Accepted 22 March 2015 Available online 1 April 2015 Keywords: Cell adhesion Integrin Osteopontin Surface plasmon resonance Phosphorylation Integrin I domain

a b s t r a c t Integrin αXβ2 (also known as complement receptor 4, p150,95, or CD11c/CD18) is expressed in the cell membrane of myeloid leukocytes. αXβ2 has been reported to bind a large number of structurally unrelated ligands, often with a shared molecular character in the presence of polyanionic stretches in poorly folded proteins or glucosaminoglycans. Nevertheless, it is unclear what chemical sources of polyanionicity enable the binding by αXβ2. Osteopontin (OPN) is an intrinsically disordered protein, which facilitates phagocytosis via the integrin αXβ2. Unlike for other integrins, neither the RGD nor the SVVYGLR motifs account for this binding, and the molecular basis of OPN binding by αXβ2 remains uncharacterized. Here, we show that the monovalent interactions between the ligand-binding domain of αXβ2 and OPN, its fragments, or caseins are weak, with dissociation constants higher than 10−5 M but with high apparent stoichiometries. From comparison with cell adhesion studies, the discrimination between αXβ2 ligands and non-ligands appears to rely on these apparent stoichiometries in a way, which involves glutamate rather than aspartate side chains. Surprisingly, the extensive, negatively charged phosphorylation of OPN is not contributing to αXβ2 binding. Furthermore, synchrotron radiation circular spectroscopy excludes that the phosphorylation affects the general folding of OPN. Taken together, our quantitative analyses reveal a mode of ligand recognition by integrin αXβ2, which seem to differ in principles considerably from other OPN receptors. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Integrin αXβ2 (also known as CD11c/CD18, p150,95, or complement receptor 4) is expressed primarily in the cellular membrane of myeloid leukocytes and natural killer cells. It is a classic finding that dendritic cells (DCs) express high levels of αXβ2 [9], which supports phagocytic uptake of ligand-coated particulate substances [10,11], in this way procuring antigen for later presentation to T lymphocytes. In pathophysiological immune responses, αXβ2 affects the development of experimental autoimmune encephalomyelitis [12], which is a widely

Abbreviations: ALP, alkaline phosphatise; D, molar ligand density; d, dephosphorylated; DC, dendritic cell; FI, fluorescence intensity; HCM, human casein mixture; ICAM, intercellular adhesion molecule; MIDAS, metal-ion dependent adhesion site; N, stoichiometry; OPN, osteopontin; PBMC, peripheral blood mononuclear cells; R, SPR response signal; RU, resonance units; SPR, surface plasmon resonance; SRCD, synchrotron-radiation circular dichroism spectroscopy ⁎ Corresponding author at: Biophysical Immunology Laboratory, Dept. of Biomedicine, Aarhus University, DK-8000 Aarhus C, Denmark. Tel.: +45 8716 7853; fax: +45 8619 6128. E-mail address: [email protected] (T. Vorup-Jensen).

http://dx.doi.org/10.1016/j.bbapap.2015.03.008 1570-9639/© 2015 Elsevier B.V. All rights reserved.

used animal model of human multiple sclerosis. These observations associate integrin αXβ2 with central functions in the immune response. The ligand recognition by αXβ2 is remarkably complex. Among the well-characterized ligand for this receptor is a proteolytic cleavage products of complement component C3, namely the iC3b [13–16]. However, a large number of alternative ligands have been reported, including denatured albumin [17], denatured fibrinogen [18], as well as several polyanionic carbohydrates and lipids [19,20]. In view of the surprising ability to recognize proteins structurally decayed through treatments with chemical denaturants [17,18] or proteolysis [18], there is considerable uncertainty regarding the biochemical principles, which permit the binding of integrin αXβ2 to its vast range of ligands [20]. In the cell membrane, integrins are obligatory heterodimers. The alpha chain of αXβ2 carries the major ligand binding, a domain inserted (I) into the seven-bladed beta propeller domain [21]. A recent structural enquiry into the ligand selectivity of I domains from integrins αMβ2 and αXβ2 showed a high degree of consistency between the isolated I domain binding of ligands and the ligands bound by entire receptor ecto-domain [15,22,23]. The I domain adopts the Rossmann fold and

E. Kläning et al. / Biochimica et Biophysica Acta 1854 (2015) 930–938

chelates a Mg2+ ion in the metal-ion dependent adhesion site (MIDAS). Negatively charged side-chains in protein ligands may ligate via coordination to the Mg2 + ion in the MIDAS. In the case of the αX I domain, ligands may also include free glutamate or aspartate amino acids, or even simpler anionic species such acetic or propionic acid [18]. This binding capacity is shared with the I domain of integrin αMβ2 (CD11b/ CD18, Mac-1, or complement receptor 3) but not with integrin αLβ2 (CD11a/CD18, or lymphocyte function-associated antigen [LFA]-1). αXβ2 and αMβ2 also share a vast number of structurally unrelated ligands as well as the ability to bind denatured protein species. By contrast, αLβ2 binds only immunoglobulin superfamily molecules, notably the intercellular adhesion molecule (ICAM). The broad ligand specificity displayed by αXβ2 and αMβ2 is likely to be linked with their ability to chelate anionic groups via the MIDAS [20]. However, surface plasmon resonance (SPR)-based assays reported a weak strength of these interactions, typically displaying a KD of ~ 200–300 μM [18,22]. It remains unknown if and how such weak interactions are quantitatively contributing to cell adhesion. Unlike the integrin αMβ2, αXβ2 shows a preference for polyanionic macromolecules with intrinsically unstructured regions [18,20,24]. A recently described example is osteopontin (OPN) [25]. OPN carries a high negative charge with glutamate and aspartate constituting 25% of its residues. In addition, OPN is often extensively phosphorylated [1, 26]. Spectroscopic analyses show that OPN contains large regions, which are intrinsically unstructured in solution [27]. OPN is an extracellular matrix protein found in tissues such as bone, skin and the gut as well as in body fluids including urine, milk and blood [28] with roles in bone mineralization [29,30], cancer metastasis [31,32] and immune regulation [33–35]. Many of these functions are asserted via OPN interaction with integrins. Previously, these interactions were thought to be mediated mainly by two integrin binding sites, namely the 143RGD145 motif, which ligates integrins α5β1, α8β1, αVβ1, αVβ3, αVβ5,αVβ6, αVβ8, and αIIbβ3 [36] and a cryptic motif 146SVVYGLR152 ligating integrins α9β1 and α4β1, however, only after proteolytic cleavage of OPN [37,38]. Integrin αXβ2 was hypothesized to bind OPN through its exposure of negative charge and not exclusively, if at all, through the RGD- or SVVYGLR-motifs [25]. However, this point was not experimentally investigated. Since the past studies indicated a complex and heterogeneous type of interaction between the αX I domain and ligands, characterization of the kinetics in the binding of OPN would seem crucial to further our understanding of this type of interaction. It remains unclear if the binding of polyanions by αXβ2 is the consequence of simple electrostatic attractions with little or no selectivity towards the source of the negative charges, or if the αX I domain preferentially binds certain anions. Indeed, quantum chemical calculations on ligand binding by the αL I domain MIDAS [39] and experimental findings using the αX I domain [18] suggested a preference for glutamate over aspartate side chains as I domain ligands. Recent structural evidence also suggests that the relatively long glutamate side chains are more permissive of integrins I domain binding compared with aspartate side chains [22]. However, it has not been studied if this has implications for the binding by αXβ2 to proteins with multiple sources of anionicity. Here, we compare binding between OPN or casein and the integrin αXβ2. While both OPN and casein are highly polyanionic and unstructured proteins, only OPN is an efficient ligand for the membraneexpressed receptor. For these binding reactions, SPR-based assays provided the kinetics and apparent stoichiometry of αX I domain to anionic ligands. From comparison also with casein, our data suggest that the C-terminal part of human OPN carries a high density of αX I domain binding sites constituted by glutamate, but not aspartate, side chains, however, all with a weak affinity and not different in binding kinetics from those sites presented in casein. We propose that an ensemble of low-affinity interactions supports binding of integrin αXβ2 to OPN and that these interactions are sufficient for supporting cell adhesion. Surprisingly, the presence of OPN phosphate groups did not contribute to the critical polyanionicity, nor did they affect the lack of secondary

