- Email: [email protected]
Multiple mitochondrial DNA deletions exist in cardiomyocytes of patients with hypertrophic or dilated cardiomyopathy
Vol.
170,
July
31,
No.
2, 1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS Pages
1990
Multiple
Mitochondrial DNA Deletions Exist in Cardiomyocytes with Hypertrophic or Dilated Cardiomyopathy
830-836
of Patients
Takayuki Ozawa, Masashi Tanaka, Satoru Sugiyama, Kazuki Hattori*, Takayuki Ito*, Kinji Ohno**, Akira Takahashi**, Wataru Satot, Goro Takadat, Bunji Mayumis, Kiichiro Yamamotog, Kyo Adachis, Yoshinori Koga§ and Hironori Toshimas Department of Biomedical Chemistry, *International Medicine and **Neurology, Faculty of Medicine, University of Nagoya, Nagoya 466,Japan ?Department of Pediatrics, Akita University School of Medicine, Akita 010, Japan SDepartment of Internal Medicine, Kurume University School of Medicine, Kurume 830, Japan Received
June
11,
1990
SUMMARY: Genetic impairment was revealed in idiopathic cardiomyopathy and the responsible DNA locus was estimated. Mitochondrial DNA were amplified from autopsied cardiac specimens from three patients who died from hypertrophic or dilated cardiomyopathy by using polymerase chain reaction (PCR). By using two novel methods for PCR gene amplification, the pleioplasmic existence of multiple populations of differently deleted mitochondrial DNA in all specimens from the patients was confirmed. Mitochondrial DNA with a 7,436 bp deletionwhich commonly existed among the specimens was sequenced and the direct repeat at each edge of deletion was identified as (CATCAACAACCG) which was located in ATPase 6 gene and in the D-loop region. From our results mitochondrial DNA mutations could also be an important contributory factor to cardiomyopathy. 01990 Academic Press, Inc.
Cumulating evidence (l-7) demonstrates that a number of neuromuscular diseases have structural abnormalities of mitochondria as their common feature and that these appear to be caused by mitochondrial DNA (mtDNA) mutations. These degenerative diseases could be classified into a novel clinical entity, mtDNA disease. Recent advances in the gene amplification technique using polymerase chain reaction (PCR) make it possible to survey mtDNA mutations among clinical specimens in small quantity.
We have identified (8-10)
defects in subunits of mitochondrial respiratory chain Complex I (NADH-ubiquinone oxidoreductase) by using Western blot analyses in two patients with hypertrophic cardiomyopathy associated with encephalomyopathy. Deleted mtDNA has been described in patients with chronic progressive external ophthalmoplegia (1) and Kearns-Sayre syndrome (11). Previously, we demonstrated multiple deletions of mtDNA in a patient with external ophthalmoplegia (12) by using PCR, and sequenced directly PCR amplified deleted mtDNA in myopathic patients (13). We proposed a hypothesis that accumulation of mtDNA mutations is an important contributor to several degenerative diseases (14). To examine the possible mtDNA mutation in some cases of cardiomyopathies and to exclude false conclusions resulting 0006-291X/90 $1.50 Copyright 0 I990 by Academic Press, All rights of reproduction in any form
Inc. reserved.
830
Vol.
170,
No.
2,
BIOCHEMICAL
1990
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
from misannealing of PCR primers, we have devised two novel PCR methods for the detection of mtDNA deletion and surveyed the autopsied cardiac tissues from five patients with cardiomyopathies and cardiac disorder of definite pathological diagnosis. MATERIALS
AND METHODS
Patients Cardiac tissue specimens were obtained from three patients (49 years old, female, 47 years old, male, and 53 years old, male) with hypertrophic or dilated cardiomyopathy of unknown etiology, from a patient with dilated cardiomyopathy after delivery (40 years old, female), from a patient who died from myocardial infarction (59 years old, male) and from a person who died in an accident as a normal control (41 years old, female), as listed in Table 1. Preparation of DNA The autopsied muscles (5 mg) were homogenized using a Physcotron Handy Micro Homogenizer (Niti-on, Tokyo) for 30 set, and were digested in 1 ml of 10 mM Tris-HCl, 0.1 M EDTA (pH 7.4) containing 0.1 mg/ml proteinase K and 0.5% SDS. DNA was extracted twice with equal volumes of phenol/chloroform/isoamyl alcohol (25:25:1), and once with chloroform/isoamyl alcohol (25: 1). DNA was precipitated with a one-fiftieth volume of 5 M NaCl and two volumes of ethanol at -80°C for 2 h, and rinsed with 70% ethanol. The precipitated DNA was recovered in 30 u.l of 10 mM Tris-HCl, 0.1 mM EDTA (pH 8.0). PCR amplification Southern blot analysis was performed as follows. DNA (100 ng) was digested wi.th 12 units of BumHI and PstI obtained from Toyobo, Osaka, Japan and separated electrophoretically on 0.6% agarose gels. Size standards employed were lambda phage DNA digested with Hind111 and phage Xl74 DNA digested with Hue111 from Nippon Gene, Toyama, Japan. DNA in the gels was denatured and transferred onto GeneScreenPlus membranes: from Du Pont-NEN. Hybridization was carried out as described previously (10). Southern blot analysis Primers for PCR were synthesized using a Shimadzu model NS-1 DNA synthesizer and an Applied Biosystems model 380B DNA synthesizer and purified on Oligonucleotide Purification Cartridges from Applied Biosystems. The base sequences of the oligonucleotides arc shown in Table 2. PCR amplification was carried out on 1 ul of the DNA
TABLE
Age / Sex
Patient
1. Characteristics of patients and control Clinical features
mtDNA Deletion*
(ye=) 1
YY
49/F
hypertrophic cardiomyopathy died of cardiac failure
+
2
KS
47/M
familial conduction block dilated cardiomyopathy died of cardiac failure
+
3
HO
53/M
hypertrophic cardiomyopathy died of cerebral infarction
+
4
TY
40/F
dilated cardiomyopathy of her third child died of cardiac failure
-
5
AI
59/M
died of myocardial
6
ES
41 IF
died in accident
831
after delivery
infarction
-
Vol.
