Multiple sclerosis: the frequency of allelic forms of tumor necrosis factor and lymphotoxin-alpha

Journal of Neuroimmunology 84 Ž1998. 198–206

Multiple sclerosis: the frequency of allelic forms of tumor necrosis factor and lymphotoxin-alpha M. Mycko a , W. Kowalski b, M. Kwinkowski a , A.C. Buenafe c , B. Szymanska a , E. Tronczynska a , A. Plucienniczak b, K. Selmaj a,) a

b

Department of Neurology, Medical Academy of Lodz, Lodz, Poland Institute of Microbiology and Virology, Polish Academy of Sciences, Lodz, Poland c Department of Neurology, Oregon Health Sciences UniÕersity, Portland, USA

Received 7 August 1997; received in revised form 6 October 1997; accepted 28 November 1997

Abstract The cytokines LTa and TNF have been implicated as major mediators of tissue injury in multiple sclerosis ŽMS.. In this study we have assessed the frequency of specific polymorphisms for these genes in MS Ž n s 53. and controls Ž n s 81. using a highly sensitive, two stage nested polymerase chain reaction ŽPCR., with the second stage using mutation-specific primers. Genomic DNA was extracted from blood cells and the results confirmed by direct dideoxy chain termination sequencing. The frequency of the y308 G to A mutation in the TNF promoter region in normal controls was 15% and in MS was 24%. For LTa gene the exon 3 polymorphism allele A was detected in 36% of controls and 34% of the MS patients. In MS, the combined genotype TNF G q A and LTa C q C was present 6 times more frequently Ž12%. than in controls Ž2%., and patients with this genotype showed the highest EDSS scores. We found the TNF and LTa polymorphisms to occur independently from the HLA class II DR2 allele distribution in MS. Whilst the G y A polymorphism in TNF gene promoter has been studied previously in MS, with conflicting results, this is the first study that has addressed the exon 3 polymorphism in LTa in MS. The results indicate that this polymorphism is not linked with the higher genetic predisposition for MS, but that combined TNF G q A and LTa C q C genotype might contribute to development of the disease. q 1998 Elsevier Science B.V. Keywords: TNF; LTa; Genetic susceptibility; Genetic polymorphism; MS

1. Introduction The pathogenesis of multiple sclerosis ŽMS. remains unknown. However the majority of the data have favoured an autoimmune hypothesis in MS ŽHafler and Weiner, 1989.. Cytokines, the molecules taking part in regulation of immunological system activity, have been closely studied in MS and its animal model experimental autoimmunological encephalomyelitis ŽEAE. ŽLiblau et al., 1995.. The proinflammatory cytokines are the most implicated—especially, the closely related tumor necrosis factor ŽTNF. and lymphotoxin-a ŽLTa. ŽSelmaj, 1992.. Disease progression in MS patients has been correlated with high TNF levels in

) Corresponding author. Department of Neurology, Medical Academy of Lodz, Kopcinskiego str. 22, 90-153 Lodz, Poland. E-mail: [email protected]

0165-5728r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 5 - 5 7 2 8 Ž 9 7 . 0 0 2 5 5 - 5

CSF ŽSharief and Henteges, 1991.. TNF and LTa have been identified in acute and chronic active MS lesions ŽSelmaj et al., 1991a.. Both cytokines have been shown to mediate oligodendrocyte apoptosis in vitro ŽSelmaj and Raine, 1988.. Elevated serum and cerebrospinal fluid ŽCSF. levels of TNF and LTa have been shown to be associated with the onset of relapses ŽSharief and Henteges, 1991; Rudick and Ransahoff, 1992.. Also, the development of chronic relapsing EAE can be effectively prevented either by anti-TNF antibodies ŽRuddle et al., 1990; Selmaj et al., 1991b. or by soluble TNF receptor p55 ŽBaker et al., 1994; Selmaj et al., 1995; Klinkert et al., 1996.. This has led to an increased interest in the molecular and genetic mechanisms underlying the production of these cytokines. The genes for TNF and LTa reside within the class III human leukocyte antigen ŽHLA. region on chromosome 6 ŽAggarwal and Natarajan, 1996.. The expression level of these genes has been correlated with several variable ge-

M. Mycko et al.r Journal of Neuroimmunology 84 (1998) 198–206

netic elements. For example, the TNF gene allelic form at the nucleotide y308 position of the promoter region has been described as associated with higher constitutive and inducible levels of TNF gene transcription as compared to the wild type ŽWilson et al., 1994a.. The exon 3 variant of the LTa gene leads to the substitution at the amino acid position 26 ŽAsp to Thr. ŽKobayashi et al., 1986. and correlates with a reduced level of LTa production ŽMesser et al., 1991.. The previously reported NcoI LTa gene polymorphism resides within intron 1 ŽDawkins et al., 1989. and has also been described as being correlated with exon 3 polymorphism and affects LTa gene expression level ŽMesser et al., 1991.. The combination of these allelic forms may lead to the different levels of cytokines production in response to various physiological and pathological stimuli ŽSteinman, 1995. and in turn might result in a predisposition to the development of MS or a different clinical status of MS. In this paper we have investigated the association of TNF and LTa allelic polymorphism frequency with the occurrence and clinical type and severity of MS. We have also assessed whether TNF and LTa allelic polymorphism affects spontaneous and inducible cytokine production in MS patients. As HLA class II DR2 allele involvement in MS genetic susceptibility has been suggested ŽCompston et al., 1978. we also analyzed TNFrLTa genotyping results against the possible linkage with the DR2.

