- Email: [email protected]
Multiplex RT-PCR assay for differentiating European swine influenza virus subtypes H1N1, H1N2 and H3N2
Journal of Virological Methods 184 (2012) 117–120
Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Multiplex RT-PCR assay for differentiating European swine influenza virus subtypes H1N1, H1N2 and H3N2 Chiara Chiapponi a,∗ , Ana Moreno b , Ilaria Barbieri c , Marianna Merenda a , Emanuela Foni a a b c
Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna “Bruno Ubertini”, Sezione Diagnostica di Parma, via dei Mercati 13/A, 43126 Parma, Italy Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna “Bruno Ubertini”, Reparto di Virologia, via Bianchi, 7/9, 25124 Brescia, Italy Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna “Bruno Ubertini”, Reparto Genomica, via Bianchi, 7/9, 25124 Brescia, Italy
a b s t r a c t Article history: Received 12 August 2011 Received in revised form 18 May 2012 Accepted 24 May 2012 Available online 1 June 2012 Keywords: Swine influenza A virus Multiplex RT-PCR Detection
In Europe, three major swine influenza viral (SIV) subtypes (H1N1, H1N2 and H3N2) have been isolated in pigs. Developing a test that is able to detect and identify the subtype of the circulating strain rapidly during an outbreak of respiratory disease in the pig population is of essential importance. This study describes two multiplex RT-PCRs which distinguish the haemagglutinin (HA) gene and the neuraminidase (NA) gene of the three major subtypes of SIV circulating in Europe. The HA PCR was able to identify the lineage (avian or human) of the HA of H1 subtypes. The analytical sensitivity of the test, considered to be unique, was assessed using three reference viruses. The detection limit corresponded to 1 × 10−1 TCID50 /200 l for avian-like H1N1, 1 × 100 TCID50 /200 l for human-like H1N2 and 1 × 101 TCID50 /200 l for H3N2 SIV. The multiplex RT-PCR was first carried out on a collection of 70 isolated viruses showing 100% specificity and then on clinical samples, from which viruses had previously been isolated, resulting in an 89% positive specificity of the viral subtype. Finally, the test was able to identify the viral subtype correctly in 56% of influenza A positive samples, from which SIV had not been isolated previously. It was also possible to identify mixed viral infections and the circulation of a reassortant strain before performing genomic studies. © 2012 Elsevier B.V. All rights reserved.
Swine influenza viruses (SIVs) belong to the family Orthomixoviridae, genus Influenzavirus A and are characterised by a segmented genome made up of eight single-stranded RNA molecules with negative polarity. SIVs are typed according to the surface determinants haemagglutinin (HA) and neuraminidase (NA). Sixteen antigenically different HA (H1–H16) and 9 different NA (N1–N9) were recognised and their combination determines the subtype of the virus. H1N1, H1N2 and H3N2 are the three major subtypes circulating among the swine population. The H1N1 SIVs circulating currently in Europe all have a genome of avian origin (avian-like) with the HA and the NA genes related to the reference strains A/Sw/Finistere/2899/82 and A/Sw/Ile et Vilaine/1455/99. The predominant H3N2 SIV strain (human-like H3N2) has been circulating in Europe since 1984. This kind of strain emerged from a reassortment between the avianlike H1N1 SIV and human influenza viruses H3N2 (the “Hong-Kong flu”) as a new virus with internal genes of avian origin and human-derived external proteins, and it is related to the reference virus A/Sw/Ghent/1/84. The major lineage of European H1N2 SIVs derives from reassortment events between avian- like H1N1 and
∗ Corresponding author. Tel.: +39 0521293733; fax: +39 0521293538. E-mail address: [email protected] (C. Chiapponi). 0166-0934/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2012.05.020
human-like H3N2 with the internal genes of avian origin and the HA and the NA genes of a human H1N1 virus, and it is related to A/Sw/Scotland/410440/94 (Kyriakis et al., 2011; Kuntz-Simon and Madec, 2009; Marozin et al., 2002). The epidemiological situation is constant evolution; the recent pandemic H1N1 influenza A virus (A(H1N1) pdm/09) was isolated in the swine population (Forgie et al., 2011; Howden et al., 2009; Moreno et al., 2010; Welsh et al., 2010). Isolation of reassortant viruses between the pandemic virus and endemic swine viruses have been reported in most countries, (i.e. Italy, UK, USA, China) (Ducatez et al., 2011; Fan et al., 2011; Howard et al., 2011; Moreno et al., 2011; Zhu et al., 2011). Other reassortant strains, i.e. H1N1 with human-like (hu-like) HA and H1N2 with avian-like (av-like) HA, circulate in Europe and are isolated sporadically (Bálint et al., 2009; Franck et al., 2007; Kyriakis et al., 2011; Marozin et al., 2002). Since pigs are thought to be a “mixing vessel” for generating reassortant strains capable of infecting humans (Ito et al., 1998), virological surveillance of SIVs and rapid virus subtyping are of crucial importance. Traditionally, the antigenic characterisation of influenza A virus isolates is performed by two serological tests: haemoagglutination inhibition (HI) and neuroaminidase inhibition (NI) tests (OIE, 2008). These methods are time-consuming and a high virus titre is required to obtain a satisfactory result. To overcome this problem,
118
C. Chiapponi et al. / Journal of Virological Methods 184 (2012) 117–120
RT-PCR assays have been developed recently for detection and subtyping of swine influenza viruses from the USA and Asia (Choi et al., 2002; Lee et al., 2008; Schorr et al., 1994). A multiplex RT-PCR has been developed recently for detection of three different lineages of HA of SIVs isolated from China (Fu et al., 2010). Since the genetic characteristics of SIVs are related to geographical regions, European viruses are different from viruses isolated in North America and Asia (Kuntz-Simon and Madec, 2009; Olsen et al., 2006; Van Reeth, 2007) and specific identification methods are required. One of the OFFLU (OIE/FAO Network of expertise on animal influenza) research priorities for swine influenza is the development of primers for different types of PCR (generic primers as well as more specific primers for major lineages) (OFFLU Steering Committee, 2011). The aim of this study was to evaluate two one-step multiplex RTPCR methods (one for HA and one for NA) in order to distinguish rapidly the main SIV subtypes circulating in Europe i.e. hu-like H1N2, av-like H1N1, human