170,
No.
2, 1990
BIOCHEMICAL
TABLE Primer*
AND
BIOPHYSICAL
RESEARCH
2. Synthesized primers used for PCR Complementary Site**
Sequence 5’ + 3’
L73 1 L853 L1167 L1641 H12 H38 H60 H884 H1189
COMMUNICATIONS
to to to to to to to to to
7,311 8,531 11,671 16,411 140
TTCATGATTTGAGAAGCCTT ACGAAAATCTGTTCGCTTCA AACCCCCTGAAGCTTCACCG CGTGAAATCAATATCCCGCA GAATCAAAGACAGATACTGC AAATTTGAAATCTGGTTAGG AAACATTTTCAGTGTATTGC TGCCCGCTCATAAGGGGATG GTTACTAGCACAGAGAGTTC
:z 8,860 11,910
7,330 8,550 11,690 16,430 121 381 601 8,841 11,891
*Primers L731, L853, L1167 and L1641 were used for amplification of the light strand of mtDNA. Primers H12, H38, H60, H884 and H1189 were used for amplification of the heavy strand of mtDNA. **Numbering of mtDNA is according to Anderson et al. (17). I\ma*e5 gene Y’
Cl2 8
3
4
‘3”
A
5
0
C
4-
2.4-
01
1 kbp o-
kbp I
02
12
3
12
3
12
3
FIG.. mtDNA fragments amplified by PCR from specimens obtained from patients with cardiomyopathy. From cardiac tissues obtained from autopsied patients, mtDNAs were extracted and amplified by PCR with a primer pair of L853 and H884 of an 8.4 kb distance (Table 2). In mtDNA fragments obtained from patients 1, 2, and 3 (lanes 1, 2, 3) with hypertrophic or dilated cardiomyopathy (Table l), multiple fragments shorter than an 8.4 kb fragment were detected, whereas there exists only the 8.4-kb fragment in specimen from the control (lane c), in that from a patient of cardiomyopathy after delivery (lane 4) or in that from a patient who died of cardiac infarction (lane 5). FIG. 2. Schematic presentation of the primer shift method and detection of multiple deletions in mtDNA from patients with cardiomyopathy. One pair of PCR primer of L731 and H60 will amplify a fragment A. Shift of a primer L73 1 to L853 amplify a fragment B. The difference in sizes between A and B should coincide with the distance (bp) at between L731 and L853, i.d. 1.2 kb. On the same principle, a shorter primer pair of L853 and H38 should produce a shorter fragment C. Hatched regions at each edge of the deletion are the direct repeats located at different genes. Column A: mtDNA fragments amplified using a PCR primer pair of L731 and H60. Column B: those by a primer pair of L853 and H60. Column C: those by a primer pair of L853 and H38. Coincident with the distance of 1.2 kb between L731 and L853, the mtDNA fragments in Column B are 1.2 kb shorter than those in Column A. mtDNA fragments in Column C are 0.2 kb shorter than those in Column B coincident with the distance between H60 and H38. Lanes 1, 2, and 3 represent the specimens obtained from patients 1, 2 and 3 in Table 1. A mtDNA fragment with 7.5 kb deletion was sequenced and the direct repeat was identified as (CATCAACAACCA).
832
Vol.