931

structure in OPN. Together, our studies point to selectivity of the integrin αXβ2 in binding anionic molecules. 2. Materials and methods 2.1. Sources of OPN isoforms, OPN fragments, and casein Our study involved five isoforms of human OPN and the N- and C-terminal fragments of OPN as outlined in Fig. 1, as well as a human casein mixture (HCM). OPN was purified from human milk as described in [1] and either left untreated or dephosphorylated as described in [8]. Both untreated and alkaline phosphatase (ALP)-treated OPN (dOPN) was further purified by reverse-phase HPLC on a Vydac C18 column (Separations Group). The purification was carried out in 0.1% (v/v) trifluoroacetic acid and proteins were eluted with a linear gradient of 75% (v/v) 2-propanol in 0.1% (v/v) trifluoroacetic acid. Recombinant (r)OPN-RGD and rOPNRAD for adhesion experiments were made by transfection of HEK293 cells. Cloning of N-terminally tagged full-length OPN, the residues 1–298 of OPN (without the signal peptide) into the vector pEXPRIBA42 (IBA BioTAGnology) was carried out as described in [8]. Mutation of RGD to RAD (g455c; indicated with an underscored character in the primer sequence) was carried out with QuikChange® Site-Directed Mutagenesis Kit (Stratagene) using complementary primers: forward 5′-CACATATGATGGCCGAGCTGATAGTGTGGTTTATG-3′. The pEXPRIBA42 vector contains the BM40 signal sequence resulting in secretion of the construct. HEK293T cells were transfected with plasmids, cultured, serum-free medium was harvested and rOPN-RGD and rOPNRAD were purified as described in [8]. Non-phosphorylated rOPN was made by recombinant synthesis in Escherichia coli. rOPN was amplified from the pEXPR-IBA42 vector mentioned above using the primers (forward) 5′-CAGAGGATCCCATCACCATCACC-3′ and (reverse) 5′-CGACCT CGAGCTACTAATTGACC-3′. The amplification product was ligated into the vector pGEX-6P-2 (GE Healthcare) using restriction sites BamHI and XhoI. GST-rOPN fusion protein was expressed in the E. coli BL21 strain and purified on Glutathione Sepharose 4B, GST GraviTrap, (GE Healthcare Life Sciences). The fusion protein was cleaved with the PreScission™ Protease (GE Healthcare). rOPN was further purified on a Ni-NTA superflow column (Qiagen). rOPN was incubated with 30 mU thrombin/μg for 1 h at 37 °C. N- and C-terminal rOPN fragments were separated by reverse-phase HPLC on a Vydac C18 column as described above. Fragment sizes and purity were verified by Western Blotting and mass spectrometry. Human casein mix (HCM) was purchased from Sigma. 2.2. Analysis of OPN and casein secondary structure-content by SRCD Synchrotron Radiation Circular Dichroism (SRCD) spectra were collected on beamline CD1 [40,41] at the ASTRID storage ring (ISA, Dept. of Physics & Astronomy, Aarhus University, Aarhus, Denmark). The beam from CD1 was polarised with a MgF2 Rochon polariser (B-Halle GmbH, Berlin), and a photo-elastic modulator (Hinds, USA) produced alternating left- and right-handed circularly polarised light. The light was passed through the sample and detected by a photomultiplier tube (Type 9406B, ETL, UK). Spectra were collected for the proteins: OPN (0.5–1.9 mg/mL), dOPN (0.8–1.0 mg/mL) and HCM (0.6 mg/mL). All samples were measured in a buffer containing 10 mM Tris, 40 mM Na2SO4 and 3 mM CaCl2, pH 7.4, and spectra of the buffer were recorded for baseline subtraction. Samples were measured in 0.1 mm path length Suprasil cells (Hellma GmbH). All sample and baseline spectra were collected at least three times with 1 nm step size and 2 s dwell time. The spectra were averaged, baseline-subtracted and mildly smoothed with a Savitzky–Golay filter using a purpose made Excel template. The secondary structure predictions were carried out on the DichroWeb server [42] with the CDSSTR method using the SP175 reference dataset. Accurate secondary structure determinations rely on careful evaluation of

932

E. Kläning et al. / Biochimica et Biophysica Acta 1854 (2015) 930–938

Fig. 1. OPN variants used in the study. Schematic representation of the different OPN variants used in this study. Black diamonds represent OPN glycosylations while grey circles indicate OPN phosphorylation. However, the indicated modifications are not representative of the actual number of modified residues, but merely indicate that such modifications can be found in OPN. The levels of glycosylations and phosphorylations were described earlier from findings presented in [1] and from mass-spectrometric analysis of recombinant proteins expressed in E. coli [8].

the sample concentration. This was enabled by repeated Quantitative Amino Acid analysis (QAA) on all samples. An average amino acid molecular mass of 110 Da was used for concentration determination. In addition SRCD spectra were collected on several batches of purified OPN variants to exclude batch-to-batch variation effects in the analysis.

2.3. Cell adhesion assays K562 cells either non-transfected or stably transfected with the integrin αXβ2 [43] were used for cell adhesion experiments. Cells were cultured in RPMI 1640 medium supplemented with 2 mM glutamine, 10 U/mL penicillin, 10 μg/mL streptomycin, and 10% (v/v) FBS. In addition, transfected cells were cultured in the presence of 200 μg/mL hygromycin. The assay was carried out essentially as described in [44]. In brief, 96-well polystyrene plates with conical wells (Corning) were coated with 70 μL/well protein dissolved in coating buffer (20 mM Tris–HCl pH 9.4, 150 mM NaCl) and incubated for 1 h at 37 °C. OPN, dOPN, HCM, rOPN-RGD and rOPN-RAD were used as ligands and coated on 96-well plates. Adsorption to plastic plates was evaluated using the FluoroProfile kit (Sigma-Aldrich) to ensure equal amounts of protein binding to the plastic surface. Plates were blocked in 0.05% (v/v) Tween 20 in PBS, pH 7.2. Meanwhile K562 cells, non-transfected, or transfected with integrin αXβ2, were stained with BCECF-AM (Invitrogen). Cells were washed and diluted to a concentration of 0.5 × 106 cells/mL in binding buffer ((10 mM HEPES-KOH, pH 7.4), 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 5 mM D-glucose). Cells were either left untreated or activated for integrin binding by addition of 1 mM MnCl2. All cells were incubated for 30 min. at 37 °C. 100 μL cell suspension was added to each well and the plate was incubated for 20 min. at 37 °C. The plate was centrifuged at 10 ×g for 5 min. Fluorescence was measured using a VICTOR™ X3 Multilabel Plate Reader (PerkinElmer). Adhesion was calculated by comparing fluorescence signals from protein-coated (Scoated) and uncoated (Suncoated) wells as Cell Binding (%) = 100% × (Suncoated − Scoated) / Suncoated. All measurements for both coated and control wells were done in triplicate and triplicates were averaged. These averages were used for the calculation of cell binding from independent experiments.