2. Materials and methods 2.1. Patients and controls TNF and LTa allelic and genotype frequencies were studied in randomly selected, unrelated MS patients Žfor TNF: n s 53, for LTa: n s 53., and randomly selected, unrelated controls Žfor TNF: n s 81, for LTa: n s 66.. All individuals were of Polish Caucasian origin. The MS patients had clinically and neuroradiologically confirmed relapsing–remitting MS Ž n s 40. or secondary progressive MS Ž n s 13. ŽPoser et al., 1983.. 2.2. Preparation of peripheral blood mononuclear cells (PBMC) PBMC were isolated by gradient centrifugation of blood on Histopaque ŽSigma Aldrich. and washed three times in RPMI 1640 with Hepes ŽGibco. with the following additives: streptomycin 100 m grml ŽGibco., penicillin 100 unitsrml ŽGibco. and L-glutamine 0.8 mM ŽGibco., supplemented with 5% pooled normal fetal calf serum. PBMC were used for DNA extraction and TNF, LTa production analysis.

199

2.3. DNA extraction The PBMC were first treated with lysis buffer Ž20 mM Tris 7.6, 10 mM EDTA, 0.5% SDS. and digested with proteinase K ŽSigma Aldrich.. The genomic DNA was extracted once with phenol and twice with chloroform, then precipitated from ethanol by standard procedures ŽGustincich et al., 1991.. 2.4. Typing of the TNF and LTa gene PCR was used to amplify a 519 bp of the TNF promoter region and to amplify a 740 bp fragment across intron 1rexon 3 of the LTa gene. A total of 100 ng of genomic DNA was added to 50 m l of reaction mixture containing 2 ng of each primer ŽTNF: 5X CAAACACAGGCCTCAG G A CTC3 X , 5 XA G G G A G CG T CTG CTG G CTG 3 X ; L T a: 5 XA G A G C T G G T G G G G A C A T G T C T G 3 X , 5X CCGTGCTT CGTGCTTTGGACTA3X ., 0.05 mM of each dNTP and polymerase buffer with 1.5 mmolrl MgCl 2 . A total of 1 unit Taq polymerase ŽBiometra. was added after heating Ž958C for 240 s. at 728C followed by 37 cycles at 958C for 30 s, 588C for 30 s, 728C for 30 s then a final 420 s at 728C. To determine the allelic type of the TNF gene promoter or LTa gene, we generated specially selected condition nested PCRs with the use of allele specific primers designed with the last nucleotide complementary to the allelic variant substitution base. A total 2 ng of the first stage PCR product were added to two of 50 m l reaction mixtures containing 2 ng of one of the allele specific primers Žfor TNF: 5X TAGGTTTTGAGGGG CATGG3X or 5X TAGGTTTTGAGGGGCATGT3X , for LTa: 5X GAGGTGAGCAGCAGGTTTGAGGT3X or 5X GAG GT GAGCAGCAGGTTTGAGGG3X . and antisense primer Žfor TNF: 5XAGGGAGCGTCTGCTGGCTG3X , for LTa: 5X CCGTGCTTCGTGCTTTGGACTA3X ., 0.05 mM of each dNTP and polymerase buffer with 1.5 mmolrl MgCl 2 . A total of 1 unit Taq polymerase ŽBiometra. was added after heating Ž958C for 240 s. at 728C followed by for TNF: 7 cycles at 958C for 45 s, 588C for 5 s, 728C for 45 s then a final 420 s at 728C and for LTa: 7 cycles at 958C for 45 s, 648C for 5 s, 728C for 45 s then a final 420 s at 728C. The allelic type was determined according to the presence of the desired length PCR products Žfor TNF: 443 bp, for LTa: 694 bp. by electrophoresis on 6% polyacrylamide gels. It was considered homozygotic when the PCR product was present in only one of two allele specific PCR, heterozygotic when the PCR product was present in both reactions ŽFigs. 1 and 2.. 2.5. Identification of HLA-DR2 q DNA samples A total of 100 ng of isolated genomic DNA were used in each amplification reaction. HLA-DR2q patients were

200

M. Mycko et al.r Journal of Neuroimmunology 84 (1998) 198–206

Fig. 1. The TNF promoter-308 allele detection: Results show data from three different patients, patient a1 with TNF gene homozygote G q G: lane 3 and 4; patient a2 with TNF gene heterozygote G q A: lane 5 and 6; patient a3 with TNF gene homozygote A q A: lane 7 and 8. DNA from each patient was amplified with two sets of primers, one for G and one for A allele, therefore each patient has two lines: in case of heterozygoticy there are bands in two lines, in case of homozygoticy there is band in one line, only, either for G or A. From left to right: Lane 1: dsDNA length markers ŽpUC digested with Hae III.; Lane 2: Product of first PCR, which was used for further analysis with nested PCR; Lane 3 and lane 4: Patient a1 homozygote G q G; Lane 5 and lane 6: Patient a2 heterozygote G q A; Lane 7 and lane 8: Patient a3 homozygote A q A.