170, No. 2, 1990
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
solution (ca. 10 ng of total DNA) in a final volume of 100 pl which included 200 pM of each dNTP, 2.5 units of Taq DNA polymerase (AmpliTaq, Cetus) and PCR buffer (50 mM TrisHCl, pH 8.3, containing 50 mM KCl, 1.5 mM MgC12, and 0.01% gelatin) with 1 pM each of primers (12). The reactions were carried out for a total of 35 cycles, with the use of a PerkinElmer/Cetus Thermal Cycler. The cycle times were as follows: denaturation 15 set at 94-C; annealing, 15 set at 45’C; and primer extension, 80 set at 72’C. To sequence the crossover regions of the deleted mtDNA, a single-stranded DNA fragment containing the crossover was prepared by asymmetric PCR amplification and sequenced directly without cloning as reported previously (13). Primer shift PCR method To confirm the deletion in the mtDNA of these patients’ cardiomyccytes, we have devised a novel PCR method, the primer shift method, which excludes a false conclusion derived from a possible misannealing of PCR primers to mtDNA. The schematically presented principle of the method and the results are illustrated in Fig. 1. In principle, PCR amplifications of the same mtDNA with different primer pairs should produce different size of mtDNA fragments corresponding to the distance between the primers, if there is no misannealing of the primer(s). In our survey, amplified fragments from mtDNA of three patients w.ith idiopathic cardiomyopathy by using a primer pair, L731 and H60, are shown in column A in Fig. 2. The fragments amplified by using another primer pair, LB53 and H60, are shown in column B. PCR Southern method In order to confirm the deletion directly, we devised another novel method, the PCR Southern method,of which the schematically presented principle and the results are presented in Fig. 2. First, three kinds of mtDNA probes are prepared by PCR. A pair of the probes, A and C, are located at either end of a suspected deletion. Probe, B is located in the middle of the deletion. In a Southern blot analysis probes A and C will hybridize with abnormal fragments, but not probe B. In the case of mtDNA of patients with cardiomyopathy, a PCR amplified fragment from the normal mtDNA using a primer pair of LB53 and H884 is used as the probe A of 320 bp, that using L1167 and H1189 as the probe B of 240 bp, and that using L1641 and H12 as the probe C of 299 bp as shown Fig. 2. These probes A, B and C were tested with the PCR fragments using a primer pair, LB53 and H38, of an 8.4 kb distance.
RESULTS In Southern blot analyses, BamHI digested cardiomyocyte mtDNA from all specimens showed only a single band of 16.6-kb fragment produced from the normal-sized mtDNA. When PstI was used as the restriction enzyme, only two bands of 14.5-kb and 2.1-kb fragments derived also from the normal-sized mtDNA were observed. Namely, no abnormal fragments, could be detected by the conventional Southern blot analyses in the patients’ cardiomyocytes. However, by PCR amplification of mtDNA with a primer pair, LB53 and H884, of 8.4-kb distance, multiple abnormal bands including a 1-kb fragment could be detected in patients 1, 2 and 3, but neither in patients 4 and 5 nor in the control except an 8.4kb fragment derived from the normal-sized mtDNA, as shown in Fig. 3. These results suggest that pleioplasmic multiple deletions up to 7.4-kb exist in mtDNA of cardiomyocytes in patients with idiopathic cardiomyopathy. As shown in Fig. 1, coincident with the distance 1.2-kb between L731 and LB53 of, a major fragment of 2.4 kb in A is shifted to 1.2 kb. By using the other primer pair, LB53 and H38, of 0.2-kb shorter than the pair in B, 1.2 kb fragment is shifted to 1.0 kb as shown in column C. These results clearly indicate that the PCR amplified abnormal fragments in Fig. 3 are not the products of misannealing of PCR primer(s) to mtDNA, but that the fragments derived from real deletions of mtDNA. 833
Vol.
170,
No.
2,
1990
BIOCHEMICAL
A
AND
BIOPHYSICAL
B
RESEARCH
COMMUNICATIONS
C
FIG. 3. Schematic presentation of the PCR Southern method and confirmation of the deletions in mtDNA from patients with cardiomyopathy. A set of three probes, A, B and C, was prepared by PCR from the normal mtDNA. A and C are located in either end of the suspected deletion and B is in the middle. From a specimen mtDNA fragments are amplified by PCR with a primer pair of L and H. If the specimen contains mutant mtDNA with a deletion beside the normal mtDNA, the probes A and C will hybridize with the full length mtDNA fragment between a primer pair of L and H and a shorter fragment derived from the deletion, but the probe B will hybridize with only the full length fragment. mtDNA fragments in specimens from the control (c) and idiopathic cardiomyopathy patient 1, 2 and 3 (Table 1) are amplified by PCR with a primer pair of L853 and H38, of an 8.4 kb distance. Probes A (320 bp), B (240 bp) and C (299 bp) are prepared from the normal mtDNA by PCR with a primer pair of L853 and H884, that of L1167 and H1189 and that of L1641 and H12, respectively. Probes A and C hybridize with multiple shorter bands beside an 8.4 kb fragment, whereas probe B hybridizes only with an 8.4 kb fragment.
As shown in Fig. 2, both probes A and C hybridize with several deleted mtDNA fragments beside the normal 8.4-kb fragment. Probe B hybridize only with the 8.4-kb fragment. These results clearly demonstrate that the probe B region is really deleted in these mtDNAs in patients with cardiomyopathy. It was noted that one mtDNA with 7.5 kb deletion exists commonly among the specimens. Thus, we amplified this mtDNA fragment with PCR and sequenced directly. The direct repeats of this fragment schematically presented in Fig. 2 were identified as (CATCAACAACCG)-
located in ATPase 6 gene and that located in D-loop region of mtDNA.
DISCUSSION Apart from the minor contribution of anaerobic glycolysis, mitochondria exclusively produce adenosine triphosphate, and mitochondrial function is closely related to maintenance of cellular integrity. Several subunits of mitochondrial electron transport chain are biosynthesized from the information of mtDNA. It is well known that incidence of mtDNA mutation is higher than that of nuclear DNA mutation. Hence, it is expected that not nuclear DNA mutation but 834
Vol.