2.4. Expression and purification of recombinant αX I domain The human αX I domain mutant C128S/I316G [16] was subcloned into pET30Ek/LIC vector using the primers (forward) 5′-GACGACGACA AGATGGAGAATCTTTATTTTCAGGGCGCCGTGTCCAGGCAGGAGTCCCC-3′ and (reverse) 5′-GAGGAGAAGCCCGGTTAACCCTCAATGGCAAAGATCTT CTCC-3′. The protein was expressed in BL21 (DE3) E. coli cells. The cells harbouring plasmid were grown in 2 × TY medium to OD600 ≈ 0.6 at 37 °C. Protein expression was induced with 1 mM IPTG and growth was continued at 20 °C over-night. Cells were harvested by centrifugation (7000 ×g for 20 min at 4 °C), resuspended in 50 mM HEPES pH 7.5, 300 mM NaCl, 30 mM imidazole, 1 mM PMSF (binding buffer) and lysed by sonication. Cell debris was removed by centrifugation (20,000 ×g for 30 min at 4 °C) and the resulting supernatant was loaded on a Ni2+-charged HisTrap FF crude column (GE Healthcare). The recombinant proteins were eluted in 20 mL of 50 mM HEPES pH 7.5, 300 mM NaCl, 500 mM imidazole. The histidine-tag was removed by digestion using an in-house prepared TEV protease during dialysis over-night at 4 °C against 2 L of 50 mM HEPES pH 7.5, 300 mM NaCl, 0.5 mM EDTA. The cleavage product was then loaded onto the HisTrap column and the tag-free protein recovered in the flow-through. The αX I domain was further purified on a 120 mL Superdex 75 gelfiltration column (GE Healthcare) eluted in 50 mM HEPES pH 7.5, 200 mM NaCl. Purity of the recombinant proteins was analysed by SDS–PAGE, after which the protein-containing fractions were pooled, snap-frozen and stored at −80 °C. 2.5. SPR assay-based quantification of αX I domain binding kinetics Experiments were carried out essentially as described in [16]. In brief, HCM, rOPN, rOPN-N and rOPN-C were immobilised on CM-4 chips (GE Healthcare) using amine coupling reagents. HCM and rOPN were immobilized in separate flow cells while another flow cell was used as a reference following activation of the carboxyl groups and subsequent blocking with ethanol amine. A second set of ligands included rOPN, rOPN-N and rOPN-C coupled on a separate chip. Proteins for immobilization were dissolved in 10 mM acetate buffer with the pH level adjusted one pH unit below the calculated pI of the protein (Table 1).

E. Kläning et al. / Biochimica et Biophysica Acta 1854 (2015) 930–938

933

Table 1 Protein properties. Number of protein amino acid residuesa, relative molecular massb, and isoelectric pointc (not including phosphorylations). Molecular weight and isoelectric point was calculated using the ExPASy Compute Mw/pI Tool [4–6]. Percentage of total casein in human milk based on data from [7]d. Number of phosphorylated residues and the percentage of acidic residues are listed for α-S1-casein, β-casein, κ-casein, HCM (weighted average of α-S1-casein, β-casein and κ-casein), OPN, rOPN, rOPN-N and rOPN-C based on data from [1]e. Protein

Proteina residues

Theoretical Mbr

Theoretical pIc

% of total casein in human milkd

Number of phosphorylated residuese

% acidic residues

α-S1-casein β-casein κ-casein HCM OPN rOPN rOPN-N rOPN-C

170 211 162 – 298 311 165 146

20,089 23,858 18,163 22,077 33,714 35,036 18,216 16,839

5.17 5.33 8.68 6.10 4.35 4.49 4.11 5.12

11.75 64.75 23.5 100 – – – –

0–8 0–5 – – 0–32 0 0 0

13.5 9.5 6.8 9.3 25.2 24.1 25.5 22.6

The αX I domain was applied in running buffer containing 50 mM HEPES, 200 mM NaCl, 1 mM MgCl2, pH 7.5, in concentrations of 0.25, 0.5, 1.0, 2.0, 4.0, 6.0, 8.0, 10.0, 20.0, 40.0, 50.0 and 100.0 μM, respectively, with a contact time of 240 s, followed by a monitored dissociation phase of ~350 s. Between each run, the surfaces were regenerated in 100 mM HEPES, 1.5 M NaCl, 50 mM EDTA, pH 7.4. The heterogeneous interaction between the αX I domain and ligand was analysed by initial alignment of the SPR signals (R, in arbitrary response units, RU) from the ligand-coated and reference flow cells, followed by subtraction of the reference signal from signal obtained in ligand-coated flow cells using BIAevaluation software (GE Healthcare). The resulting sensorgrams were analysed either with a Langmuir binding isotherm as implemented in the Prism v. 6 software package (©GraphPad Software, Inc.,) or with the EVILFIT v.3 software package [2,3] as detailed elsewhere [45]. 2.6. Statistical analysis All statistical analyses were carried out in Prism v.6 software package. 3. Results 3.1. OPN and HCM are equally disordered proteins From past investigations [17,18], lack of ligand higher-order structure appears to be an important contributor to binding by integrin αXβ2. OPN and human casein mix (HCM) share several biochemical characteristics (Table 1), including a high negative charge contributed by acidic residues and phosphorylations, but carry no major primary structure similarities. We used SRCD to directly compare the degree of structural disorder and secondary structural elements found in human OPN, dOPN and HCM. The SRCD spectra recorded for OPN, dOPN, and HCM are shown in Fig. 2. The SRCD data showed that these protein species are equally disordered and mainly differ in the content of α-helical and β-sheet structure (Table 2). To compare the structural properties of OPN variants with HCM in more detail, we analysed the structural stability of OPN, dOPN and HCM using SRCD temperature scans (Fig. 2A–C). An initial scan at 24 °C was followed by heating in steps in the interval 11–77 °C. Furthermore, a scan was included after 12 h re-cooling of the sample. The heat stability was evaluated by analysing the SRCD signal at the wavelength yielding maximum signal as a function of the temperature (Fig. 2D). All proteins investigated displayed a clear decrease in signal strength upon heating across the wavelength spectrum (Fig. 2A–C). The secondary structure of OPN and dOPN was not regained after 12 h re-cooling (Fig. 2A, B) whereas HCM completely regained the secondary structure observed prior to heating (Fig. 2C). The signal was stable below or at ~38 °C for OPN and dOPN while at higher temperatures the signal decreased (Fig. 2D). HCM maintained structured elements below or at ~ 42 °C (Fig. 2D), i.e., only slightly above the critical temperature for

Fig. 2. Representative SRCD spectrums for human OPN, dOPN and HCM. OPN (A), dOPN (B) and HCM (C) were analysed by SRCD at temperatures ranging 11–77 °C. The SRCD signal is plotted as a function of the wavelength. (D) The heat-stability of OPN, dOPN and HCM was compared by plotting the SRCD signal θ (in mdeg) averaged for 198–202 nm (OPN and HCM) or 200–204 nm (dOPN) as a function of the temperature (°C). A dashed line indicates the approximate temperature where melting of OPN and dOPN started while the full line indicates this temperature for HCM.