identified using the method described by Erlich et al., 1991. This method makes use of primers which specifically amplify alleles of the DR2 haplotype. DR2-specific alleles were amplified using primers AB60 and AB83 ŽErlich et al., 1991; Begovich et al., 1992. at a final concentration of 0.5 mM in 1X Taq buffer plus 0.2 mM dNTPs, 1.5 mM MgCl 2 and 1.75 units of Taq polymerase in a 50 ml volume. A two-step amplification profile was utilized: 968C for 30 s followed by 30 s at 658C, for 35 cycles. As a control for DNA degradation, DR b 1 fragments were likewise amplified from each sample using primers AB60 and GH46 and the following amplification profile: 948C for 60 s, 558C for 45 s, 728C for 45 s for 32 cycles. Amplifications were performed on a GeneAmp

PCR system 9600 ŽPerkin-Elmer.. Primers were synthesized by Oligos Ets. ŽWilsonville, OR, USA.. Ten ml of each amplification reaction, including those of known positive and negative controls, were loaded and separated on a 2% agarose gel in 1X TAE containing 0.5 mgrml EtBr: 70 V for 45–50 min. DR b 1-amplified samples produced a 296 bp band, while samples positive for DR2 amplification produced a 269 bp band. 2.6. NcoI RFLP analysis First stage LTa gene PCR products were generated as described above and digested with the restriction enzyme

Fig. 2. The LTa exon 3 allele detection: Results show data from three different patients, patient a4 with LTa gene homozygote C q C: lane 3 and 4; patient a5 with LTa gene heterozygote C q A: lane 5 and 6; patient a6 with LTa gene homozygote A q A: lane 7 and 8. DNA from each patient was amplified with two sets of primers, one for C and one for A allele, therefore each patient has two lines: in case of heterozygoticy there are bands in two lines, in case of homozygoticy there is band in one line, only, either for C or A. From left to right: Lane 1: dsDNA length markers ŽpUC digested with Hae III.; Lane 2: Product of first PCR, which was used for further analysis with nested PCR; Lane 3 and lane 4: Patient a4 homozygote C q C; Lane 5 and lane 6: Patient a5 heterozygote C q A; Lane 7 and lane 8: Patient a6 homozygote A q A.

M. Mycko et al.r Journal of Neuroimmunology 84 (1998) 198–206 Table 1 TNF and LTa genotype frequency TNF allelic type GqG

GqA

LTa allelic type AqA

CqC

CqA

AqA

Controls 68 Ž84%. 12 Ž15%. 1 Ž1%. 39 Ž59%. 24 Ž36%. 3 Ž5%. MS 39 Ž74%. 13 Ž24%. 1 Ž2%. 32 Ž60%. 18 Ž34%. 3 Ž6%. Total 107 Ž80%. 25 Ž19%. 2 Ž1%. 71 Ž60%. 42 Ž35%. 6 Ž5%. First figures indicate number of individuals with given TNF and LTa genotype and numbers in brackets percentage of the genotype, respectively.

NcoI. The RFLP fragments obtained were separated by size by electrophoresis on 6% polyacrylamide gel. LTa intron 1 allelic types were identified according to the presence Žpreviously described as 5.5 kb allele by Messer et al., 1991. or absence Žpreviously described as 10.0 kb allele by Messer et al., 1991. of the NcoI restriction site. 2.7. DNA sequence analysis Several first stage PCR products of genomic DNA were purified by 6% polyacrylamide gel electrophoresis and phenolrchloroform extraction and directly sequenced by the dideoxy chain termination method to confirm the results obtained by mutation specific primer typing. For TNF gene sequence analysis the following primer was used: 5X TCCTCCCTGCTGCGATTCCGA3X , for LTa gene: 5XAGAGCTGGTGGGGACATGTCTG3X . 2.8. TNF and LTa production PBMC, isolated and washed, were cultured at a concentration of 1 = 10 6 cellsrml. For TNF production, parallel cultures were established, one control and one stimulated with lipopolysaccharide ŽLPS, Sigma, 10 m grml.; for LTa production, one control and one stimulated with phytohemagglutinin ŽPHA-P, Sigma, 10 m grml. were used. Supernatant fluids were harvested at 4 h for TNF and at 48 h for LTa and frozen until assayed. 2.9. TNF and LTa ELISA TNF and LTa were measured by a sandwich ELISA in polystyrene microtiter plates by using Quantikine im-

201

munoassay kits ŽR & D Systems. for TNF and for LTa. Optical densities were measured at 450 nm and the concentration of cytokines were evaluated according to standard curves generated according to the manufacturer’s protocol. 2.10. Clinical typing and assessment All the MS patients were divided into two clinical groups: relapsing–remitting MS or secondary progressive MS, according to the disease history. Clinical scores were given according to the Kurtzke expanded scale ŽEDSS. ŽKurtzke, 1983.. 2.11. Statistical analysis Chi-square analysis with Yates correction, out median test, Fisher’s exact test and the F-Snedecor test were all applied where appropriate to test for significant associations. Five percent Žtwo-tailed. was chosen as the level of significance.