derived H3N2 and their potential reassortants. For the screening of the HA from the pandemic A(H1N1) pdm/09 virus, a real-time RT-PCR (CDC, 2009) method was used separately. This method was evaluated on samples from Italy and on reference SIV strains from Europe. The PCR was first carried out on viral strains characterised previously by the HI test and/or by sequencing, and then on clinical samples. The primers sequences and amplicon lengths are listed in Table 2. SIV sequences used for primer design were selected and aligned by ClustalW2 (http://www.ebi.ac.uk/Tools/ msa/clustalw2/) from the Influenza Virus Sequence Database (http://www.ncbi.nlm.nih.gov/genomes/FLU/Database/nphselect.cgi?go=database). For each gene (i.e. av-like H1, hu-like H1, N1 and N2) one alignment was performed and a pair of primers was designed. To design av-like H1 primers, a set of European av-like H1N1 SIV HA genes were retrieved and aligned. A conserved region was identified and used to design a pair of primers using Primer3 software (Rozen and Skaletsky, 2000). To design hu-like H1 primers HA, sequences from European H1N2 SIVs were used. To design the N1 primers, a set of NA genes from av-like H1N1 SIVs were analysed. To design N2 primers, NA sequences from H3N2 and H1N2 European SIVs were used. The amplicon lengths were chosen to make it easer to differentiate PCR products using gel electrophoresis. Viral RNA was extracted from cell culture supernatant, allantoic fluid, nasal swabs or lung homogenates using the Rneasy Mini Kit (QIAGEN, Milan, Italy) according to the manufacturer’s protocol. Two separated multiplex reactions were set up to amplify HA and NA genes with the Qiagen One-step RT-PCR kit. Each multiplex RT-PCR was performed in a reaction mixture of 25 l containing 5 l of Reaction Buffer, 0.4 mM of each dNTP (Promega, Milan, Italy), 20 U RNase inhibitor (Promega), 1 l of One Step Enzyme mix (QIAGEN), and 2.5 l of RNA template. HA reactions were set up with 0.5 M of H1N1-FOR, H1N1-REV, H1N2-FOR, H1N2-REV primers, and 1 M of H3-175f and H3-896r primers (Lee et al., 2001). NA reactions contained 0.5 M of N1-FOR, N1-REV, N2-FOR and N2-REV primers. Amplifications were obtained in an iCycler Thermal Cycler (Bio-Rad Laboratories, Milan, Italy) with the following cycling conditions: 30 min at 50 ◦ C, 15 min at 95 ◦ C of initial denaturation, then 40 cycles at 95 ◦ C for 45 s, annealing at 55 ◦ C for 45 s and extension at 72 ◦ C for 1 min followed by an extension step at 72 ◦ C for 7 min. RT-PCR amplicons were separated and visualised after SYBR SafeTM DNA gel (Invitrogen) staining on 2% agarose gel. Viral subtypes were differentiated according to the length of each amplification product (Table 2, Fig. 1). The specificity of the test was assessed using samples containing other swine respiratory viruses (porcine reproductive and respiratory syndrome virus (PRRS) including Euro strain, porcine circovirus type 2 (PCV2),
Fig. 1. Gel electrophoresis for the detection and differentiation of HA (lane 2) and NA (lane 1) by multiplex-RT-PCR. Lane M: 100 bp molecular marker. Lanes 1 and 2 are a mixture of the three different viruses H1N1, H1N2 and H3N2.
Aujeszky’s disease virus (ADV), Mycoplasma hyopneumoniae) and the pandemic strain A/Sw/Italy/290271/2009 H1N1v. Every amplification product of each subtype of A/sw/Finistere/2899/82 (H1N1), A/Sw/Italy/284922/2009 (H1N2), A/Sw/Ghent/84 (H3N2) was sequenced with the ABI BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) using PCR primers and analysed by automatic sequencer ABI PRISM 310 Genetic Analyser (Applied Biosystems). In order to test the assay’s analytical sensitivity, the viral titres of A/Sw/Finistere/2899/82 (H1N1), A/Sw/Italy/284922/2009 (H1N2) and A/Sw/Ghent/84 (H3N2) (50% tissue culture dose TCID50 ) were estimated according to Reed and Muench (1938). Viruses were ten-fold diluted in PBS, viral RNA was extracted and multiplex RT-PCR was performed as described above. Amplification products were confirmed by sequencing and no specific product was detected when the test was checked using samples containing other swine respiratory viruses (PRRS, PCV2, ADV, M. hyopneumoniae). The multiplex RT-PCR detected the N1 gene of the pandemic strain A/sw/It/290271/2009 while no amplification was present for the HA gene (classical lineage). The NA PCR was positive at higher virus dilutions than the HA PCR so the limit of sensitivity of the assay, considered as a single test, was calculated at the highest dilution found to be positive by the HA PCR. The detection limit corresponded to a viral titre of 1 × 10−1 TCID50 /200 l for the avian-like H1N1, 1 × 100 TCID50 /200 l for the human-like H1N2 and 1 × 101 TCID50 /200 l for H3N2. The analytical sensitivity of the test with a mixture of the three reference viruses, which were detected simultaneously, was 1 × 101 TCID50 /200 l. At lower limits this test was less sensitive than the influenza A matrix gene Real-Time RT-PCR (RRT-PCR) (Brookes et al., 2010) which is used routinely as the screening test (1 × 10−3 TCID50 /200 l) (data not shown). The Multiplex RT-PCR was performed on six European reference strains (Table 1) and on 70 viruses collected during the period of 2003–2010 in Italy (Table 3). The results were 100% confirmed by HI tests or by partial sequencing of HA and NA genes. Table 1 Reference viral strains used in this study and HA amplification products.
(r)
Virus reference strain
Subtype
RT-PCR HA
RT-PCR NA
A/Sw/Italy/1521/98 A/Sw/Scotland/41440/92 A/Sw/Italy/2064/99 A/Sw/Finistere/2899/82 A/Sw/Ghent/84
H1N2 H1N2 H1N2r H1N1 H3N2
H1 hu-like H1 hu-like H1 av-like H1 av-like H3
N2 N2 N2 N1 N2
Reassortant strain.
C. Chiapponi et al. / Journal of Virological Methods 184 (2012) 117–120
119
Table 2 Primer sequences and amplicon length. Primer
Sequence 5 –3
Amplification product
Amplicon length (base pairs)
Reference
H1N1 FOR H1N1 REV H1N2 FOR H1N2 REV H3-175f H3-896r N1 FOR N1 REV N2 FOR N2 REV
CTGCACTGAAAGCTGACACC GCTGCTCCCTTAATTCCTCA GCTACCATGCGAACAATTCA TCAGCATTTGGTGTTTCTGC CARATTGARGTGACHAATGC GGTGCATCTGAYCTCATTA TGAAATACAATGGCATAATAAC GGATCCCAAATCATCTCAAA GGAAAAGCATGGCTGCAT GTGCCACAAAACACAACAAT
H1 av-like
327
H1 hu-like
241
H3
722
N1
514
N2
791
This study This study This study This study Lee et al. (2001) Lee et al. (2001) This study This study This study This study
(R)
A/G, (Y) C/T, (D) G/A/T, (H) A/C/T.
Table 3 Results of the multiplex RT-PCR carried out on isolated strains, on original samples with virus isolation and on original samples without virus isolation.