934

E. Kläning et al. / Biochimica et Biophysica Acta 1854 (2015) 930–938

Table 2 Secondary structures of human OPN, dOPN and HCM. The content of regular α-helicala, disordered α-helixb, regular β-strandc, disordered βstrandd, turnse and unordered conformationf in OPN, dOPN, HCM and β-casein. Results for OPN and dOPN are averaged from at least three independent experiments performed in triplicate whereas results for HCM represent single experiment where measurements were performed in triplicate. The measurements for calculating the distribution of secondary structure were collected at 25 °C. Protein

Regular Distorted α-helixa α-helixb

Regular β-strandc

Distorted Turnse Unorderedf Total β-strandd

OPN dOPN HCM

0.00 0.00 0.10

0.22 0.22 0.11

0.13 0.13 0.08

0.06 0.06 0.12

0.14 0.14 0.13

0.44 0.44 0.46

0.99 0.99 1

OPN and dOPN. However, the signal for OPN and dOPN was completely lost, while HCM maintained some signal (Fig. 2D). During heating, the secondary structure is lost but precipitation will also give rise to a loss of signal. These effects are hard to separate in continuous measurements. In summary, direct measurements of the secondary structure OPN, dOPN, and HCM revealed a similar content of disordered regions. The only slight difference in heat-stability further supports their similarities with regard to structural content. Consequently, OPN, its variants, as well HCM are relevant to compare with regard to integrin αXβ2 binding to identify properties beyond structural disorder as contributing to the binding by this integrin. 3.2. OPN and dOPN, but not HCM, mediates cell adhesion via the integrin αXβ2 With the structural similarities between OPN and HCM recorded by SRCD between OPN and HCM, we probed these proteins as ligand for the integrin αXβ2. This was done by the use of a cell adhesion assay described earlier for probing adhesion to bovine OPN [25]. Human OPN (Fig. 3A) and dOPN (Fig. 3B) were robust ligands for αXβ2. The binding required Mn2+ ions (Fig. 3A, B) indicating that OPN binding requires conformational change of the integrin. Cells without β2 integrin expression did not support detectable binding to the OPNs, confirming the specificity of the interaction. Interestingly, the binding by αXβ2 did not involve the RGD motif present in native OPN, since mutation of glycine to alanine did not alter the binding between the αXβ2-expressing K562 cells and recombinant OPN (Fig. 3D). By striking contrast, HCM was not a ligand for αXβ2 (Fig. 3C). We ensured an equal level of protein adsorption to the wells by using the Fluoroprofile Kit (Sigma) excluding differential adsorption as an explanation of this finding (data not shown). 3.3. Quantification of αX I domain binding kinetics and apparent stoichiometry in the interactions with OPN and HCM The αX I domain interaction with recombinant OPN (rOPN) and HCM was analysed by SPR, essentially as described for other ligands [18,22,45]. rOPN was split into a N- and a C-terminal fragment by thrombin cleavage (rOPN-N and rOPN-C, respectively), generating fragments of similar size and charge suited for further detailing properties in the OPN interactions with αX I domain. The interactions of HCM, rOPN, rOPN-N and rOPN-C with the αX I domain were analysed in the presence of 1 mM Mg2+ in order to enable MIDAS-mediated interactions. The sensorgrams (Fig. 4A, D, G, J) were analysed either by establishing a simple Langmuir binding isotherm from the steady-state equilibrium response level [REq(c)] reached at the end of the injection phase (Fig. 4B, E, H, K) or using the EVILFIT algorithm [2,3] (Fig. 4C, F, I, L). The EVILFIT analysis resolves the heterogeneous interaction between the I domain and ligands into ensembles of simple 1:1 interactions, each type of interaction weighted by the algorithm. The abundance (in arbitrary resonance units, RU) of such interactions (here

Fig. 3. αXβ2-transfected K562 cells adhere to both OPN and dOPN but not to HCM. αXβ2transfected K562 cells in the presence Mn2+, αXβ2-expressing K562 cells and untransfected K562 cells in the presence of Mn2+ were analysed for adhesion to OPN (A), dOPN (B) and HCM (C) following centrifugation at 10 ×g. Error bars indicate SEM of mean values from at least three independent experiments. (D) Adherence to OPNRGD and OPN-RAD (10 μg/mL) centrifuged at 10 × g. Error bars indicate the SEM of three independent experiments.

indicated with colour-codes) is plotted as a function of the dissociation constant (KD) and dissociation rate (kd). The Langmuir isotherm [45,46] fitted the experiment data well, returning an estimate of the KD for all ligands within the order of 4.5 × 10−5 M. As judged from the relatively modest standard error of the mean for the models, the values were robust estimates of KD. By contrast, the maximum binding capacity (RMax) differed between the immobilized ligands, with the rOPN-C-coupled surface showing higher binding capacity than the rOPN-N-coupled surface even though rOPNC was immobilized with lower density (Table 3). With regard to accounting for the binding kinetics, binding data for the I domain applied in 0.25–100 μM showed only small discrepancies between the experimental data (indicated with green lines in Fig. 4A, D, G, J) and the modelled sensorgrams (indicated with red lines) as

E. Kläning et al. / Biochimica et Biophysica Acta 1854 (2015) 930–938

935

Fig. 4. Analysis of SPR data with Langmuir binding isotherms and two-dimensional distributions of KD and kd established with EVILFIT. Sensorgrams (A, D, G, J), the fitting of REq to a Langmuir binding isotherm (B, E, H, K), and 2D plots (C, F, I, L) are presented for HCM (A–C), rOPN (D–F), rOPN-N (G–I), and rOPN-C (J–L). Sensorgrams represent the signal, R (in RU), as a function of time (in s). Green curves show the experimental data and red curves represent the fit generated by the EVILFIT algorithm [2,3]. Langmuir binding isotherms were calculated from fitting of the experimental data (REq) with Eq. (3). The two-dimensional plots display the ensemble of binding kinetics in the interaction between the immobilized protein and soluble α XI domain. Results were plotted as log10(KD) vs. log10(kd) with the abundance of the interactions indicated with colour-code. Data shown represents at least two experiments.