170,
No.
2, 1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
mtDNA mutation is a responsible factor of mitochondrial dysfunction derived from genetic impairment. Recently, the relationship between mtDNA mutation and the etiology of disease has been emphasized, and a clinical entity based on mtDNA mutation has attracted much interest. In this communication, we demonstrated pleioplasmic multiple deletions in mtDNA in cardiomyocytes in patients with hypertrophic or dilated cardiomyopathy. Especially, mtDNA with 7.5 kb #deletioncommonly existed among specimens from the cardiomyopathies and could relate closely to their etiology.
In contrast, mtDNA deletions were found neither in the
specimen of cardiomyopathy associated with delivery nor in that of myocardial infarction. Because the Southern blot analysis usually could not detect mutated mtDNA of which the population is below 10% of the total, the population of the mutant mtDNA in these specimens is supposed. to be below 10%. Since the survey reported here using PCR amplification of mtDNA reqires only a few mg of cardiomyocytes, genetic diagnosis of cardiomyopathy of this entity could be performed by using a biopsied specimen from the suspected patient. The novel PCR methods reported here will help to avoid a false conclusion resulted from PCR artifacts. These methodology will allow us to diagnose the diseases on the basis of molecular biology. The gene responsible for familiar hypertrophic cardiomyopathy is recently reported (15) to be located on chromosome 14. X-linked cardiomyopathy is also reported (16). Thus, it could be concluded that either mtDNA mutation or nuclear DNA mutation might be a contributory factor to the genesis of cardiomyopathy.
Advances in genetic biology including
our results present a serious challenge to traditional pathologic and etiologic classifications of cardiomyopathy.
ACKNOWLEDGMENT This work was supported by the Grants-in-Aid for Scientific Research on Priority Areas (Bioenergetics, 01617002) to T. 0. from the Ministry of Education, Science and Culture of Japan. REFERENCES 1. 2. 3. 4. 5. 6. 7. 8.
Ozawa, T., Yoneda, M., Tanaka, M., Ohno, K., Sato, W., Suzuki, H., Nishikimi, M., Yamamoto, M., Nonaka, I., and Horai, S. (1988) B&hem. Biophys. Res. Commun. 154, 1240-1247. Wallace, D.C., Singh, G., Lott, M.T., Hodge, J.A., Schurr, T.G., Lezza, A.M.S., Elsas, II L.J., and Nikoskelainen, E.K. (1988) Science 242, 1427-1430. Halt,, I.J., Harding, A.E., and Morgan-Hughes, J.A. (1988) Nature 331, 717-719. Schon, E.A., Rizzuto, R., Moraes, C.T., Nakase, H., Zeviani, M., and DiMauro, S. (1989) Science 244,346-349. Zeviani, M., Servidei, S., Gellera, C., Bertini, E., DiMauro, S., and DiDonato, S. (1989) Nature 339,309-311. Wallace, D.C. (1989) Trends Genet. 5,9-13. Holt, I.J., Harding, A.E., and Morgan-Hughes, J.A. (1989) Nucl. Acids Res. 47, 4465-4469. Tanaka, M., Nishikimi, M., Suzuki, H., Ozawa, T., Nishizawa, M., Tanaka, K., and Miyatake, T. (1986) Biochem. Biophys. Res. Commun. 140, 88-93. 835
Vol.
170,
9. 10. 11. 12. 13. 14. 15. 16. 17.
No.
2,
1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
Yoneda, M., Tanaka, M., Nishikimi, M., Suzuki, H., Tanaka, K., Nishizawa, M., Atsumi, T., Ohama, E., Horai, S., Ikuta, F., Miyatake, T., and Ozawa, T. (1989) J.Neurol. Sci. 92, 143-158. Ichiki, T., Tanaka, M., Kobayashi, M., Sugiyama, N., Suzuki, H., Nishikimi, M., Ohnishi, T., Nonaka, I., Wada, Y., and Ozawa, T. (1989) Pediafr. Res. 25, 194-201 Lestienne, P., and Ponsot, G. (1988) Lancer i, 885. Sato, W., Tanaka, M., Ohno, K., Yamamoto, T., Takada, G., and Ozawa, T. (1989) Biochem. Biophys. Res. Commun. 162, 664-672. Tanaka, M., Sato, W., Ohno, K., Yamamoto, T., and Ozawa, T. (1989) Biochem. Biophys. Res. Commun. 164, 156-163. Linnane, A.W., Marzuki, S., Ozawa, T., and Tanaka, M. (1989) Lancer i, 642-645. Jarcho, J.A., McKenna, W., Pare, J.A.P., Solomon, S.D., Holcombe, R.F., Dickie, S., Levi, T., Donis-Keller, H., Seidman, J.G., and Seidman, C.E. (1989) N. Engl. J. Med. 321, 1372-1378. Berko, B.A., and Swift, M. (1987) N. Engl. J. Med. 316, 1186-1191. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H.L., Coulson, A.R., Drouin, J., Eperson, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J.H., Staden, R., and Young, I.G. (1981) Nature 290,457-465.