(r)
Origin
TOT
H1N2
H1N2r
H1N1
Isolated strains Original sample with virus isolation Original sample w/o virus isolation
70 56 27
28 16 4
1 – 1
28 32 10
H1N1r 2 1 –
H3N2
H1N1 + H1N2
Not typeable
11 7 0
– 1 (only H1N2 was isolated)
0 5 (4 H3N2 and 1 H1N1) 12
Reassortant strain.
More precisely, one H1N2 reassortant strain, expressing an avian-like HA gene, and two H1N1 reassortant strains expressing the human-like HA gene, were identified correctly. The use of the HI test alone was not sufficient to subtype these strains and sequence analysis of the HA and NA genes was carried out to reveal their subtype. Nasal swabs or swine lungs were collected during outbreaks of acute respiratory disease in Northern Italy from 2009 to 2010. Samples were screened for influenza A virus matrix gene by RRT-PCR. All the positive samples were inoculated onto MDCK and CaCo2 cells in culture and into embryonated chicken eggs (Chiapponi et al., 2010) for virus isolation and tested with the multiplex RT-PCRs. Since the multiplex RT-PCR was not able to detect the pandemic virus A(H1N1)pdm/09, influenza A positive samples were also tested with the specific RRT-PCR from Centers for Disease Control and Prevention, USA (CDC, 2009). As shown in Table 3, the test was performed on 55 samples of clinical material from which the virus had been isolated. The multiplex RT-PCR identified 49 samples correctly. In one sample, two different subtypes were detected (H1N1 and H1N2) but only H1N2 replicated successfully and was isolated from embryonated chicken eggs and cell cultures. The multiplex PCR did not identify the viral subtype from the clinical material in five samples probably because the viral load was low, as indicated by the matrix gene RRT-PCR in which a threshold cycle (Ct ) higher than 30 cycles was recorded. The test was performed on 27 clinical samples which were positive for Influenza A without successful viral isolation. The multiplex RT-PCR detected HA and NA genes in 15 clinical samples while 12 samples, with Ct s higher than 30 cycles when analysed with the Influenza A RRT-PCR, could not be classified. None of the samples examined was positive for A(H1N1)pdm/09 virus by the CDC RRT-PCR for the pandemic HA (CDC, 2009). The assay described in this paper was specific and its usefulness was demonstrated by the prompt identification of one reassortant H1N2 strain with the HA gene of avian origin and two H1N1 with the HA gene of human origin. The use of PCR to subtype SIV strains was simpler and quicker than the use of HI, NI or sequencing assays, even though these techniques provide additional antigenic and genetic information. For these samples, virus isolation proved to be extremely important for identifying the correct viral subtype. Four of the samples were H3N2 and one was H1N1. The high number of non-classifiable
samples of H3N2 subtype could be explained by the lower analytical sensitivity for detecting virus subtype H3N2 in comparison to swine influenza A subtypes H1N1 or H1N2 by the assay described in this paper. The multiplex RT-PCR was able to identify one sample which was positive for both H1N1 and H1N2, a mixing event which could lead to reassortant viruses, and highlighted one interesting sample which underwent further genetic analysis. Furthermore, the multiplex RT-PCR carried out on influenza A positive samples, from which no virus could be isolated by any of the culture systems, was able to amplify the HA and the NA genes in 56% of the cases. The assay proved to be a simple way to obtain information that would be otherwise lost due to the presence of a non-viable or non-replicating in vitro virus strain. A negative result was recorded in 44% of the samples with low viral load and/or non-viable viruses. This result could be explained by the reduced sensitivity of the multiplex RT-PCR compared to the matrix RRT-PCR used for the first screening of the samples. Viral isolation by culture methods is still an important way to characterise a virus and maintain virus banks for future analyses. However, the multiplex RT-PCR described in this paper is an easy and quick tool for identifying the three main European SIV subtypes present in clinical material. Rapid identification can assist in the management of disease outbreaks with the possibility of carrying out a detailed followup when there is sufficient time. One of the major advantages of this method is the possibility of identifying the HA origin, i.e. avian or human, of the H1 SIV strains and then identifying reassortant strains with the use of standard equipment present in any molecular biology laboratory.
Acknowledgements The authors would like to thank the ESNIP consortium for providing reference strains A/Sw/Scotland/41440/92, A/Sw/Finistere/2899/82, A/Sw/Ghent/84. The authors would also like to thank Dr. Gabriele Casadei for checking this manuscript and Roberta Manfredi and Debora Campagna for their technical assistance. This work was financed partially by The Italian Ministry of Health project PRC2009/07.
120
C. Chiapponi et al. / Journal of Virological Methods 184 (2012) 117–120
References Bálint, A., Metreveli, G., Widén, F., Zohari, S., Berg, M., Isaksson, M., Renström, L.H., Wallgren, P., Belák, S., Segall, T., Kiss, I., 2009. The first Swedish H1N2 swine influenza virus isolate represents an uncommon reassortant. Virology Journal 6, 180. ˜ Brookes, S.M., Núnez, A., Choudhury, B., Matrosovich, M., Essen, S., Clifford, D., Slomka, M.J., Kuntz-Simon, G., Garcon, F., Nash, B., Hanna, A., Heegaard, P.M.H., Quéguiner, S., Chiapponi, C., Bublot, M., Maldonado Garcia, J., Gardner, R., Foni, E., Loeffen, W., Larsen, L., Van Reeth, K., Banks, J., Irvine, R.I., Brown, I.H., 2010. Replication, pathogenesis and transmission of pandemic (H1N1) 2009 virus in non immune pigs. Plos One 5, e9068, http://dx.doi.org/10.1371/journal.pone.0009068. CDC, 2009. CDC Protocol of Realtime RTPCR for Influenza A (H1N1), Revision 2. http://www.who.int/csr/resources/publications/swineflu/CDCRealtimeRTPCR SwineH1Assay-2009 20090430.pdf. Chiapponi, C., Zanni, I., Garbarino, C., Barigazzi, G., Foni, E., 2010. Comparison of the usefulness of the CACO-2 cell line with standard substrates for