indicated by the small root-mean-square deviations (Fig. 4A, D, G, J). From the simple relation KD = kd/ka, where ka is the association rate, the distribution in KD and kd, puts the ka between 101 to 104.5 M−1 s−1. This is lower than 105 M−1 s−1, which is a reference

Table 3 SPR parameters calculated for injection of 100 μM αX I domain. Two CM-4 chips were used in the study; one immobilized with HCM and rOPN (top two rows) and a second immobilized with rOPN, rOPN-N and rOPN-C (bottom three rows). Dliganda, Rb, Danalytec and N(c)d were all calculated at 100 μM analyte according to Eqs. (1) & (2). Results are stated as mean value ± SD for at least two experiments. Protein immobilized

DaLigand (pmol/mm2)

R,c = 100 μMb (RU)

DAnalyte (100 μM)c (pmol/mm2)

N (100 μM)d

HCM rOPN rOPN rOPN-N rOPN-C

0.0856 0.0452 0.0468 0.0798 0.0590

2441 ± 276 4358 ± 1216 4002 ± 93 1993 ± 264 5885 ± 165

0.108 ± 0.012 0.192 ± 0.054 0.176 ± 0.004 0.088 ± 0.012 0.259 ± 0.007

1.3 ± 0.1 4.2 ± 1.2 3.8 ± 0.1 1.1 ± 0.1 4.4 ± 0.1

value for considering mass transport limitations. Together with the excellent fits obtained with the two-dimensional distributions, it excludes that experiments were significantly influenced by mass transportation [47]. The αX I domain binding to HCM, rOPN, rOPN-N and rOPN-C was similar with regard to binding kinetics. Three distinct populations were observed, indicating that αX I domain interaction with either of these protein ligands is not reliant on a single type of interaction, but is rather an ensemble of interactions (Fig. 4C, F, I, L). All observed interactions were metal ion-dependent as addition of EDTA to the running buffer completely disrupted binding (data not shown). Notably, no interactions with KD values lower than 10− 5 M were observed (Fig. 4B, D, F, H). As reported elsewhere, this is unlike the observations for denatured fibrinogen and large C3 fragments, which features detectable populations with a KD ~ 10−6 M [16,18,22,45]. The validity of the analysis of the binding kinetic was further supported by the agreement with analyses made using the Langmuir binding isotherms. As indicated with a hatched line in Fig. 4C ,F ,I, and K, the KD value at 4.5 × 10−5 M established from the isotherms also accounted well as a mean value for the KD distributions resolved by the use of EVILFIT.

936

E. Kläning et al. / Biochimica et Biophysica Acta 1854 (2015) 930–938

To further explore the interaction between the αX I domain and the ligands, the molar binding capacity (apparent stoichiometry) of the immobilized ligand properties was also analysed. As a theoretical starting point, we considered the situation with two ligands, which bind the αX I domain (i.e., the analyte) with similar distributions in KD values. The molar density of ligand molecules, DLigand, and bound analyte at the concentration c, DAnalyte(c), can be calculated from amount of immobilized ligand in RU and the REq(c) using the transformation 1 RU equals 1 pg protein/mm2 [48] (chip surface-bound) with molecular weights of ligand (MW,Ligand) and analyte (MW, Analyte): DLigand ¼

REq ðcÞ  1pg=RU RI  1pg=RU ; DAnalyte ðcÞ ¼ : MW;Ligand MW;Analyte

ð1Þ

From these values, the apparent stoichiometry, i.e., number of mol analyte bound per mol ligand at the analyte concentration c, N(c), can be calculated as NðcÞ ¼

DAnalyte ðcÞ : DLigand

ð2Þ

Results generated from the highest analyte concentration applied (100 μM) were used to calculate N for HCM, rOPN, rOPN-N and rOPN-C (Table 3). rOPN and rOPN-C bound both αX I domains with proportions of ~1:4 (ligand:αX I domain), indicating that OPN supports binding of multiple αX I domains simultaneously and that the majority of the binding sites are located in the C-terminal portion of the protein. In support of this observation, rOPN-N displayed proportions of only ~ 1:1. HCM shared the low binding capacity of rOPN-N, also yielding proportions of ~1:1. While N(c) has the benefit of being directly measurable, it depends on the applied analyte concentration. In principle, the apparent stoichiometry can be calculated from RI and an experimentally determined RMax. However, it would require impractically high I domain concentrations of at least ~10−3 M to quantitatively saturate the weaker type of interactions as judged from the apparent mean KD value, bKDN, at ~10−4 M (Fig. 4). To explore if an analyte concentration-independent measurement can be derived using experimental quantifications of N(c), we considered measurements at identical analyte concentration for two ligands, N(c) and N′(c). The calculation assumes a similar distribution of KD values and hence similar bKDN. Both theoretical data [2] and past experimental studies [45] as well as data shown above (Fig. 4C, F, I, K) suggest that a simple 1:1 Langmuir binding equilibrium isotherm returns only small departures in absolute signal from the experimental data, at least for the part of the isotherm covering the applied concentration interval of I domain [45]. A 1:1 Langmuir binding equilibrium isotherm is consequently an acceptable approximation of DAnalyte(c) in this concentration interval. Using the 1:1 Langmuir binding equilibrium isotherm REq ðcÞ ¼

RMax  c bK D N þ c

ð3Þ

the ratio N(c)/N′(c) can consequently be written DAnalyte ðcÞ RMax  c 0 0 DLigand D Ligand bK D N þ c D Ligand RMax NðcÞ N ¼ ¼ ¼ 0  0  ¼ 0 N ðcÞ D Analyte ðcÞ DLigand R Max  c DLigand R0 Max N0 bK D N þ c D0 Ligand ðcÞ

ð4Þ

where N and N′ are the stoichiometries at binding saturating concentrations of analyte. As a test of the validity of this equation, calculations were made of N(c) for the surfaces with HCM, rOPN, rOPN-N, and rOPN-C at 10, 20, 40, 50 and 100 μM αX I domain, respectively. The N(c) values for HCM, rOPN, and rOPN-N were normalized against the value for rOPN, ≡ N′(c) (Fig. 5). In the concentration interval

Fig. 5. N(c)/N′(c) calculated for HCM, rOPN-N and rOPN-C. N(c) for HCM, rOPN-N and rOPN-C was normalized according to N(c) for rOPN [N′(c) in Eq. (4)] to give the values, N/N′, plotted as a function of analyte concentration. This ratio was analysed for analyte concentrations in the range of 10–100 μM. Error bars indicate the SD of at least two experiments.