3. Results TNF and LTa genotype frequency: The genotype distributions of the TNF gene promoter y308 GrA polymorphism are shown in the Table 1. In the control group the heterozygotic G q A genotype of TNF was detected in 15% of individuals. Homozygotic TNF A q A genotype was present in only one control. In MS patients we found a higher frequency of the point mutation in the y308 nucleotide in the promoter region of the TNF gene by 9%, but the difference was statistically not significant Ž p - 0.2.. We have detected one individual with the TNF A q A genotype in the MS group. The genotype distribution of the LTa exon 3 gene polymorphism showed, that the allele C q A was present in MS patients in 34% of individuals whereas in the control group in 36% Ž p - 0.2.. The homozygote A q A was detected in three individuals Ž6%. in MS patients and also in three individuals Ž5%. in controls ŽTable 1.. The frequency of the LTa gene allelic forms according to the intron 1 NcoI RFLP have also been determined.

Table 2 TNFrLTa combined genotype frequency MS vs. Controls

Controls MS

G q GrC q C

G q GrC q A

G q ArC q C

G q ArC q A

G q ArA q A

G q GrA q A

A q ArA q A

38 Ž57%. 25 Ž47%.

18 Ž28%. 13 Ž25%.

1 Ž2%. 7 Ž12%.

6 Ž11%. 5 Ž10%.

2 Ž2%. 1 Ž2%.

y 1 Ž2%.

y 1 Ž2%.

First figures indicate number of individuals with given combined TNFrLTa genotype and numbers in brackets the percentage of the genotype, respectively. Underline marks the significantly higher frequency of combined genotype G q ArC q C occurrence in the MS group Ž p - 0.025..

M. Mycko et al.r Journal of Neuroimmunology 84 (1998) 198–206

202

Table 3 TNFrLTa combined genotype frequency Controls vs. Expected

Controls Expected

G q GrC q C

G q GrC q A

G q ArC q C

G q ArC q A

G q ArA q A

G q GrA q A

A q ArA q A

57% 50%

28% 30%

2% 8%

11% 7%

2% 2%

y 2%

y 1%

Numbers indicate the percentage of the combined genotypes TNFrLTa in Control group. Percentages given in group Expected represent the numbers calculated by the multiplication of the separated frequencies for TNF and LTa alleles in Control group.

DR2 allele presence Ž p - 0.3 in both MS and control groups..

NcoI RFLP results in 5.5 kb or 10.0 kb-related fragments. We found full correlation between the occurrence of 5.5 kb NcoI fragment and A allele of the LTa exon 3 polymorphism, which supports earlier results ŽMesser et al., 1991.. We also compared the combined TNF gene promoterrLTa exon 3 genotype frequencies in MS patients and control groups ŽTable 2.. Seven variants of genotypes occurred in MS patient groups but only five in the control group. Most interestingly, the third most frequent combination of the TNF gene promoter y308 allele G q A with the LTa gene exon 3 allele C q C ŽG q ArC q C. was present six times more frequently in MS than in controls ŽTable 2.. This difference was statistically significant Ž p - 0.025.. However, in both of the most common allelic type combinations: G q GrC q C and G q GrC q A, there was no obvious difference between the MS and non-MS groups Ž p - 0.3. ŽTable 2.. According to our data, both point mutations Žy308 promoter of TNF gene and exon 3 LTa gene. seem to be inherited independently, since no difference was found between the number of the combined allelic types and the expected numbers calculated by the multiplication of the separated frequencies for TNF and LTa alleles in both, control and MS, groups ŽTables 3 and 4..

3.2. Clinical type and grade We have not seen any significant association between the MS clinical type with the TNF or LTa or TNFrLTa allelic type Ž p - 0.3.. We have also found no statistically significant difference in EDSS score in each of the TNF or LTa or TNFrLTa allelic type groups, but the patients expressing combined TNFrLTa genotype G q ArC q C showed highest EDSS, 4.2 " 2.0, although duration of the disease was not different from other genotype groups Ž p - 0.2.. Also no statistically significant difference was found in MS clinical type and EDSS score according to the DR2 allele distribution Ž p - 0.3.. 3.3. TNF and LTa production As both mutations had been suggested to be associated with different levels of both spontaneous and inducible cytokine production ŽWilson et al., 1994a; Messer et al., 1991., we measured TNF and LTa production by PBMC in MS patients and control groups according to their allelic type ŽFig. 3.. The results of our extensive investigations were not able to show significant differences in spontaneous and inducible production of TNF or LTa by PBMC in relation to the TNF or LTa or TNFrLTa allelic type Ž p - 0.2.. The cytokine production in the TNFrLTa G q ArC q C allelic type in MS patients was also not different from other allelic genotype groups. However, our results support earlier findings suggesting higher spontaneous PBMC production of TNF in MS patients ŽSharief and Henteges, 1991; Rentos et al., 1996; Imamura et al., 1993.. In MS group the mean spontaneous TNF production was

3.1. HLA class II DR2 allele typing To elucidate possible linkage disequilibrium between TNF and LTa polymorphism and the DR2 allele we assessed the DR2 distribution and compared it with the results of TNFrLTa genotyping in the MS and control groups. We found non-significantly different frequency of DR2 allele in both groups Ž32% in MS and 37% in controls.. We also were not able to show any correlation between the TNF or LTa or TNFrLTa allelic type and the

Table 4 TNFrLTa combined genotype frequency MS vs. Expected

MS Expected

G q GrC q C

G q GrC q A

G q ArC q C

G q ArC q A

G q ArA q A

G q GrA q A

A q ArA q A

47% 45%

25% 25%

12% 14%

10% 8%

2% 2%

2% 4%

2% 2%

Numbers indicate the percentage of the combined genotypes TNFrLTa in MS group. Percentages given in group Expected represent the numbers calculated by the multiplication of the separated frequencies for TNF and LTa alleles in MS group.