isolation of swine influenza A viruses. Journal of Virological Methods 163, 162–165. Choi, Y.K., Goyal, S.M., Kang, S.W., Farnham, M.W., Joo, H.S., 2002. Detection and subtyping of swine influenza H1N1, H1N2 and H3N2 viruses in clinical samples using two multiplex RT-PCR assays. Journal of Virological Methods 102, 53–59. Ducatez, M.F., Hause, B., Stigger-Rosser, E., Darnell, D., Corzo, C., Juleen, K., Simonson, R., Brockwell-Staats, C., Rubrum, A., Wang, D., Webb, A., Crumpton, J.C., Lowe, J., Gramer, M., Webby, R.J., 2011. Multiple reassortment between pandemic (H1N1) 2009 and endemic influenza viruses in pigs, United States. Emerging Infectious Diseases, 1624–1629. Fan, X., Zhu, H., Zhou, B., Smith, D.K., Chen, X., Lam, T.T., Poon, L.L., Peiris, M., Guan, Y., 2011. Emergence and dissemination of a swine H3N2 reassortant with 2009 pandemic H1N1 genes in pigs in China. Journal of Virology 86, 2375–2378. Forgie, S.E., Keenliside, J., Wilkinson, C., Webby, R., Lu, P., Sorensen, O., Fonseca, K., Barman, S., Rubrum, A., Stigger, E., Marrie, T.J., Marshall, F., Spady, D.W., Hu, J., Loeb, M., Russell, M.L., Babiuk, L.A., 2011. Swine outbreak of pandemic influenza A virus on a Canadian research farm supports human-to-swine transmission. Clinical Infectious Diseases 52, 10–18. Franck, N., Queguiner, S., Gorin, S., Eveno, E., Fablet, C., Madec, F., Kuntz-Simon, G., 2007. Molecular epidemiology of swine influenza virus in France: identifications of novel H1N1 reassortants. In: Markowska-Daniel, I. (Ed.), 5th International Symposium on Emerging and Re-emerging Pig Diseases, PHV Kopiorama (K. Karez, G. Kozlowski). Krakow, Poland, 24–27 June, p. 250. Fu, G., Liu, M., Zeng, W., Pu, J., Bi, Y., Ma, G., Liu, J., 2010. Establishment of a multiplex RT-PCR assay to detect different lineages of swine H1 and H3 influenza A viruses. Virus Genes 41, 236–240. Howard, W.A., Essen, S.C., Strugnell, B.W., Russell, C., Barass, L., Reid, S.M., Brown, I.H., 2011. Reassortant Pandemic (H1N1) 2009 virus in pigs, United Kingdom. Emerging Infectious Diseases, 1049–1052. Howden, K.J., Brockhoff, E.J., Caya, F.D., McLeod, L.J., Lavoie, M., Ing, J.D., Bystrom, J.M., Alexandersen, S., Pasick, J.M., Berhane, Y., Morrison, M.E., Keenliside, J.M., Laurendeau, S., Rohonczy, E.B., 2009. Special report: an investigation into human pandemic influenza virus (H1N1) 2009 on an Alberta swine farm. Canadian Veterinary Journal 50, 1153–1161. Ito, T., Couceiro, J.N., Kelm, S., Baum, L.G., Krauss, S., Castrucci, M.R., Donatelli, I., Kida, H., Paulson, J.C., Webster, R.G., Kawaoka, Y., 1998. Journal of Virology 72, 7367–7373.
Kyriakis, C.S., Brown, I.H., Foni, E., Kuntz-Simon, G., Maldonado, J., Madec, F., Essen, S.C., Chiapponi, C., Van Reeth, K., 2011. Virological surveillance and preliminary antigenic characterization of influenza viruses in pigs in five European countries from 2006 to 2008. Zoonoses Public Health 58, 93–101. Kuntz-Simon, G., Madec, F., 2009. Genetic and antigenic evolution of swine influenza viruses in Europe and evaluation of their zoonotic potential. Zoonoses Public Health 56, 310–325. Lee, C.S., Kang, B.K., Lee, D.H., Lyou, S.H., Park, B.K., Ann, S.K., Jung, K., Song, D.S., 2008. One-step multiplex RT-PCR for detection and subtyping of swine influenza H1, H3, N1, N2 viruses in clinical samples using a dual priming oligonucleotide (DPO) system. Journal of Virological Methods 151, 30–44. Lee, M.S., Chang, P.C., Shien, J.H., Cheng, M.C., Shieh, H.K., 2001. Identification and subtyping of avian influenza viruses by reverse transcription-PCR. Journal of Virological Methods 97, 13–22. Marozin, S., Gregory, V., Cameron, K., Bennett, M., Valette, M., Aymard, M., Foni, E., Barigazzi, G., Lin, Y., Hay, A., 2002. Antigenic and genetic diversity among swine influenza A H1N1 and H1N2 viruses in Europe. Journal of General Virology 83, 735–745. Moreno, A., Di Trani, L., Alberali, L., Vaccai, G., Barbieri, I., Falcone, E., Sozzi, E., Puzelli, S., Ferri, G., Cordioli, P., 2010. First pandemic H1N1 outbreak from a pig farm in Italy. Open Virology Journal 4, 52–56. Moreno, A., Di Trani, L., Faccini, S., Vaccari, G., Nigrelli, D., Boniotti, M.B., Falcone, E., Boni, A., Chiapponi, C., Sozzi, E., Cordioli, P., 2011. Novel H1N2 swine influenza reassortant strain in pigs derived from the pandemic H1N1/2009 virus. Veterinary Microbiology 149, 472–477. OFFLU Steering Committee, 2011. An OFFLU Agenda for Influenza Research Priorities in Animal Species, pp. 9–11. Available online http://www.offlu.net/ OFFLU%20Site/OFFLU%20Research%20Priorities.pdf. OIE (Ed.), 2008. OIE Manual of Standards for Diagnostic Tests and Vaccines for Terrestrial Animals, fifth edition (Chapter 2.8.8). Available from: http://www. oie.int/fileadmin/Home/eng/Health standards/tahm/2.08.08 SWINE INFLUENZA. pdf. Olsen, C.W., Brown, I.H., Easterday, B.C., van Reeth, K., 2006. Swine influenza. In: Straw, B.E., Zimmerman, J.J., D’Allaire, S., Taylor, D.J. (Eds.), Disease of Swine. Iowa State University Press, Ames, Iowa, pp. 469–482. Reed, L.J., Muench, H., 1938. A simple method of estimating 50 per cent end points American Journal of Hygiene 27, 493–497. Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386. Schorr, E., Wentworth, D., Hinshaw, V.S., 1994. Use of polymerase chain reaction to detect swine influenza virus in nasal swab specimens. American Journal of Veterinary Research 55, 952–956. Van Reeth, K., 2007. Avian and swine influenza viruses: our current understanding of the zoonotic risk. Veterinary Research 38, 243–260. Welsh, M.D., Baird, P.M., Guelbenzu-Gonzalo, M.P., Hanna, A., Reid, S.M., Essen, S., Russell, C., Thomas, S., Barrass, L., McNeilly, F., McKillen, J., Todd, D., Harkin, V., McDowell, S., Choudhury, B., Irvine, R.M., Borobia, J., Grant, J., Brown, I.H., 2010. Initial incursion of pandemic (H1N1) 2009 influenza A virus into European pigs. Veterinary Record 166, 642–645. Zhu, H., Zhou, B., Fan, X., Lam, T.T., Wang, J., Chen, A., Chen, X., Chen, H., Webster, R.G., Webby, R., Peiris, J.S., Smith, D.K., Guan, Y., 2011. Novel reassortment of Eurasian avian-like and pandemic/2009 influenza viruses in swine: infectious potential for humans. Journal of Virology, 10432–10439.
Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Multiplex RT-PCR assay for differentiating European swine influenza virus subtypes H1N1, H1N2 and H3N2 Chiara Chiapponi a,∗ , Ana Moreno b , Ilaria Barbieri c , Marianna Merenda a , Emanuela Foni a a b c
Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna “Bruno Ubertini”, Sezione Diagnostica di Parma, via dei Mercati 13/A, 43126 Parma, Italy Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna “Bruno Ubertini”, Reparto di Virologia, via Bianchi, 7/9, 25124 Brescia, Italy Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna “Bruno Ubertini”, Reparto Genomica, via Bianchi, 7/9, 25124 Brescia, Italy
a b s t r a c t Article history: Received 12 August 2011 Received in revised form 18 May 2012 Accepted 24 May 2012 Available online 1 June 2012 Keywords: Swine influenza A virus Multiplex RT-PCR Detection
In Europe, three major swine influenza viral (SIV) subtypes (H1N1, H1N2 and H3N2) have been isolated in pigs. Developing a test that is able to detect and identify the subtype of the circulating strain rapidly during an outbreak of respiratory disease in the pig population is of essential importance. This study describes two multiplex RT-PCRs which distinguish the haemagglutinin (HA) gene and the neuraminidase (NA) gene of the three major subtypes of SIV circulating in Europe. The HA PCR was able to identify the lineage (avian or human) of the HA of H1 subtypes. The analytical sensitivity of the test, considered to be unique, was assessed using three reference viruses. The detection limit corresponded to 1 × 10−1 TCID50 /200 l for avian-like H1N1, 1 × 100 TCID50 /200 l for human-like H1N2 and 1 × 101 TCID50 /200 l for H3N2 SIV. The multiplex RT-PCR was first carried out on a collection of 70 isolated viruses showing 100% specificity and then on clinical samples, from which viruses had previously been isolated, resulting in an 89% positive specificity of the viral subtype. Finally, the test was able to identify the viral subtype correctly in 56% of influenza A positive samples, from which SIV had not been isolated previously. It was also possible to identify mixed viral infections and the circulation of a reassortant strain before performing genomic studies. © 2012 Elsevier B.V. All rights reserved.
Swine influenza viruses (SIVs) belong to the family Orthomixoviridae, genus Influenzavirus A and are characterised by a segmented genome made up of eight single-stranded RNA molecules with negative polarity. SIVs are typed according to the surface determinants haemagglutinin (HA) and neuraminidase (NA). Sixteen antigenically different HA (H1–H16) and 9 different NA (N1–N9) were recognised and their combination determines the subtype of the virus. H1N1, H1N2 and H3N2 are the three major subtypes circulating among the swine population. The H1N1 SIVs circulating currently in Europe all have a genome of avian origin (avian-like) with the HA and the NA genes related to the reference strains A/Sw/Finistere/2899/82 and A/Sw/Ile et Vilaine/1455/99. The predominant H3N2 SIV strain (human-like H3N2) has been circulating in Europe since 1984. This kind of strain emerged from a reassortment between the avianlike H1N1 SIV and human influenza viruses H3N2 (the “Hong-Kong flu”) as a new virus with internal genes of avian origin and human-derived external proteins, and it is related to the reference virus A/Sw/Ghent/1/84. The major lineage of European H1N2 SIVs derives from reassortment events between avian- like H1N1 and
∗ Corresponding author. Tel.: +39 0521293733; fax: +39 0521293538. E-mail address: [email protected] (C. Chiapponi). 0166-0934/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2012.05.020
human-like H3N2 with the internal genes of avian origin and the HA and the NA genes of a human H1N1 virus, and it is related to A/Sw/Scotland/410440/94 (Kyriakis et al., 2011; Kuntz-Simon and Madec, 2009; Marozin et al., 2002). The epidemiological situation is constant evolution; the recent pandemic H1N1 influenza A virus (A(H1N1) pdm/09) was isolated in the swine population (Forgie et al., 2011; Howden et al., 2009; Moreno et al., 2010; Welsh et al., 2010). Isolation of reassortant viruses between the pandemic virus and endemic swine viruses have been reported in most countries, (i.e. Italy, UK, USA, China) (Ducatez et al., 2011; Fan et al., 2011; Howard et al., 2011; Moreno et al., 2011; Zhu et al., 2011). Other reassortant strains, i.e. H1N1 with human-like (hu-like) HA and H1N2 with avian-like (av-like) HA, circulate in Europe and are isolated sporadically (Bálint et al., 2009; Franck et al., 2007; Kyriakis et al., 2011; Marozin et al., 2002). Since pigs are thought to be a “mixing vessel” for generating reassortant strains capable of infecting humans (Ito et al., 1998), virological surveillance of SIVs and rapid virus subtyping are of crucial importance. Traditionally, the antigenic characterisation of influenza A virus isolates is performed by two serological tests: haemoagglutination inhibition (HI) and neuroaminidase inhibition (NI) tests (OIE, 2008). These methods are time-consuming and a high virus titre is required to obtain a satisfactory result. To overcome this problem,
118
C. Chiapponi et al. / Journal of Virological Methods 184 (2012) 117–120
RT-PCR assays have been developed recently for detection and subtyping of swine influenza viruses from the USA and Asia (Choi et al., 2002; Lee et al., 2008; Schorr et al., 1994). A multiplex RT-PCR has been developed recently for detection of three different lineages of HA of SIVs isolated from China (Fu et al., 2010). Since the genetic characteristics of SIVs are related to geographical regions, European viruses are different from viruses isolated in North America and Asia (Kuntz-Simon and Madec, 2009; Olsen et al., 2006; Van Reeth, 2007) and specific identification methods are required. One of the OFFLU (OIE/FAO Network of expertise on animal influenza) research priorities for swine influenza is the development of primers for different types of PCR (generic primers as well as more specific primers for major lineages) (OFFLU Steering Committee, 2011). The aim of this study was to evaluate two one-step multiplex RTPCR methods (one for HA and one for NA) in order to distinguish rapidly the main SIV subtypes circulating in Europe i.e. hu-like H1N2, av-like H1N1, human derived H3N2 and their potential reassortants. For the screening of the HA from the pandemic