10–100 μM the N(c)/N′(c) was essentially constant in clear agreement with Eq. (4). At concentrations b KDN ≫ c, i.e., below 10 μM, some departure from the N(c)/N′(c) calculated at higher concentrations was observed (data not showed). With less than ~10% of the binding sites occupied at these concentrations, it seems reasonable to propose that calculation of N(c) is relatively inaccurate and biased compared with higher saturation levels. In these calculations rOPN-C displayed a stoichiometry relative to full-length rOPN close to unity. By contrast, HCM and rOPN-N displayed a considerably lower relative stoichiometry, i.e., 1 ≫ N(c)/N′(c) (Fig. 5). In this way, the stoichiometric, rather than binding kinetic, properties of HCM and OPN provide a consistent correlate to the findings made in the cell adhesion studies (Fig. 3). This calculation also supports the point, that the C-terminal half of OPN provides nearly all of the binding sites for the αX I domain found in OPN. 4. Discussion Here, we characterize the interaction between integrin αXβ2 and human OPN in its phosphorylated and dephosphorylated states, with its N- and C-terminal domains. By comparison of these proteins with HCM, which share the presence of large, disordered regions with OPN, we rationalize that binding by αXβ2 is critically enabled by a sufficient density of ligand carboxylated side chains. The significance of the present study is found mainly in two aspects. First, we establish that human OPN is a ligand for membrane-expressed integrin αXβ2, while HCM is not. In SPR experiments these ligands bind the αX I domain with remarkably similar binding kinetics, but differ considerably in apparent binding stoichiometry. This is a type of ligand recognition unlike what has been reported for the highly similar αLβ2 and αMβ2 integrins and their ligands [18,22,49,50]. Nor is this type of recognition similar to what was reported for other integrins, which bind specific, non-repeated motifs in OPN. Second, we demonstrate that the adhesion of cells expressing αXβ2 to OPN-coated surfaces is independent of OPN phosphorylation. As a seemingly reasonably hypothesis from the relevant data available at the time [18,24], Schack et al. [25] speculated that the high negative charge carried by the phosphorylation played a part in the binding. Now, we show that not all types of negative charges are equal in constituting binding partners for integrin the αXβ2. By excluding phosphate groups as contributors to the αXβ2-mediated cell adhesion, this finding consequently shows a level of selectivity in the recognition by αXβ2 of negatively charged molecules. It has been suggested by others that cell adhesion molecules confined in the two-dimensional space of a cell membrane may support cell adhesion provided that a sufficient number of bonds are formed, even when the formal KD established in experiment with the ligands

E. Kläning et al. / Biochimica et Biophysica Acta 1854 (2015) 930–938

in solution suggest a low affinity [51]. As analysed by Piper et al. [52], the exact dependency on the affinity of interaction and the density of receptors and ligands is non-trivial and most likely requires a probabilistic formulation. Nevertheless, it is clear from their careful analysis, that ligand binding site density is an important factor in determining the likelihood of cell adhesion. In our study, the comparison of OPN and HCM as αXβ2 ligands further supports this proposal. On a technical note, one may observe that our cell adhesion studies included Mn2 + ions, which is a simple, widely used and well-established way of conformational activation of integrins for ligand binding. While this influence of Mn2+ involves the beta-chain I-like domain [53], we cannot exclude, however, the possibility that Mn2+ also bind in the αX I domain MIDAS. Evidence from the wild-type αL and αM I domains suggests that Mn2+ ions bind ~5–15 fold stronger than the physiologically relevant Mg2+ ions [50,54], but it is not clear if this alters in any way the ligand interaction by the I domain. As demonstrated by the lack of binding to HCM in these experiments compared to the robust binding to OPN, however, the Mn2+-activated αXβ2 integrins are capable of discriminating between ligands and non-ligands. Characterization of the interaction between the αX I domain and OPN was achieved by comparing the binding to non-overlapping OPN fragments in SPR. The αX I domain primarily interacts with the rOPNC as shown by the robust signals obtained. Previous reports have identified an overall polyanionic character to support strong binding to the αX I domain [18,24]. Therefore, it was surprising that rOPN-C presented more αX I domain binding sites than rOPN-N when the latter contains a higher frequency of negatively charged residues (Table 1). The binding kinetics of the interactions between the αX I domain and both OPN fragments were highly similar, hence excluding that a high-affinity binding site is present in the C-terminal fragment. Simple calculations showed that multiple αX I domains bound simultaneously, which also challenges the presence of a single, well-defined binding site in the Cterminal half of OPN. rOPN-N and rOPN-C were generated by thrombin cleavage of rOPN. One clear difference between rOPN-N and rOPN-C is their contents of aspartate and glutamate residues. rOPN-N has a higher number of aspartate residues, FAsp, than rOPN-C, while rOPN-C has a higher number of glutamate residues, FGlu, than rOPN-N. Hence, rOPN is split into an aspartate-rich fragment, rOPN-N, and a glutamate-rich fragment, rOPN-C, by thrombin cleavage (Table 4). It was recently suggested [22] that integrin I domains are brought into closer contact with neighbouring residues when the MIDAS chelates an aspartate side chain relative to the longer side chain of glutamate, which permits a type of contact only involving that side chain [22,55,56]. As found experimentally by Vorup-Jensen et al. [18] and supported further by quantum chemical calculations [39], the aspartate β-COOH is a poorer ligand than the γ-COOH of glutamate for chelation by the αX I domain MIDAS Mg2+ ion. Taken together, this suggests that the αX I domain may have a preference for glutamates under certain circumstances or are restricted to bind to the glutamate side chain when the neighbouring residues prevent chelation of aspartate residues.

Table 4 Contents of aspartate and glutamate residues in HCM and rOPNs used for SPR. The percentage and number of aspartatea,b and glutamatec,d residues in α-S1-casein, βcasein, κ-casein, rOPN, rOPN-N and rOPN-C are listed. The content of these residues in HCMe was calculated from the number of aspartate and glutamate residues the in α-, β-, and κ-caseins and fractional abundance in HCM. Protein