836
170,
July
31,
No.
2, 1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS Pages
1990
Multiple
Mitochondrial DNA Deletions Exist in Cardiomyocytes with Hypertrophic or Dilated Cardiomyopathy
830-836
of Patients
Takayuki Ozawa, Masashi Tanaka, Satoru Sugiyama, Kazuki Hattori*, Takayuki Ito*, Kinji Ohno**, Akira Takahashi**, Wataru Satot, Goro Takadat, Bunji Mayumis, Kiichiro Yamamotog, Kyo Adachis, Yoshinori Koga§ and Hironori Toshimas Department of Biomedical Chemistry, *International Medicine and **Neurology, Faculty of Medicine, University of Nagoya, Nagoya 466,Japan ?Department of Pediatrics, Akita University School of Medicine, Akita 010, Japan SDepartment of Internal Medicine, Kurume University School of Medicine, Kurume 830, Japan Received
June
11,
1990
SUMMARY: Genetic impairment was revealed in idiopathic cardiomyopathy and the responsible DNA locus was estimated. Mitochondrial DNA were amplified from autopsied cardiac specimens from three patients who died from hypertrophic or dilated cardiomyopathy by using polymerase chain reaction (PCR). By using two novel methods for PCR gene amplification, the pleioplasmic existence of multiple populations of differently deleted mitochondrial DNA in all specimens from the patients was confirmed. Mitochondrial DNA with a 7,436 bp deletionwhich commonly existed among the specimens was sequenced and the direct repeat at each edge of deletion was identified as (CATCAACAACCG) which was located in ATPase 6 gene and in the D-loop region. From our results mitochondrial DNA mutations could also be an important contributory factor to cardiomyopathy. 01990 Academic Press, Inc.
Cumulating evidence (l-7) demonstrates that a number of neuromuscular diseases have structural abnormalities of mitochondria as their common feature and that these appear to be caused by mitochondrial DNA (mtDNA) mutations. These degenerative diseases could be classified into a novel clinical entity, mtDNA disease. Recent advances in the gene amplification technique using polymerase chain reaction (PCR) make it possible to survey mtDNA mutations among clinical specimens in small quantity.
We have identified (8-10)
defects in subunits of mitochondrial respiratory chain Complex I (NADH-ubiquinone oxidoreductase) by using Western blot analyses in two patients with hypertrophic cardiomyopathy associated with encephalomyopathy. Deleted mtDNA has been described in patients with chronic progressive external ophthalmoplegia (1) and Kearns-Sayre syndrome (11). Previously, we demonstrated multiple deletions of mtDNA in a patient with external ophthalmoplegia (12) by using PCR, and sequenced directly PCR amplified deleted mtDNA in myopathic patients (13). We proposed a hypothesis that accumulation of mtDNA mutations is an important contributor to several degenerative diseases (14). To examine the possible mtDNA mutation in some cases of cardiomyopathies and to exclude false conclusions resulting 0006-291X/90 $1.50 Copyright 0 I990 by Academic Press, All rights of reproduction in any form
Inc. reserved.
830
Vol.
170,
No.
2,
BIOCHEMICAL
1990
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
from misannealing of PCR primers, we have devised two novel PCR methods for the detection of mtDNA deletion and surveyed the autopsied cardiac tissues from five patients with cardiomyopathies and cardiac disorder of definite pathological diagnosis. MATERIALS
AND METHODS
Patients Cardiac tissue specimens were obtained from three patients (49 years old, female, 47 years old, male, and 53 years old, male) with hypertrophic or dilated cardiomyopathy of unknown etiology, from a patient with dilated cardiomyopathy after delivery (40 years old, female), from a patient who died from myocardial infarction (59 years old, male) and from a person who died in an accident as a normal control (41 years old, female), as listed in Table 1. Preparation of DNA The autopsied muscles (5 mg) were homogenized using a Physcotron Handy Micro Homogenizer (Niti-on, Tokyo) for 30 set, and were digested in 1 ml of 10 mM Tris-HCl, 0.1 M EDTA (pH 7.4) containing 0.1 mg/ml proteinase K and 0.5% SDS. DNA was extracted twice with equal volumes of phenol/chloroform/isoamyl alcohol (25:25:1), and once with chloroform/isoamyl alcohol (25: 1). DNA was precipitated with a one-fiftieth volume of 5 M NaCl and two volumes of ethanol at -80°C for 2 h, and rinsed with 70% ethanol. The precipitated DNA was recovered in 30 u.l of 10 mM Tris-HCl, 0.1 mM EDTA (pH 8.0). PCR amplification Southern blot analysis was performed as follows. DNA (100 ng) was digested wi.th 12 units of BumHI and PstI obtained from Toyobo, Osaka, Japan and separated electrophoretically on 0.6% agarose gels. Size standards employed were lambda phage DNA digested with Hind111 and phage Xl74 DNA digested with Hue111 from Nippon Gene, Toyama, Japan. DNA in the gels was denatured and transferred onto GeneScreenPlus membranes: from Du Pont-NEN. Hybridization was carried out as described previously (10). Southern blot analysis Primers for PCR were synthesized using a Shimadzu model NS-1 DNA synthesizer and an Applied Biosystems model 380B DNA synthesizer and purified on Oligonucleotide Purification Cartridges from Applied Biosystems. The base sequences of the oligonucleotides arc shown in Table 2. PCR amplification was carried out on 1 ul of the DNA
TABLE
Age / Sex
Patient
1. Characteristics of patients and control Clinical features
mtDNA Deletion*
(ye=) 1
YY
49/F
hypertrophic cardiomyopathy died of cardiac failure
+
2
KS
47/M
familial conduction block dilated cardiomyopathy died of cardiac failure
+
3
HO
53/M
hypertrophic cardiomyopathy died of cerebral infarction
+
4
TY
40/F
dilated cardiomyopathy of her third child died of cardiac failure
-
5
AI
59/M
died of myocardial
6
ES
41 IF
died in accident
831
after delivery
infarction
-
Vol.