A(H1N1) pdm/09 virus, a real-time RT-PCR (CDC, 2009) method was used separately. This method was evaluated on samples from Italy and on reference SIV strains from Europe. The PCR was first carried out on viral strains characterised previously by the HI test and/or by sequencing, and then on clinical samples. The primers sequences and amplicon lengths are listed in Table 2. SIV sequences used for primer design were selected and aligned by ClustalW2 (http://www.ebi.ac.uk/Tools/ msa/clustalw2/) from the Influenza Virus Sequence Database (http://www.ncbi.nlm.nih.gov/genomes/FLU/Database/nphselect.cgi?go=database). For each gene (i.e. av-like H1, hu-like H1, N1 and N2) one alignment was performed and a pair of primers was designed. To design av-like H1 primers, a set of European av-like H1N1 SIV HA genes were retrieved and aligned. A conserved region was identified and used to design a pair of primers using Primer3 software (Rozen and Skaletsky, 2000). To design hu-like H1 primers HA, sequences from European H1N2 SIVs were used. To design the N1 primers, a set of NA genes from av-like H1N1 SIVs were analysed. To design N2 primers, NA sequences from H3N2 and H1N2 European SIVs were used. The amplicon lengths were chosen to make it easer to differentiate PCR products using gel electrophoresis. Viral RNA was extracted from cell culture supernatant, allantoic fluid, nasal swabs or lung homogenates using the Rneasy Mini Kit (QIAGEN, Milan, Italy) according to the manufacturer’s protocol. Two separated multiplex reactions were set up to amplify HA and NA genes with the Qiagen One-step RT-PCR kit. Each multiplex RT-PCR was performed in a reaction mixture of 25 l containing 5 l of Reaction Buffer, 0.4 mM of each dNTP (Promega, Milan, Italy), 20 U RNase inhibitor (Promega), 1 l of One Step Enzyme mix (QIAGEN), and 2.5 l of RNA template. HA reactions were set up with 0.5 M of H1N1-FOR, H1N1-REV, H1N2-FOR, H1N2-REV primers, and 1 M of H3-175f and H3-896r primers (Lee et al., 2001). NA reactions contained 0.5 M of N1-FOR, N1-REV, N2-FOR and N2-REV primers. Amplifications were obtained in an iCycler Thermal Cycler (Bio-Rad Laboratories, Milan, Italy) with the following cycling conditions: 30 min at 50 ◦ C, 15 min at 95 ◦ C of initial denaturation, then 40 cycles at 95 ◦ C for 45 s, annealing at 55 ◦ C for 45 s and extension at 72 ◦ C for 1 min followed by an extension step at 72 ◦ C for 7 min. RT-PCR amplicons were separated and visualised after SYBR SafeTM DNA gel (Invitrogen) staining on 2% agarose gel. Viral subtypes were differentiated according to the length of each amplification product (Table 2, Fig. 1). The specificity of the test was assessed using samples containing other swine respiratory viruses (porcine reproductive and respiratory syndrome virus (PRRS) including Euro strain, porcine circovirus type 2 (PCV2),
Fig. 1. Gel electrophoresis for the detection and differentiation of HA (lane 2) and NA (lane 1) by multiplex-RT-PCR. Lane M: 100 bp molecular marker. Lanes 1 and 2 are a mixture of the three different viruses H1N1, H1N2 and H3N2.
Aujeszky’s disease virus (ADV), Mycoplasma hyopneumoniae) and the pandemic strain A/Sw/Italy/290271/2009 H1N1v. Every amplification product of each subtype of A/sw/Finistere/2899/82 (H1N1), A/Sw/Italy/284922/2009 (H1N2), A/Sw/Ghent/84 (H3N2) was sequenced with the ABI BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) using PCR primers and analysed by automatic sequencer ABI PRISM 310 Genetic Analyser (Applied Biosystems). In order to test the assay’s analytical sensitivity, the viral titres of A/Sw/Finistere/2899/82 (H1N1), A/Sw/Italy/284922/2009 (H1N2) and A/Sw/Ghent/84 (H3N2) (50% tissue culture dose TCID50 ) were estimated according to Reed and Muench (1938). Viruses were ten-fold diluted in PBS, viral RNA was extracted and multiplex RT-PCR was performed as described above. Amplification products were confirmed by sequencing and no specific product was detected when the test was checked using samples containing other swine respiratory viruses (PRRS, PCV2, ADV, M. hyopneumoniae). The multiplex RT-PCR detected the N1 gene of the pandemic strain A/sw/It/290271/2009 while no amplification was present for the HA gene (classical lineage). The NA PCR was positive at higher virus dilutions than the HA PCR so the limit of sensitivity of the assay, considered as a single test, was calculated at the highest dilution found to be positive by the HA PCR. The detection limit corresponded to a viral titre of 1 × 10−1 TCID50 /200 l for the avian-like H1N1, 1 × 100 TCID50 /200 l for the human-like H1N2 and 1 × 101 TCID50 /200 l for H3N2. The analytical sensitivity of the test with a mixture of the three reference viruses, which were detected simultaneously, was 1 × 101 TCID50 /200 l. At lower limits this test was less sensitive than the influenza A matrix gene Real-Time RT-PCR (RRT-PCR) (Brookes et al., 2010) which is used routinely as the screening test (1 × 10−3 TCID50 /200 l) (data not shown). The Multiplex RT-PCR was performed on six European reference strains (Table 1) and on 70 viruses collected during the period of 2003–2010 in Italy (Table 3). The results were 100% confirmed by HI tests or by partial sequencing of HA and NA genes. Table 1 Reference viral strains used in this study and HA amplification products.
(r)
Virus reference strain
Subtype
RT-PCR HA
RT-PCR NA
A/Sw/Italy/1521/98 A/Sw/Scotland/41440/92 A/Sw/Italy/2064/99 A/Sw/Finistere/2899/82 A/Sw/Ghent/84
H1N2 H1N2 H1N2r H1N1 H3N2
H1 hu-like H1 hu-like H1 av-like H1 av-like H3
N2 N2 N2 N1 N2
Reassortant strain.
C. Chiapponi et al. / Journal of Virological Methods 184 (2012) 117–120
119
Table 2 Primer sequences and amplicon length. Primer
Sequence 5 –3
Amplification product
Amplicon length (base pairs)
Reference
H1N1 FOR H1N1 REV H1N2 FOR H1N2 REV H3-175f H3-896r N1 FOR N1 REV N2 FOR N2 REV
CTGCACTGAAAGCTGACACC GCTGCTCCCTTAATTCCTCA GCTACCATGCGAACAATTCA TCAGCATTTGGTGTTTCTGC CARATTGARGTGACHAATGC GGTGCATCTGAYCTCATTA TGAAATACAATGGCATAATAAC GGATCCCAAATCATCTCAAA GGAAAAGCATGGCTGCAT GTGCCACAAAACACAACAAT
H1 av-like
327
H1 hu-like
241
H3
722
N1
514
N2
791
This study This study This study This study Lee et al. (2001) Lee et al. (2001) This study This study This study This study
(R)
A/G, (Y) C/T, (D) G/A/T, (H) A/C/T.
Table 3 Results of the multiplex RT-PCR carried out on isolated strains, on original samples with virus isolation and on original samples without virus isolation.