FAsp (%)a

NbAsp

FGlu (%)c

NdGlu

α-S1-casein β-casein κ-casein HCMe rOPN rOPN-N rOPN-C

1.8 2.8 1.9 ~2.5 15.4 18.8 11.6

3 6 3 – 48 31 17

11.8 6.6 4.9 ~6.8 8.7 6.7 11.0

20 14 8 – 27 11 16

937

5. Conclusion Integrin αXβ2 binds polyanionic species, including osteopontin. Understanding the interaction between OPN and αXβ2 helps elucidate the versatile nature of OPN as a ligand for integrins. Our study shows that integrin αXβ2 binds OPN in a way, which is fundamentally different, both in quantitative and structural terms compared with other integrins. We demonstrate that glutamate side chains are critical for binding to the αX I domain while aspartate side chains or phosphorylation are not. In this way, ligand recognition is selective towards the source of polyanionicity. With the central roles of αXβ2 in immunity, this supports the importance of OPN in the human leukocyte biology. Transparency document The Transparency document associated with this article can be found, in the online version. Acknowledgements We thank Dr. Huaying Zhao, National Inst. of Health, MD, for her expert advice on the analysis of SPR data. We also wish to thank Anne Marie Bundsgaard for carrying out SPR measurements and Bettina W. Grumsen for her excellent technical assistance with the cellular experiments. This work was supported grants from The Danish Council for Independent Research (ESS) and Aarhus University Research Foundation through the MEMBRANES Research Centre (TV-J). References [1] B. Christensen, M.S. Nielsen, K.F. Haselmann, T.E. Petersen, E.S. Sorensen, Posttranslationally modified residues of native human osteopontin are located in clusters: identification of 36 phosphorylation and five O-glycosylation sites and their biological implications, Biochem. J. 390 (2005) 285–292. [2] J. Svitel, A. Balbo, R.A. Mariuzza, N.R. Gonzales, P. Schuck, Combined affinity and rate constant distributions of ligand populations from experimental surface binding kinetics and equilibria, Biophys. J. 84 (2003) 4062–4077. [3] Gorshkova II, J. Svitel, F. Razjouyan, P. Schuck, Bayesian analysis of heterogeneity in the distribution of binding properties of immobilized surface sites, Langmuir 24 (2008) 11577–11586. [4] B. Bjellqvist, B. Basse, E. Olsen, J.E. Celis, Reference points for comparisons of two-dimensional maps of proteins from different human cell types defined in a pH scale where isoelectric points correlate with polypeptide compositions, Electrophoresis 15 (1994) 529–539. [5] B. Bjellqvist, G.J. Hughes, C. Pasquali, N. Paquet, F. Ravier, J.C. Sanchez, S. Frutiger, D. Hochstrasser, The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences, Electrophoresis 14 (1993) 1023–1031. [6] E. Gasteiger, C. Hoogland, A. Gattiker, M.R. Wilkins, R.D. Appel, A. Bairoch, Protein Identification and Analysis Tools on the ExPASy Server, Humana Press, 2005. [7] Q. Sheng, X. Fang, Bioactive Components in Milk and Dairy Products, Wiley-Blackwell, 2009. [8] B. Christensen, E. Klaning, M.S. Nielsen, M.H. Andersen, E.S. Sorensen, C-terminal modification of osteopontin inhibits interaction with the alphaVbeta3-integrin, J. Biol. Chem. 287 (2012) 3788–3797. [9] J.P. Metlay, M.D. Witmer-Pack, R. Agger, M.T. Crowley, D. Lawless, R.M. Steinman, The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies, J. Exp. Med. 171 (1990) 1753–1771. [10] S.M. Tan, The leucocyte beta2 (CD18) integrins: the structure, functional regulation and signalling properties, Biosci. Rep. 32 (2012) 241–269. [11] G.D. Ross, W. Reed, J.G. Dalzell, S.E. Becker, N. Hogg, Macrophage cytoskeleton association with CR3 and CR4 regulates receptor mobility and phagocytosis of iC3b-opsonized erythrocytes, J. Leukoc. Biol. 51 (1992) 109–117. [12] D.C. Bullard, X. Hu, J.E. Adams, T.R. Schoeb, S.R. Barnum, p150/95 (CD11c/CD18) expression is required for the development of experimental autoimmune encephalomyelitis, Am. J. Pathol. 170 (2007) 2001–2008. [13] K.J. Micklem, R.B. Sim, Isolation of complement-fragment-iC3b-binding proteins by affinity chromatography. The identification of p150,95 as an iC3b-binding protein, Biochem. J. 231 (1985) 233–236. [14] B.L. Myones, J.G. Dalzell, N. Hogg, G.D. Ross, Neutrophil and monocyte cell surface p150,95 has iC3b-receptor (CR4) activity resembling CR3, J. Clin. Invest. 82 (1988) 640–651. [15] X. Chen, Y. Yu, L.Z. Mi, T. Walz, T.A. Springer, Molecular basis for complement recognition by integrin alphaXbeta2, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 4586–4591. [16] T. Vorup-Jensen, C. Ostermeier, M. Shimaoka, U. Hommel, T.A. Springer, Structure and allosteric regulation of the alpha X beta 2 integrin I domain, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 1873–1878.

938

E. Kläning et al. / Biochimica et Biophysica Acta 1854 (2015) 930–938

[17] G.E. Davis, The Mac-1 and p150,95 beta 2 integrins bind denatured proteins to mediate leukocyte cell-substrate adhesion, Exp. Cell Res. 200 (1992) 242–252. [18] T. Vorup-Jensen, C.V. Carman, M. Shimaoka, P. Schuck, J. Svitel, T.A. Springer, Exposure of acidic residues as a danger signal for recognition of fibrinogen and other macromolecules by integrin alphaXbeta2, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 1614–1619. [19] C.P. Taborda, A. Casadevall, CR3 (CD11b/CD18) and CR4 (CD11c/CD18) are involved in complement-independent antibody-mediated phagocytosis of Cryptococcus neoformans, Immunity 16 (2002) 791–802. [20] T. Vorup-Jensen, On the roles of polyvalent binding in immune recognition: perspectives in the nanoscience of immunology and the immune response to nanomedicines, Adv. Drug Deliv. Rev. 64 (2012) 1759–1781. [21] T.A. Springer, Folding of the N-terminal, ligand-binding region of integrin alphasubunits into a beta-propeller domain, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 65–72. [22] G. Bajic, L. Yatime, R.B. Sim, T. Vorup-Jensen, G.R. Andersen, Structural insight on the recognition of surface-bound opsonins by the integrin I domain of complement receptor 3, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 16426–16431. [23] D.I. Beller, T.A. Springer, R.D. Schreiber, Anti-Mac-1 selectively inhibits the mouse and human type three complement receptor, J. Exp. Med. 156 (1982) 1000–1009. [24] T. Vorup-Jensen, L. Chi, L.C. Gjelstrup, U.B. Jensen, C.A. Jewett, C. Xie, M. Shimaoka, R.J. Linhardt, T.A. Springer, Binding between the integrin alphaXbeta2 (CD11c/ CD18) and heparin, J. Biol. Chem. 282 (2007) 30869–30877. [25] L. Schack, R. Stapulionis, B. Christensen, E. Kofod-Olsen, U.B. Skov Sorensen, T. Vorup-Jensen, E.S. Sorensen, P. Hollsberg, Osteopontin enhances phagocytosis through a novel osteopontin receptor, the alphaXbeta2 integrin, J. Immunol. 182 (2009) 6943–6950. [26] B. Christensen, C.C. Kazanecki, T.E. Petersen, S.R. Rittling, D.T. Denhardt, E.S. Sorensen, Cell type-specific post-translational modifications of mouse osteopontin are associated with different adhesive properties, J. Biol. Chem. 282 (2007) 19463–19472. [27] G. Platzer, A. Schedlbauer, A. Chemelli, P. Ozdowy, N. Coudevylle, R. Auer, G. Kontaxis, M. Hartl, A.J. Miles, B.A. Wallace, O. Glatter, K. Bister, R. Konrat, The metastasis-associated extracellular matrix protein osteopontin forms transient structure in ligand interaction sites, Biochemistry 50 (2011) 6113–6124. [28] J. Sodek, B. Ganss, M.D. McKee, Osteopontin, Crit. Rev. Oral Biol. Med. 11 (2000) 279–303. [29] H.A. Goldberg, G.K. Hunter, The inhibitory activity of osteopontin on hydroxyapatite formation in vitro, Ann. N. Y. Acad. Sci. 760 (1995) 305–308. [30] D.A. Pampena, K.A. Robertson, O. Litvinova, G. Lajoie, H.A. Goldberg, G.K. Hunter, Inhibition of hydroxyapatite formation by osteopontin phosphopeptides, Biochem. J. 378 (2004) 1083–1087. [31] A. Bellahcene, V. Castronovo, K.U. Ogbureke, L.W. Fisher, N.S. Fedarko, Small integrin-binding ligand N-linked glycoproteins (SIBLINGs): multifunctional proteins in cancer, Nat. Rev. Cancer 8 (2008) 212–226. [32] A.M. Craig, G.T. Bowden, A.F. Chambers, M.A. Spearman, A.H. Greenberg, J.A. Wright, M. McLeod, D.T. Denhardt, Secreted phosphoprotein mRNA is induced during multistage carcinogenesis in mouse skin and correlates with the metastatic potential of murine fibroblasts, Int. J. Cancer 46 (1990) 133–137. [33] S. Ashkar, G.F. Weber, V. Panoutsakopoulou, M.E. Sanchirico, M. Jansson, S. Zawaideh, S.R. Rittling, D.T. Denhardt, M.J. Glimcher, H. Cantor, Eta-1 (osteopontin): an early component of type-1 (cell-mediated) immunity, Science 287 (2000) 860–864. [34] T. Uede, Y. Katagiri, J. Iizuka, M. Murakami, Osteopontin, a coordinator of host defense system: a cytokine or an extracellular adhesive protein? Microbiol. Immunol. 41 (1997) 641–648. [35] D.F. Frenzel, J.M. Weiss, Osteopontin and allergic disease: pathophysiology and implications for diagnostics and therapy, Expert. Rev. Clin. Immunol. 7 (2010) 93–109. [36] Y. Yokosaki, K. Tanaka, F. Higashikawa, K. Yamashita, A. Eboshida, Distinct structural requirements for binding of the integrins alphavbeta6, alphavbeta3, alphavbeta5, alpha5beta1 and alpha9beta1 to osteopontin, Matrix Biol. 24 (2005) 418–427.