M. Mycko et al.r Journal of Neuroimmunology 84 (1998) 198–206

203

Fig. 3. Data represents: mean TNF and LTa production in pgrml, "standard deviation. No statistically significant difference was found in cytokine production between the genotype groups. In controls, there is significantly less spontaneous production of TNF in all TNF genotype groups.

218 pgrml whereas in controls 68 pgrml. The production in response to LPS stimulation was 710 pgrml vs. 1060 pgrml in controls. LTa production was comparable in MS and controls. We have not observed any correlation between the DR2 allele distribution and the TNF or LTa production levels.

4. Discussion Studies on the genetics of multiple sclerosis provide evidence that at least two or more genes play role in susceptibility to the disease ŽMcDonald et al., 1994.. The strongest association, but only in restricted population, was observed with the HLA class II, especially DR2 ŽEbers and Sadovnick, 1994.. The involvement of pro-inflammatory

cytokines, like TNF and LTa, in MS has been suggested ŽSelmaj, 1992; Rieckmann et al., 1994; Raine, 1995.. Human TNF and LTa are encoded on chromosome 6 in HLA class III region, part of a genome recently highlighted in the genome screens MS multiplex families studies ŽSawcer et al., 1996; The Multiple Sclerosis Genetics Group, 1996; Ebers et al., 1996.. It has also been suggested that individual differences in TNF production can be linked with polymorphic markers in this region ŽAggarwal and Natarajan, 1996.. The regions of most interest are the regulatory sites of the genes, especially promoter regions. The human TNF gene promoter region has been found to be associated with several transcription regulatory nuclear factors like: NF-kBrRel family, AP-1, AP-2, SP-1 and CREB ŽAggarwal and Natarajan, 1996; Messer et al., 1991; Trede et al., 1995.. The y308 promoter TNF gene

204

M. Mycko et al.r Journal of Neuroimmunology 84 (1998) 198–206

point mutation G y A lies in the 40 bp region of the binding sites for the transcription factors AP-2 and Ets and can potentially affect the TNF gene transcription level ŽMesser et al., 1991.. Allele A has been suggested to be associated with higher constitutive and inducible levels of TNF ŽWilson et al., 1994a.. However, opposing results have also been published ŽZipp et al., 1995; He et al., 1995.. In African children, homozygosity for allele A seems to be a risk factor for death from cerebral malaria, a disease with a strong pathogenic link to the TNF involvement ŽMcGuire et al., 1994.. Correlation with allele A has also been shown for mucocutaneous leishmaniasis—a severe form of cutaneous leishmaniasis associated with high circulating levels of TNF ŽCabrera et al., 1995.. In one study TNF polymorphism was found to play a role in systemic lupus erythematosus ŽSLE. susceptibility ŽWilson et al., 1994b.. The frequency of the LTa exon 3 polymorphism C q A has never been tested in MS. This point mutation results in a substitution of the codon for Threonine ŽACC. to Asparagine ŽAAC. ŽKobayashi et al., 1986.. LTa intron 1 NcoI RFLP Žearlier incorrectly located within the TNF region. was reported to correlate with the exon 3 allele A ŽMesser et al., 1991.. The increased frequency of NcoI RFLP was reported in dermatitis hermetiformis ŽMesser et al., 1994., SLE ŽBettinotti et al., 1993., IgA nephropathy, idiopathic membranous glomerulonephritis ŽMedcraft et al., 1993., but failed to show any correlation with insulin dependent diabetes mellitus ŽIhonen et al., 1992., multiple sclerosis ŽFugger et al., 1990; Roth et al., 1994.. NcoI RFLP 5.3 kb has been reported to lead to a lower LTa response upon PHA stimulation of T lymphocytes, but not to any statistically significant difference in precursor TNF protein at the mRNA levels ŽMesser et al., 1991.. In the present paper, in 119 individuals, we found almost an identical frequency of the LTa exon 3 genotypes between MS patients and a control group. The TNF y308 G to A genotype was present in MS patients at moderately higher frequency. Our results showing no evidence for the an important role of the single TNF y308 polymorphism in MS susceptibility are in concordance with the previously reported data ŽHe et al., 1995; Braun et al., 1996; Epplen et al., 1997; Huizinga et al., 1997.. However, analysis of the combined LTa exon 3 and the y308 genotype and MS revealed that the combination of the TNF promoter gene y308 allele G q A with the LTa gene exon 3 allele C q C occurred significantly more frequently in MS patients comparing to the control group. To investigate whether any specific type of the disease or severe clinical score might be linked to the LTa exon 3 or the TNF promoter polymorphism, we performed frequency analysis in chronic progressive and relapsing–remitting MS cases and scored our patients against the EDSS. We found no linkage between the y308 TNF gene promoter and LTa exon 3 polymorphisms and the disease type or severity expressed by the EDSS level. However, of interest