(r)
Origin
TOT
H1N2
H1N2r
H1N1
Isolated strains Original sample with virus isolation Original sample w/o virus isolation
70 56 27
28 16 4
1 – 1
28 32 10
H1N1r 2 1 –
H3N2
H1N1 + H1N2
Not typeable
11 7 0
– 1 (only H1N2 was isolated)
0 5 (4 H3N2 and 1 H1N1) 12
Reassortant strain.
More precisely, one H1N2 reassortant strain, expressing an avian-like HA gene, and two H1N1 reassortant strains expressing the human-like HA gene, were identified correctly. The use of the HI test alone was not sufficient to subtype these strains and sequence analysis of the HA and NA genes was carried out to reveal their subtype. Nasal swabs or swine lungs were collected during outbreaks of acute respiratory disease in Northern Italy from 2009 to 2010. Samples were screened for influenza A virus matrix gene by RRT-PCR. All the positive samples were inoculated onto MDCK and CaCo2 cells in culture and into embryonated chicken eggs (Chiapponi et al., 2010) for virus isolation and tested with the multiplex RT-PCRs. Since the multiplex RT-PCR was not able to detect the pandemic virus A(H1N1)pdm/09, influenza A positive samples were also tested with the specific RRT-PCR from Centers for Disease Control and Prevention, USA (CDC, 2009). As shown in Table 3, the test was performed on 55 samples of clinical material from which the virus had been isolated. The multiplex RT-PCR identified 49 samples correctly. In one sample, two different subtypes were detected (H1N1 and H1N2) but only H1N2 replicated successfully and was isolated from embryonated chicken eggs and cell cultures. The multiplex PCR did not identify the viral subtype from the clinical material in five samples probably because the viral load was low, as indicated by the matrix gene RRT-PCR in which a threshold cycle (Ct ) higher than 30 cycles was recorded. The test was performed on 27 clinical samples which were positive for Influenza A without successful viral isolation. The multiplex RT-PCR detected HA and NA genes in 15 clinical samples while 12 samples, with Ct s higher than 30 cycles when analysed with the Influenza A RRT-PCR, could not be classified. None of the samples examined was positive for A(H1N1)pdm/09 virus by the CDC RRT-PCR for the pandemic HA (CDC, 2009). The assay described in this paper was specific and its usefulness was demonstrated by the prompt identification of one reassortant H1N2 strain with the HA gene of avian origin and two H1N1 with the HA gene of human origin. The use of PCR to subtype SIV strains was simpler and quicker than the use of HI, NI or sequencing assays, even though these techniques provide additional antigenic and genetic information. For these samples, virus isolation proved to be extremely important for identifying the correct viral subtype. Four of the samples were H3N2 and one was H1N1. The high number of non-classifiable
samples of H3N2 subtype could be explained by the lower analytical sensitivity for detecting virus subtype H3N2 in comparison to swine influenza A subtypes H1N1 or H1N2 by the assay described in this paper. The multiplex RT-PCR was able to identify one sample which was positive for both H1N1 and H1N2, a mixing event which could lead to reassortant viruses, and highlighted one interesting sample which underwent further genetic analysis. Furthermore, the multiplex RT-PCR carried out on influenza A positive samples, from which no virus could be isolated by any of the culture systems, was able to amplify the HA and the NA genes in 56% of the cases. The assay proved to be a simple way to obtain information that would be otherwise lost due to the presence of a non-viable or non-replicating in vitro virus strain. A negative result was recorded in 44% of the samples with low viral load and/or non-viable viruses. This result could be explained by the reduced sensitivity of the multiplex RT-PCR compared to the matrix RRT-PCR used for the first screening of the samples. Viral isolation by culture methods is still an important way to characterise a virus and maintain virus banks for future analyses. However, the multiplex RT-PCR described in this paper is an easy and quick tool for identifying the three main European SIV subtypes present in clinical material. Rapid identification can assist in the management of disease outbreaks with the possibility of carrying out a detailed followup when there is sufficient time. One of the major advantages of this method is the possibility of identifying the HA origin, i.e. avian or human, of the H1 SIV strains and then identifying reassortant strains with the use of standard equipment present in any molecular biology laboratory.
Acknowledgements The authors would like to thank the ESNIP consortium for providing reference strains A/Sw/Scotland/41440/92, A/Sw/Finistere/2899/82, A/Sw/Ghent/84. The authors would also like to thank Dr. Gabriele Casadei for checking this manuscript and Roberta Manfredi and Debora Campagna for their technical assistance. This work was financed partially by The Italian Ministry of Health project PRC2009/07.
120
C. Chiapponi et al. / Journal of Virological Methods 184 (2012) 117–120
References Bálint, A., Metreveli, G., Widén, F., Zohari, S., Berg, M., Isaksson, M., Renström, L.H., Wallgren, P., Belák, S., Segall, T., Kiss, I., 2009. The first Swedish H1N2 swine influenza virus isolate represents an uncommon reassortant. Virology Journal 6, 180. ˜ Brookes, S.M., Núnez, A., Choudhury, B., Matrosovich, M., Essen, S., Clifford, D., Slomka, M.J., Kuntz-Simon, G., Garcon, F., Nash, B., Hanna, A., Heegaard, P.M.H., Quéguiner, S., Chiapponi, C., Bublot, M., Maldonado Garcia, J., Gardner, R., Foni, E., Loeffen, W., Larsen, L., Van Reeth, K., Banks, J., Irvine, R.I., Brown, I.H., 2010. Replication, pathogenesis and transmission of pandemic (H1N1) 2009 virus in non immune pigs. Plos One 5, e9068, http://dx.doi.org/10.1371/journal.pone.0009068. CDC, 2009. CDC Protocol of Realtime RTPCR for Influenza A (H1N1), Revision 2. http://www.who.int/csr/resources/publications/swineflu/CDCRealtimeRTPCR SwineH1Assay-2009 20090430.pdf. Chiapponi, C., Zanni, I., Garbarino, C., Barigazzi, G., Foni, E., 2010. Comparison of the usefulness of the CACO-2 cell line with standard substrates for