170,
No.
2, 1990
BIOCHEMICAL
TABLE Primer*
AND
BIOPHYSICAL
RESEARCH
2. Synthesized primers used for PCR Complementary Site**
Sequence 5’ + 3’
L73 1 L853 L1167 L1641 H12 H38 H60 H884 H1189
COMMUNICATIONS
to to to to to to to to to
7,311 8,531 11,671 16,411 140
TTCATGATTTGAGAAGCCTT ACGAAAATCTGTTCGCTTCA AACCCCCTGAAGCTTCACCG CGTGAAATCAATATCCCGCA GAATCAAAGACAGATACTGC AAATTTGAAATCTGGTTAGG AAACATTTTCAGTGTATTGC TGCCCGCTCATAAGGGGATG GTTACTAGCACAGAGAGTTC
:z 8,860 11,910
7,330 8,550 11,690 16,430 121 381 601 8,841 11,891
*Primers L731, L853, L1167 and L1641 were used for amplification of the light strand of mtDNA. Primers H12, H38, H60, H884 and H1189 were used for amplification of the heavy strand of mtDNA. **Numbering of mtDNA is according to Anderson et al. (17). I\ma*e5 gene Y’
Cl2 8
3
4
‘3”
A
5
0
C
4-
2.4-
01
1 kbp o-
kbp I
02
12
3
12
3
12
3
FIG.. mtDNA fragments amplified by PCR from specimens obtained from patients with cardiomyopathy. From cardiac tissues obtained from autopsied patients, mtDNAs were extracted and amplified by PCR with a primer pair of L853 and H884 of an 8.4 kb distance (Table 2). In mtDNA fragments obtained from patients 1, 2, and 3 (lanes 1, 2, 3) with hypertrophic or dilated cardiomyopathy (Table l), multiple fragments shorter than an 8.4 kb fragment were detected, whereas there exists only the 8.4-kb fragment in specimen from the control (lane c), in that from a patient of cardiomyopathy after delivery (lane 4) or in that from a patient who died of cardiac infarction (lane 5). FIG. 2. Schematic presentation of the primer shift method and detection of multiple deletions in mtDNA from patients with cardiomyopathy. One pair of PCR primer of L731 and H60 will amplify a fragment A. Shift of a primer L73 1 to L853 amplify a fragment B. The difference in sizes between A and B should coincide with the distance (bp) at between L731 and L853, i.d. 1.2 kb. On the same principle, a shorter primer pair of L853 and H38 should produce a shorter fragment C. Hatched regions at each edge of the deletion are the direct repeats located at different genes. Column A: mtDNA fragments amplified using a PCR primer pair of L731 and H60. Column B: those by a primer pair of L853 and H60. Column C: those by a primer pair of L853 and H38. Coincident with the distance of 1.2 kb between L731 and L853, the mtDNA fragments in Column B are 1.2 kb shorter than those in Column A. mtDNA fragments in Column C are 0.2 kb shorter than those in Column B coincident with the distance between H60 and H38. Lanes 1, 2, and 3 represent the specimens obtained from patients 1, 2 and 3 in Table 1. A mtDNA fragment with 7.5 kb deletion was sequenced and the direct repeat was identified as (CATCAACAACCA).
832
Vol.