was, that clinical analysis revealed that MS patients with the combined TNF promoter G q A and LTa exon 3 C q C allelic types had the highest EDSS compared to other TNF and LTa genotypes. The significance of the higher occurrence of the TNF gene promoter y308 G q A allelic type in combination with the LTa gene exon 3 C q C allelic type in MS patients is not clear at the present time and requires further investigation. Since our findings suggest that both mutations are inherited independently, it may indicate that coexistence of one of the LTa protein allelic variants with the change in the structure of the TNF gene promoter region might contribute to increased MS susceptibility. This effect seems to be independent from the possible linkage disequilibrium with the other HLA region genes previously reported ŽRoth et al., 1994. as connected with the MS genetic susceptibility, mainly DR2, as we were not able to show any correlation of a TNF, LTa or TNFrLTa allelic types with the DR2 allele occurrence. In contrast to some previous reports suggesting a direct link between TNF y308 and LT exon 3 polymorphism and cytokine production ŽWilson et al., 1994a; Messer et al., 1991., and in accordance with the other findings, although with different readout for TNF and LTa production ŽZipp et al., 1995; He et al., 1995., we were unable to correlate any difference in spontaneous or inducible TNF and LTa production by PBMC with TNF promoter or LTa exon 3 polymorphism measured by ELISA. These findings clearly indicate that increased TNF or LTa production cannot be directly linked with the y308 TNF promoter or LTa exon 3 polymorphism. Our data support earlier findings on increased spontaneous production of TNF in MS patients ŽSharief and Henteges, 1991; Rudick and Ransahoff, 1992; Rentos et al., 1996; Imamura et al., 1993; Hauser et al., 1990.. These results should stimulate further efforts to investigate a possible genetic background for these altered TNF and LTa responses in MS. Recently, Zipp et al. Ž1995. revealed an association between an MS-related HLA-DR2 haplotype and the production of LTa and TNF by 10 antigenspecific T cell lines. Since they found no linkage disequilibrium between HLA-DR2 and the y308 TNF promoter polymorphism or LTa NcoI RFLP, albeit with a limited research design, this study apparently indicates that HLADR2 may be linked to an as yet unknown polymorphismŽs., or to other geneŽs. with regulatory influences on TNF or LTa production. In our study, we have not seen correlation between TNF and LTa production with HLA DR2 allele occurrence, but we have measured cytokine production by bulk non fractionated PBMCs, whereas in the previous paper ŽZipp et al., 1995. cytokine production was measured in antigen specific lines. Recently four more TNF gene polymorphisms have been described—at positions: y376, y238, y163, q70 ŽBrinkman et al., 1996.. The elucidation of possible associations between these as well as other genetic loci of cytokines with MS warrants further investigation and will be of a considerable rele-

M. Mycko et al.r Journal of Neuroimmunology 84 (1998) 198–206

vance to our understanding of mechanisms underlying this devastating neurologic disease and hopefully might lead to new and better therapeutic approaches. Acknowledgements This paper was supported by a KBN grant 4.PO5A.097.08 and the grant from the M. Curie-Sklodowska Fund MZrHHS-96-247. References Aggarwal, B.B., Natarajan, K., 1996. Tumor necrosis factors: developments during the last decade. Eur. Cytokine Netw. 7, 93–124. Baker, D., Butler, D., Scallon, B.J., O’Neill, J.K., Turk, J.L., Feldmann, M., 1994. Control of established experimental allergic encephalomyelitis by inhibition of tumor necrosis factor ŽTNF. activity within the central nervous system using monoclonal antibodies and TNF receptor-immunoglobulin fusion proteins. Eur. J. Immunol. 24, 2040–2204. Begovich, A.B., McClure, G.R., Suraj, V.C., Helmuth, R.C., Fildes, N., Bugawan, T.L., Erlich, H.A., Klitz, W., 1992. Polymorphism, recombination, and linkage disequilibrium within the HLA Class II region. J. Immunol. 148, 249–258. Bettinotti, M.P., Hartung, H., Deicher, H., Messer, G., Keller, E., Weiss, E.H., Albert, E.D., 1993. Polymorphism of tumor necrosis factor beta gene in systemic lupus erythematosus: TNFB-MHC haplotypes. Immunogenetics 37, 449–454. Braun, N., Michel, U., Ernst, B.P., Metzner, R., Bitsch, A., Weber, F., Rieckmann, P., 1996. Gene polymorphism at position y308 of the tumor-necrosis-factor-alpha ŽTNF-alpha. in multiple sclerosis and it’s influence on the regulation of TNF-alpha production. Neurosci. Lett. 215, 75–78. Brinkman, B.M.N., Zuijdgeest, D., Kaijzel, E.L., Breedveld, F.C., Verweij, C.L., 1996. Relevance of tumor necrosis factor alpha ŽTNFa . y308 promoter polymorphism in TNFa gene regulation. J. Inflamm. 46, 32–41. Cabrera, M., Shaw, M.A., Sharples, C., Wiliams, H., Castes, M., Guvit, J., Blackwell, J.M., 1995. Polymorphism in tumor necrosis factor genes associated with mucocutaneous leishmaniasis. J. Exp. Med. 182, 1259–1264. Compston, D.A., Batchelor, J.R., Earl, C.J., McDonald, W.I., 1978. Factors influencing the risk of multiple sclerosis developing in patients with optic neuritis. Brain 101, 495–511. Dawkins, R.L., Spies, T., Strominger, J.L., Hansen, J.A., 1989. Some disease-associated ancestral haplotype carry a polymorphism of TNF. Hum. Immunol. 26, 91–94. Ebers, G.C., Sadovnick, A.D., 1994. The role of genetic factors in multiple sclerosis susceptibility. J. Neuroimmunol. 54, 1–17. Ebers, G.C., Kukay, K., Bulman, D.E. et al., 1996. A full genome search in multiple sclerosis. Nat. Genet. 13, 472–476. Epplen, C., Jackel, S., Santos, E.J.M., D’Souza, M., Poehlau, D., Dotzauer, B., Sindern, E., Haupts, M., Rude, K.-P., Weber, F., Stover, J., Poser, S., Gehler, W., Malin, J.-P., Przuntek, H., Epplen, J.T., 1997. Genetic predisposition to multiple sclerosis as revealed by immunoprinting. Ann. Neurol. 41, 341–352. Erlich, H., Bugawan, T., Begovich, A.B., Scharf, S., Griffith, R., Saiki, R., Higuchi, R., Walsh, P.S., 1991. HLA-DR, DQ and DP typing using PCR amplification and immobilised probes. Eur. J. Immunogenet. 18, 33–55. Fugger, L., Morling, N., Sanberg-Wollheim, M., Ryder, L.P., Svejgaard, A., 1990. Tumor necrosis factor alpha gene polymorphism in multiple sclerosis and optic neuritis. J. Neuroimmunol. 27, 85–86.