[37] S.T. Barry, S.B. Ludbrook, E. Murrison, C.M. Horgan, Analysis of the alpha4beta1 integrin-osteopontin interaction, Exp. Cell Res. 258 (2000) 342–351. [38] Y. Yokosaki, N. Matsuura, T. Sasaki, I. Murakami, H. Schneider, S. Higashiyama, Y. Saitoh, M. Yamakido, Y. Taooka, D. Sheppard, The integrin alpha(9)beta(1) binds to a novel recognition sequence (SVVYGLR) in the thrombin-cleaved aminoterminal fragment of osteopontin, J. Biol. Chem. 274 (1999) 36328–36334. [39] E. San Sebastian, J.M. Mercero, R.H. Stote, A. Dejaegere, F.P. Cossio, X. Lopez, On the affinity regulation of the metal-ion-dependent adhesion sites in integrins, J. Am. Chem. Soc. 128 (2006) 3554–3563. [40] A.J. Miles, S.V. Hoffmann, Y. Tao, R.W. Janes, B.A. Wallace, Synchrotron radiation circular dichroism (SRCD) spectroscopy: new beamlines and new applications in biology, Spectroscopy 21 (2007) 245–255. [41] A.J. Miles, R.W. Janes, A. Brown, D.T. Clarke, J.C. Sutherland, Y. Tao, B.A. Wallace, S.V. Hoffmann, Light flux density threshold at which protein denaturation is induced by synchrotron radiation circular dichroism beamlines, J. Synchrotron Radiat. 15 (2008) 420–422. [42] L. Whitmore, B.A. Wallace, Protein secondary structure analyses from circular dichroism spectroscopy: methods and reference databases, Biopolymers 89 (2008) 392–400. [43] L. Petruzzelli, L. Maduzia, T.A. Springer, Activation of lymphocyte functionassociated molecule-1 (CD11a/CD18) and Mac-1 (CD11b/CD18) mimicked by an antibody directed against CD18, J. Immunol. 155 (1995) 854–866. [44] M. Weetall, R. Hugo, C. Friedman, S. Maida, S. West, S. Wattanasin, R. Bouhel, G. Weitz-Schmidt, P. Lake, A homogeneous fluorometric assay for measuring cell adhesion to immobilized ligand using V-well microtiter plates, Anal. Biochem. 293 (2001) 277–287. [45] T. Vorup-Jensen, Surface plasmon resonance biosensing in studies of the binding between beta(2) integrin I domains and their ligands, Methods Mol. Biol. 757 (2012) 55–71. [46] I. Langmuir, The constitution and fundamental properties of solids and liquids. Part I. Solids, J. Am. Chem. Soc. 38 (1916) 2221–2295. [47] P. Schuck, H. Zhao, The role of mass transport limitation and surface heterogeneity in the biophysical characterization of macromolecular binding processes by SPR biosensing, Methods Mol. Biol. 627 (2010) 15–54. [48] E. Stenberg, B. Persson, H. Roos, C. Urbaniczky, Quantitative-determination of surface concentration of protein with surface-plasmon resonance using radiolabelled proteins, J. Colloid Interface Sci. 143 (1991) 513–526. [49] M. Shimaoka, T. Xiao, J.H. Liu, Y. Yang, Y. Dong, C.D. Jun, A. McCormack, R. Zhang, A. Joachimiak, J. Takagi, J.H. Wang, T.A. Springer, Structures of the alpha L I domain and its complex with ICAM-1 reveal a shape-shifting pathway for integrin regulation, Cell 112 (2003) 99–111. [50] T. Vorup-Jensen, T.T. Waldron, N. Astrof, M. Shimaoka, T.A. Springer, The connection between metal ion affinity and ligand affinity in integrin I domains, Biochim. Biophys. Acta 1774 (2007) 1148–1155. [51] M.L. Dustin, L.M. Ferguson, P.Y. Chan, T.A. Springer, D.E. Golan, Visualization of CD2 interaction with LFA-3 and determination of the two-dimensional dissociation constant for adhesion receptors in a contact area, J. Cell Biol. 132 (1996) 465–474. [52] J.W. Piper, R.A. Swerlick, C. Zhu, Determining force dependence of two-dimensional receptor-ligand binding affinity by centrifugation, Biophys. J. 74 (1998) 492–513. [53] J. Gailit, E. Ruoslahti, Regulation of the fibronectin receptor affinity by divalent cations, J. Biol. Chem. 263 (1988) 12927–12932. [54] E.T. Baldwin, R.W. Sarver, G.L. Bryant Jr., K.A. Curry, M.B. Fairbanks, B.C. Finzel, R.L. Garlick, R.L. Heinrikson, N.C. Horton, L.L. Kelley, A.M. Mildner, J.B. Moon, J.E. Mott, V.T. Mutchler, C.S. Tomich, K.D. Watenpaugh, V.H. Wiley, Cation binding to the integrin CD11b I domain and activation model assessment, Structure 6 (1998) 923–935. [55] J.O. Lee, P. Rieu, M.A. Arnaout, R. Liddington, Crystal structure of the A domain from the alpha subunit of integrin CR3 (CD11b/CD18), Cell 80 (1995) 631–638. [56] J.O. Lee, L.A. Bankston, M.A. Arnaout, R.C. Liddington, Two conformations of the integrin A-domain (I-domain): a pathway for activation? Structure 3 (1995) 1333–1340.