isolation of swine influenza A viruses. Journal of Virological Methods 163, 162–165. Choi, Y.K., Goyal, S.M., Kang, S.W., Farnham, M.W., Joo, H.S., 2002. Detection and subtyping of swine influenza H1N1, H1N2 and H3N2 viruses in clinical samples using two multiplex RT-PCR assays. Journal of Virological Methods 102, 53–59. Ducatez, M.F., Hause, B., Stigger-Rosser, E., Darnell, D., Corzo, C., Juleen, K., Simonson, R., Brockwell-Staats, C., Rubrum, A., Wang, D., Webb, A., Crumpton, J.C., Lowe, J., Gramer, M., Webby, R.J., 2011. Multiple reassortment between pandemic (H1N1) 2009 and endemic influenza viruses in pigs, United States. Emerging Infectious Diseases, 1624–1629. Fan, X., Zhu, H., Zhou, B., Smith, D.K., Chen, X., Lam, T.T., Poon, L.L., Peiris, M., Guan, Y., 2011. Emergence and dissemination of a swine H3N2 reassortant with 2009 pandemic H1N1 genes in pigs in China. Journal of Virology 86, 2375–2378. Forgie, S.E., Keenliside, J., Wilkinson, C., Webby, R., Lu, P., Sorensen, O., Fonseca, K., Barman, S., Rubrum, A., Stigger, E., Marrie, T.J., Marshall, F., Spady, D.W., Hu, J., Loeb, M., Russell, M.L., Babiuk, L.A., 2011. Swine outbreak of pandemic influenza A virus on a Canadian research farm supports human-to-swine transmission. Clinical Infectious Diseases 52, 10–18. Franck, N., Queguiner, S., Gorin, S., Eveno, E., Fablet, C., Madec, F., Kuntz-Simon, G., 2007. Molecular epidemiology of swine influenza virus in France: identifications of novel H1N1 reassortants. In: Markowska-Daniel, I. (Ed.), 5th International Symposium on Emerging and Re-emerging Pig Diseases, PHV Kopiorama (K. Karez, G. Kozlowski). Krakow, Poland, 24–27 June, p. 250. Fu, G., Liu, M., Zeng, W., Pu, J., Bi, Y., Ma, G., Liu, J., 2010. Establishment of a multiplex RT-PCR assay to detect different lineages of swine H1 and H3 influenza A viruses. Virus Genes 41, 236–240. Howard, W.A., Essen, S.C., Strugnell, B.W., Russell, C., Barass, L., Reid, S.M., Brown, I.H., 2011. Reassortant Pandemic (H1N1) 2009 virus in pigs, United Kingdom. Emerging Infectious Diseases, 1049–1052. Howden, K.J., Brockhoff, E.J., Caya, F.D., McLeod, L.J., Lavoie, M., Ing, J.D., Bystrom, J.M., Alexandersen, S., Pasick, J.M., Berhane, Y., Morrison, M.E., Keenliside, J.M., Laurendeau, S., Rohonczy, E.B., 2009. Special report: an investigation into human pandemic influenza virus (H1N1) 2009 on an Alberta swine farm. Canadian Veterinary Journal 50, 1153–1161. Ito, T., Couceiro, J.N., Kelm, S., Baum, L.G., Krauss, S., Castrucci, M.R., Donatelli, I., Kida, H., Paulson, J.C., Webster, R.G., Kawaoka, Y., 1998. Journal of Virology 72, 7367–7373.
Kyriakis, C.S., Brown, I.H., Foni, E., Kuntz-Simon, G., Maldonado, J., Madec, F., Essen, S.C., Chiapponi, C., Van Reeth, K., 2011. Virological surveillance and preliminary antigenic characterization of influenza viruses in pigs in five European countries from 2006 to 2008. Zoonoses Public Health 58, 93–101. Kuntz-Simon, G., Madec, F., 2009. Genetic and antigenic evolution of swine influenza viruses in Europe and evaluation of their zoonotic potential. Zoonoses Public Health 56, 310–325. Lee, C.S., Kang, B.K., Lee, D.H., Lyou, S.H., Park, B.K., Ann, S.K., Jung, K., Song, D.S., 2008. One-step multiplex RT-PCR for detection and subtyping of swine influenza H1, H3, N1, N2 viruses in clinical samples using a dual priming oligonucleotide (DPO) system. Journal of Virological Methods 151, 30–44. Lee, M.S., Chang, P.C., Shien, J.H., Cheng, M.C., Shieh, H.K., 2001. Identification and subtyping of avian influenza viruses by reverse transcription-PCR. Journal of Virological Methods 97, 13–22. Marozin, S., Gregory, V., Cameron, K., Bennett, M., Valette, M., Aymard, M., Foni, E., Barigazzi, G., Lin, Y., Hay, A., 2002. Antigenic and genetic diversity among swine influenza A H1N1 and H1N2 viruses in Europe. Journal of General Virology 83, 735–745. Moreno, A., Di Trani, L., Alberali, L., Vaccai, G., Barbieri, I., Falcone, E., Sozzi, E., Puzelli, S., Ferri, G., Cordioli, P., 2010. First pandemic H1N1 outbreak from a pig farm in Italy. Open Virology Journal 4, 52–56. Moreno, A., Di Trani, L., Faccini, S., Vaccari, G., Nigrelli, D., Boniotti, M.B., Falcone, E., Boni, A., Chiapponi, C., Sozzi, E., Cordioli, P., 2011. Novel H1N2 swine influenza reassortant strain in pigs derived from the pandemic H1N1/2009 virus. Veterinary Microbiology 149, 472–477. OFFLU Steering Committee, 2011. An OFFLU Agenda for Influenza Research Priorities in Animal Species, pp. 9–11. Available online http://www.offlu.net/ OFFLU%20Site/OFFLU%20Research%20Priorities.pdf. OIE (Ed.), 2008. OIE Manual of Standards for Diagnostic Tests and Vaccines for Terrestrial Animals, fifth edition (Chapter 2.8.8). Available from: http://www. oie.int/fileadmin/Home/eng/Health standards/tahm/2.08.08 SWINE INFLUENZA. pdf. Olsen, C.W., Brown, I.H., Easterday, B.C., van Reeth, K., 2006. Swine influenza. In: Straw, B.E., Zimmerman, J.J., D’Allaire, S., Taylor, D.J. (Eds.), Disease of Swine. Iowa State University Press, Ames, Iowa, pp. 469–482. Reed, L.J., Muench, H., 1938. A simple method of estimating 50 per cent end points American Journal of Hygiene 27, 493–497. Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386. Schorr, E., Wentworth, D., Hinshaw, V.S., 1994. Use of polymerase chain reaction to detect swine influenza virus in nasal swab specimens. American Journal of Veterinary Research 55, 952–956. Van Reeth, K., 2007. Avian and swine influenza viruses: our current understanding of the zoonotic risk. Veterinary Research 38, 243–260. Welsh, M.D., Baird, P.M., Guelbenzu-Gonzalo, M.P., Hanna, A., Reid, S.M., Essen, S., Russell, C., Thomas, S., Barrass, L., McNeilly, F., McKillen, J., Todd, D., Harkin, V., McDowell, S., Choudhury, B., Irvine, R.M., Borobia, J., Grant, J., Brown, I.H., 2010. Initial incursion of pandemic (H1N1) 2009 influenza A virus into European pigs. Veterinary Record 166, 642–645. Zhu, H., Zhou, B., Fan, X., Lam, T.T., Wang, J., Chen, A., Chen, X., Chen, H., Webster, R.G., Webby, R., Peiris, J.S., Smith, D.K., Guan, Y., 2011. Novel reassortment of Eurasian avian-like and pandemic/2009 influenza viruses in swine: infectious potential for humans. Journal of Virology, 10432–10439.