205

Gustincich, S., Manfiolett, G., Del Sal, G., Schneider, C., Carnici, P., 1991. A fast method for high-quality genomic DNA extraction from whole human blood. BioTechniques 11, 298–302. Hafler, D.A., Weiner, H.L., 1989. MS: a CNS and systemic autoimmune disease. Immunol. Today. 10, 104–107. Hauser, S.L., Doolittle, T.H., Lincoln, R., Brown, R.H., Dinarello, C.A., 1990. Cytokine accumulation in CSF of multiple sclerosis patients: frequent detection of interleukin-1 and tumor necrosis factor but not interleukin-6. Neurology 40, 1739–1739. He, B., Navikas, V., Lundahl, J., Sodestrom, M., Hillert, J., 1995. Tumor necrosis factor alpha-308 alleles in multiple sclerosis and optic neuritis. J. Neuroimmunol. 63, 143–147. Huizinga, T.W.J., Westendorp, R.G.J., Bollen, E.L.E.M., Keijsers, V., Brinkman, B.M.N., Langermans, J.A.M., Breedveld, F.C., Verweij, C.L., van de Gaer, L., Dams, L., Crusius, J.B.A., Garcia-Gonzales, A., van Oosten, B.W., Polman, C.H., Pena, A.S., 1997. TNF-a promoter polymorphisms, production and susceptibility to multiple sclerosis in different groups of patients. J. Neuroimmunol. 72, 149– 153. Ihonen, J., Merivelon, H., Reijonen, H., Khip, M., Akerbom, H.K., Pociot, F., Nerup, J., 1992. Tumor necrosis factor-b gene RFLP alleles in Finnish IDDM haplotypes. Scand. J. Immunol. 36, 779–783. Imamura, K., Suzumura, A., Hayashi, F., Marunouchi, T., 1993. Cytokine production by peripheral blood monocytesrmacrophages in multiple sclerosis patients. Acta Neurol. Scand. 87, 281–285. Klinkert, W.E.F., Bauerle, H., Kojima, K., Lesslauer, W., Rinner, W., Lassmann, H., Wekerle, H., 1996. Recombinant human TNF-a receptor-immunoglobulin fusion protein prevents EAE in Lewis rats. Eur. Cytokine Netw. 7, 296. Kobayashi, Y., Miyomotu, D., Asada, M., Obinata, M., Osawa, T., 1986. Cloning and expression of human lymphotoxin mRNA derived from a human T cell hydrydoma. J. Biochem. 100, 727–730. Kurtzke, J.F., 1983. Rating neurologic impairment in multiple sclerosis: an expanded disability status scale ŽEDSS.. Neurology 33, 1444–1452. Liblau, R.S., Singer, S.M., McDevitt, H.O., 1995. Th1 and Th2 CD4q T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol. Today 16, 34–38. McDonald, W.I., Batchelor, J.R., Francis, D.A., 1994. The immunogenetics of multiple sclerosis. Trends Neurol. Sci. 10, 369–371. McGuire, W., Hill, A.V.S., Allsopp, C.E.M., Greenwood, B.M., Kwiatkowski, D., 1994. Variation in the TNF-a promoter region associated with susceptibility to cerebral malaria. Nature 371, 508– 511. Medcraft, J., Hitmann, G.A., Sachs, J.A., Whichelow, C.E., Raufat, I., Moore, R.H., 1993. Autoimmune renal disease and tumor necrosis factor b gene polymorphism. Clin. Nephrol. 40, 63–68. Messer, G., Spengler, H., Jung, M.C., Honald, G., Blomer, K., Pape, G.R., Riethmuller, G., Weiss, E.H., 1991. Polymorphic structure of the tumor necrosis factor ŽTNF. locus: an NcoI polymorphism in the first intron of the human TNF-b gene correlates with a variant amino-acid in position 26 and a reduced level of the TNF-b production. J. Exp. Med. 173, 209–219. Messer, G., Kick, G., Ranki, A., Koskimies, S., Reumala, T., Meurer, M., 1994. Polymorphism of tumor necrosis factor genes in patients with dermatitis herpetiformis. Dermatology 189, 135–137, Suppl. Poser, C.M., Paty, D.W., Scheinberg, L., McDonald, W.I., Davis, F.A., Ebers, G.C., Johnson, K.P., Sibley, W.A., Silberberg, D.H., Tourtelotte, W.W., 1983. New diagnostic criteria for multiple sclerosis: guidelines for research protocols. Ann. Neurol. 13, 227–231. Raine, C.S., 1995. Multiple sclerosis: TNF revisited, with promise. Nat. Med. 1, 244–248. Rentos, M., Nikolau, C., Rombos, A., Voumvourakis, V., Sagditsa, I., Papageorgiou, C., 1996. Tumor necrosis factor alpha is elevated in serum and cerebrospinal fluid in multiple sclerosis and inflammatory neuropathies. J. Neurol. 243, 165–170. Rieckmann, P., Albert, M., Kitze, B., Weber, T., Tumani, H., Broocks, A., Luer, ¨ W., Poser, S., 1994. Cytokine mRNA levels in mononuclear