170, No. 2, 1990
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
solution (ca. 10 ng of total DNA) in a final volume of 100 pl which included 200 pM of each dNTP, 2.5 units of Taq DNA polymerase (AmpliTaq, Cetus) and PCR buffer (50 mM TrisHCl, pH 8.3, containing 50 mM KCl, 1.5 mM MgC12, and 0.01% gelatin) with 1 pM each of primers (12). The reactions were carried out for a total of 35 cycles, with the use of a PerkinElmer/Cetus Thermal Cycler. The cycle times were as follows: denaturation 15 set at 94-C; annealing, 15 set at 45’C; and primer extension, 80 set at 72’C. To sequence the crossover regions of the deleted mtDNA, a single-stranded DNA fragment containing the crossover was prepared by asymmetric PCR amplification and sequenced directly without cloning as reported previously (13). Primer shift PCR method To confirm the deletion in the mtDNA of these patients’ cardiomyccytes, we have devised a novel PCR method, the primer shift method, which excludes a false conclusion derived from a possible misannealing of PCR primers to mtDNA. The schematically presented principle of the method and the results are illustrated in Fig. 1. In principle, PCR amplifications of the same mtDNA with different primer pairs should produce different size of mtDNA fragments corresponding to the distance between the primers, if there is no misannealing of the primer(s). In our survey, amplified fragments from mtDNA of three patients w.ith idiopathic cardiomyopathy by using a primer pair, L731 and H60, are shown in column A in Fig. 2. The fragments amplified by using another primer pair, LB53 and H60, are shown in column B. PCR Southern method In order to confirm the deletion directly, we devised another novel method, the PCR Southern method,of which the schematically presented principle and the results are presented in Fig. 2. First, three kinds of mtDNA probes are prepared by PCR. A pair of the probes, A and C, are located at either end of a suspected deletion. Probe, B is located in the middle of the deletion. In a Southern blot analysis probes A and C will hybridize with abnormal fragments, but not probe B. In the case of mtDNA of patients with cardiomyopathy, a PCR amplified fragment from the normal mtDNA using a primer pair of LB53 and H884 is used as the probe A of 320 bp, that using L1167 and H1189 as the probe B of 240 bp, and that using L1641 and H12 as the probe C of 299 bp as shown Fig. 2. These probes A, B and C were tested with the PCR fragments using a primer pair, LB53 and H38, of an 8.4 kb distance.
RESULTS In Southern blot analyses, BamHI digested cardiomyocyte mtDNA from all specimens showed only a single band of 16.6-kb fragment produced from the normal-sized mtDNA. When PstI was used as the restriction enzyme, only two bands of 14.5-kb and 2.1-kb fragments derived also from the normal-sized mtDNA were observed. Namely, no abnormal fragments, could be detected by the conventional Southern blot analyses in the patients’ cardiomyocytes. However, by PCR amplification of mtDNA with a primer pair, LB53 and H884, of 8.4-kb distance, multiple abnormal bands including a 1-kb fragment could be detected in patients 1, 2 and 3, but neither in patients 4 and 5 nor in the control except an 8.4kb fragment derived from the normal-sized mtDNA, as shown in Fig. 3. These results suggest that pleioplasmic multiple deletions up to 7.4-kb exist in mtDNA of cardiomyocytes in patients with idiopathic cardiomyopathy. As shown in Fig. 1, coincident with the distance 1.2-kb between L731 and LB53 of, a major fragment of 2.4 kb in A is shifted to 1.2 kb. By using the other primer pair, LB53 and H38, of 0.2-kb shorter than the pair in B, 1.2 kb fragment is shifted to 1.0 kb as shown in column C. These results clearly indicate that the PCR amplified abnormal fragments in Fig. 3 are not the products of misannealing of PCR primer(s) to mtDNA, but that the fragments derived from real deletions of mtDNA. 833
Vol.
170,
No.
2,
1990
BIOCHEMICAL
A
AND
BIOPHYSICAL
B
RESEARCH
COMMUNICATIONS
C
FIG. 3. Schematic presentation of the PCR Southern method and confirmation of the deletions in mtDNA from patients with cardiomyopathy. A set of three probes, A, B and C, was prepared by PCR from the normal mtDNA. A and C are located in either end of the suspected deletion and B is in the middle. From a specimen mtDNA fragments are amplified by PCR with a primer pair of L and H. If the specimen contains mutant mtDNA with a deletion beside the normal mtDNA, the probes A and C will hybridize with the full length mtDNA fragment between a primer pair of L and H and a shorter fragment derived from the deletion, but the probe B will hybridize with only the full length fragment. mtDNA fragments in specimens from the control (c) and idiopathic cardiomyopathy patient 1, 2 and 3 (Table 1) are amplified by PCR with a primer pair of L853 and H38, of an 8.4 kb distance. Probes A (320 bp), B (240 bp) and C (299 bp) are prepared from the normal mtDNA by PCR with a primer pair of L853 and H884, that of L1167 and H1189 and that of L1641 and H12, respectively. Probes A and C hybridize with multiple shorter bands beside an 8.4 kb fragment, whereas probe B hybridizes only with an 8.4 kb fragment.
As shown in Fig. 2, both probes A and C hybridize with several deleted mtDNA fragments beside the normal 8.4-kb fragment. Probe B hybridize only with the 8.4-kb fragment. These results clearly demonstrate that the probe B region is really deleted in these mtDNAs in patients with cardiomyopathy. It was noted that one mtDNA with 7.5 kb deletion exists commonly among the specimens. Thus, we amplified this mtDNA fragment with PCR and sequenced directly. The direct repeats of this fragment schematically presented in Fig. 2 were identified as (CATCAACAACCG)-
located in ATPase 6 gene and that located in D-loop region of mtDNA.
DISCUSSION Apart from the minor contribution of anaerobic glycolysis, mitochondria exclusively produce adenosine triphosphate, and mitochondrial function is closely related to maintenance of cellular integrity. Several subunits of mitochondrial electron transport chain are biosynthesized from the information of mtDNA. It is well known that incidence of mtDNA mutation is higher than that of nuclear DNA mutation. Hence, it is expected that not nuclear DNA mutation but 834
Vol.