206

M. Mycko et al.r Journal of Neuroimmunology 84 (1998) 198–206

blood cells from patients with multiple sclerosis. Neurology 44, 1523–1526. Roth, M.P., Nogueira, L., Coppin, H., Clanet, M., Clayton, J., CambonThomsen, A., 1994. Tumor necrosis factor polymorphism in multiple sclerosis: no additional association independent of HLA. J. Neuroimmunol. 51, 93–99. Ruddle, N.H., Bergman, C.M., McGrath, K.M., Lingenhold, E.G., Grunnot, M.L., Padula, S.J., Clark, R.B., 1990. An antibody to lymphotoxin and tumor necrosis factor prevents transfer of experimental allergic encephalomyelitis. J. Exp. Med. 172, 1193–1200. Rudick, R.A., Ransahoff, R.M., 1992. Cytokine secretion by multiple sclerosis monocytes. Relationship to disease activity. Arch. Neurol. 49, 265–270. Sawcer, S., Jones, H.B., Feakes, R., Gray, J., Smaldon, N., Chataway, J., Robertson, N., Clayton, D., Goodfellow, P.N., Comston, A., 1996. A genome screen in multiple sclerosis reveals susceptibility loci on chromosome 6p21 and 17q22. Nat. Genet. 13, 464–468. Selmaj, K.W., 1992. The role of cytokines in inflammatory conditions of the central nervous system. Semin. Neurosci. 4, 221–229. Selmaj, K., Raine, C.S., 1988. Tumor necrosis factor mediates myelin and oligodendrocyte damage in vitro. Ann. Neurol. 23, 333–346. Selmaj, K., Raine, C.S., Cannella, B., Brosnan, C.F., 1991a. Identification of lymphotoxin and tumor necrosis factor in multiple sclerosis lesions. J. Clin. Invest. 87, 949–954. Selmaj, K., Raine, C.S., Cross, A.H., 1991b. Anti-tumor necrosis factor therapy abrogates autoimmune demyelination. Ann. Neurol. 30, 694– 700.

Selmaj, K., Papierz, W., Glabinski, A., Kohno, T., 1995. Prevention of chronic relapsing experimental autoimmune encephalomyelitis by soluble tumor necrosis factor receptor I. J. Neuroimmunol. 56, 135–141. Sharief, M.K., Henteges, R., 1991. Association between tumor necrosis factor-alpha and disease progression in patients with multiple sclerosis. New Engl. J. Med. 325, 467–472. Steinman, L., 1995. Escape from ‘horror autotoxicus’: pathogenesis and treatment of autoimmune disease. Cell 80, 7–10. The Multiple Sclerosis Genetics Group, 1996. A complete genomic screen for multiple sclerosis underscores a role for the major histocompatibility complex. Nat. Genet. 13, 469–471. Trede, N.S., Tsytsykova, A.V., Chatika, T., Goldfeld, A.E., Geha, R.S., 1995. Transcriptional activation of the human TNFa promoter by superantigen in human monocytic cells. J. Immunol. 155, 902–908. Wilson, A.G., Symons, J.A., McDowell, T.L., diGiovine, F.S., Duff, G.W., 1994a. Effects of a tumor necrosis factor ŽTNF-alpha. promoter base transition on transcriptional activity. Br. J. Rheumatol. 33, 89–92. Wilson, A.G., Gordon, C., di Giovine, F.S., de Vries, N., van de Putte, L.B., Emery, P., Duff, G.W., 1994b. A genetic association between systemic lupus erythematosus and tumor necrosis factor alpha. Eur. J. Immunol. 24, 191–195. Zipp, F., Weber, F., Huber, S., Sotgiu, S., Czlonkowska, A., Holler, E., Albert, E., Weiss, E.H., Wekerle, H., Hohlfeld, R., 1995. Genetic control of multiple sclerosis: increased production of lymphotoxin and tumor necrosis factor-a by HLA-DR2q T cells. Ann. Neurol. 38, 723–730.