170,
No.
2, 1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
mtDNA mutation is a responsible factor of mitochondrial dysfunction derived from genetic impairment. Recently, the relationship between mtDNA mutation and the etiology of disease has been emphasized, and a clinical entity based on mtDNA mutation has attracted much interest. In this communication, we demonstrated pleioplasmic multiple deletions in mtDNA in cardiomyocytes in patients with hypertrophic or dilated cardiomyopathy. Especially, mtDNA with 7.5 kb #deletioncommonly existed among specimens from the cardiomyopathies and could relate closely to their etiology.
In contrast, mtDNA deletions were found neither in the
specimen of cardiomyopathy associated with delivery nor in that of myocardial infarction. Because the Southern blot analysis usually could not detect mutated mtDNA of which the population is below 10% of the total, the population of the mutant mtDNA in these specimens is supposed. to be below 10%. Since the survey reported here using PCR amplification of mtDNA reqires only a few mg of cardiomyocytes, genetic diagnosis of cardiomyopathy of this entity could be performed by using a biopsied specimen from the suspected patient. The novel PCR methods reported here will help to avoid a false conclusion resulted from PCR artifacts. These methodology will allow us to diagnose the diseases on the basis of molecular biology. The gene responsible for familiar hypertrophic cardiomyopathy is recently reported (15) to be located on chromosome 14. X-linked cardiomyopathy is also reported (16). Thus, it could be concluded that either mtDNA mutation or nuclear DNA mutation might be a contributory factor to the genesis of cardiomyopathy.
Advances in genetic biology including
our results present a serious challenge to traditional pathologic and etiologic classifications of cardiomyopathy.
ACKNOWLEDGMENT This work was supported by the Grants-in-Aid for Scientific Research on Priority Areas (Bioenergetics, 01617002) to T. 0. from the Ministry of Education, Science and Culture of Japan. REFERENCES 1. 2. 3. 4. 5. 6. 7. 8.
Ozawa, T., Yoneda, M., Tanaka, M., Ohno, K., Sato, W., Suzuki, H., Nishikimi, M., Yamamoto, M., Nonaka, I., and Horai, S. (1988) B&hem. Biophys. Res. Commun. 154, 1240-1247. Wallace, D.C., Singh, G., Lott, M.T., Hodge, J.A., Schurr, T.G., Lezza, A.M.S., Elsas, II L.J., and Nikoskelainen, E.K. (1988) Science 242, 1427-1430. Halt,, I.J., Harding, A.E., and Morgan-Hughes, J.A. (1988) Nature 331, 717-719. Schon, E.A., Rizzuto, R., Moraes, C.T., Nakase, H., Zeviani, M., and DiMauro, S. (1989) Science 244,346-349. Zeviani, M., Servidei, S., Gellera, C., Bertini, E., DiMauro, S., and DiDonato, S. (1989) Nature 339,309-311. Wallace, D.C. (1989) Trends Genet. 5,9-13. Holt, I.J., Harding, A.E., and Morgan-Hughes, J.A. (1989) Nucl. Acids Res. 47, 4465-4469. Tanaka, M., Nishikimi, M., Suzuki, H., Ozawa, T., Nishizawa, M., Tanaka, K., and Miyatake, T. (1986) Biochem. Biophys. Res. Commun. 140, 88-93. 835
Vol.
170,
9. 10. 11. 12. 13. 14. 15. 16. 17.
No.
2,
1990
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
Yoneda, M., Tanaka, M., Nishikimi, M., Suzuki, H., Tanaka, K., Nishizawa, M., Atsumi, T., Ohama, E., Horai, S., Ikuta, F., Miyatake, T., and Ozawa, T. (1989) J.Neurol. Sci. 92, 143-158. Ichiki, T., Tanaka, M., Kobayashi, M., Sugiyama, N., Suzuki, H., Nishikimi, M., Ohnishi, T., Nonaka, I., Wada, Y., and Ozawa, T. (1989) Pediafr. Res. 25, 194-201 Lestienne, P., and Ponsot, G. (1988) Lancer i, 885. Sato, W., Tanaka, M., Ohno, K., Yamamoto, T., Takada, G., and Ozawa, T. (1989) Biochem. Biophys. Res. Commun. 162, 664-672. Tanaka, M., Sato, W., Ohno, K., Yamamoto, T., and Ozawa, T. (1989) Biochem. Biophys. Res. Commun. 164, 156-163. Linnane, A.W., Marzuki, S., Ozawa, T., and Tanaka, M. (1989) Lancer i, 642-645. Jarcho, J.A., McKenna, W., Pare, J.A.P., Solomon, S.D., Holcombe, R.F., Dickie, S., Levi, T., Donis-Keller, H., Seidman, J.G., and Seidman, C.E. (1989) N. Engl. J. Med. 321, 1372-1378. Berko, B.A., and Swift, M. (1987) N. Engl. J. Med. 316, 1186-1191. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H.L., Coulson, A.R., Drouin, J., Eperson, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J.H., Staden, R., and Young, I.G. (1981) Nature 290,457-465.
836