Multiplex short tandem repeat typing in degraded samples using newly designed primers for the TH01, TPOX, CSF1PO, and vWA loci

Legal Medicine 4 (2002) 239–245 www.elsevier.com/locate/legalmed

Multiplex short tandem repeat typing in degraded samples using newly designed primers for the TH01, TPOX, CSF1PO, and vWA loci Kazuhiko Tsukada*, Kayoko Takayanagi, Hideki Asamura, Masao Ota, Hirofumi Fukushima Department of Legal Medicine, Shinshu University School of Medicine, Asahi 3-1-1, Matsumoto, Nagano 390-8621, Japan Received 27 May 2002; received in revised form 16 July 2002; accepted 2 August 2002

Abstract We performed multiplex polymerase chain reaction (PCR) for the TH01, TPOX, CSF1PO, and vWA loci using a newly designed pair of primers that yield smaller fragments than reported previously [Fujii et al., J Hum Genet 45 (2000) 303; Lederer et al., Int J Legal Med 114 (2000) 87]. These loci can be detected in the range of 74–143 bp amplifying products. This system required genomic DNA in a range of 80 pg to 2 ng, and proved to be a sensitive typing method. We compared our system against the GenePrint Fluorescent STR Multiplex Systems CTTv (Promega, Madison, WI, USA), using DNA extracted from old bloodstains left to stand for 17–26 years at room temperature. With our designed system, all allele-typing efforts were successful in the range of 1–5 ng DNA, while no signal peaks were detected, even with when using 10 ng of DNA GenePrint Fluorescent STR Multiplex Systems CTTv. q 2002 Published by Elsevier Science Ireland Ltd. Keywords: TH01; TPOX; CSF1PO; vWA; Multiplex short tandem repeat system; Degraded DNA

1. Introduction Many short tandem repeats (STRs) are found in the human genome. These STR loci consist of sequences of base pairs of variable length that tandemly repeat sequences of 2–7 base pairs [3–8]. The STRs are widely used in many fields, such as paternity investigations and other applications related to social, medical, and forensic areas. The STRs are especially useful for the identification of individuals in forensic science and criminal investigations. Because the fragment size of STRs is smaller than that of restriction fragment length * Corresponding author. Tel.: 181-263-37-3218; fax: 181-26337-3084. E-mail address: [email protected] (K. Tsukada).

polymorphism–variable number tandem repeat (RFLP–VNTR), they are well-suited to the amplification of DNA extracted from degraded specimens. Recent reports describe newly designed primers that reduce the amplicon length of STRs loci in monoplex polymerase chain reaction (PCR) [9,10]. But there are few reports on those primers when used with multiplex PCR. Multiplex PCR, the co-amplification of several STR loci in one reaction, saves time, materials, and costs, and also conserves samples and reduces the risk of contamination [11]. These features make multiplex PCR highly useful for criminal investigations. After encountering some difficulties in the amplification of these STRs from highly degraded DNA samples, particularly with fragment sizes greater than

1344-6223/02/$ - see front matter q 2002 Published by Elsevier Science Ireland Ltd. PII: S 1344-622 3(02)00049-4

240

K. Tsukada et al. / Legal Medicine 4 (2002) 239–245

200 bp, we designed a new pair of primers to reduce the PCR fragment sizes of the TH01, TPOX, CSF1PO, and vWA loci, which are highly polymorphic and very useful markers. In this study, we investigated the usefulness of newly developed multiplex PCR for these loci using DNA extracted from old bloodstains, then compared our multiplex system with the GenePrint Fluorescent STR Multiplex Systems CTTv (Promega, Madison, WI, USA). 2. Materials and methods 2.1. DNA extraction Fresh blood from 100 individuals and 54 bloodstain samples stored at room temperature for 17–26 years were used in this study: three samples left for 17 years, nine samples left for 18 years, five samples left for 19 years, 17 samples left for 22 years, and 20 samples left for 26 years. DNA was extracted from these specimens by SDS-Proteinase K treatment, followed by phenol/chloroform extraction. DNA samples were measured spectrophotometrically (260 nm/280 nm) to determine concentrations and to estimate the purity of the nucleic acids. 2.2. PCR amplification and genotyping Multiplex PCR was performed using the primers specified in Table 1. The primers were designed using software, OLIGO and GENETYX, and we selected those which have no homology between primers. Due to overlapping fragment sizes, amplifi-

cation products were fluorescent dye-labeled with different colors. PCR reaction was performed in a total volume of 30 ml containing 1–10 ng of genomic DNA, 10 mM of Tris–HCl (pH 8.3), 50 mM of KCl, 0.2 mg/ml of bovine serum albumin (BSA), 0.2 mM of dNTPs, 1.5 U of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA, USA), 2 mM of MgCl2, 0.066 mM of TH01, 0.047 mM of TPOX, 0.11mM of CSF1PO, and 0.238 mM of vWA. The cycling parameters were pre-PCR-denaturation at 95 8C for 2 min, followed by 32 cycles of denaturing at 94 8C for 45 s, annealing at 55 8C for 45 s, and extension at 72 8C for 45 s with a Takara PCR Thermal Cycler MP (Takara, Ohtsu, Japan). A final extension was performed at 72 8C for 10 min. PCR amplification and genotyping with GenePrint Fluorescent STR Multiplex Systems CTTv (Promega, Madison, WI, USA) were performed according to the manufacturer’s instructions [13]. To determine the minimum quantity of DNA required to obtain reliable results, we used genomic DNA extracted from the cell line K562 (Promega), which was sequentially diluted with distilled water (10 pg/ml, 100 pg/ml, and 1 ng/ ml). The final concentrations of template DNA in the assay were 30, 40, 50, 60, 70, 80, 90, 100, 150, 250 and 500 pg, 1, 2, 5 and 10 ng. PCR amplification was carried out using 1, 5 and 10 ng of DNA extracted from old bloodstains. Electrophoresis was performed using an ABI 310 Genetic Analyzer, and alleles were determined using GeneScan 2.1 software. Significant signal intensity was set at above 50 relative fluorescent units (RFU). Fragment sizes were determined using the internal

Table 1 Primer sequences Locus a

PCR primers (5 0 to 3 0 )

Dye

Product length (bp)

TH01 A TH01 B TPOX A TPOX B CSF1PO A CSF1PO B vWA A vWA B

CTCCCTTATTTCCCTCAT GTTTGTGCAGGTCACAGGGAACACAGAC CACTAGCACCCAGAACCATC [12] GTTTCCTTGTCAGCGTTTATTTGCC [12] CTGCCTTCATAGATAGAAGATAG GTTTCCTGTGTCAGACCCTGTTC ATAATCAGTATGTGACTTGGAT GTTTATGATAAATACATAGGATGGATG

HEX

74–98 (5–11 alleles) 107–135 (6–13 alleles) 90–122 (7–15 alleles) 99–143 (10–21 alleles)

HEX 6-FAM TET

a A, forward primer; B, reverse primer. The 5 0 sequence of the reverse primer consisted of GTTTX (X ¼ A, C or G) for strong promotion of adenylation [14–16].

K. Tsukada et al. / Legal Medicine 4 (2002) 239–245

standard GeneScan 500 (TAMRA, Applied Biosystems, Foster City, CA, USA). To verify the reliability of the new designed primer, we performed PCR amplification of DNA extracted from blood from 100 individuals using the newly designed multiplex system and the GenePrint Fluorescent STR Multiplex Systems CTTv, which is commercially available from Promega. 3. Results 3.1. Primer sequence and optimal PCR conditions From degraded DNA, we designed a pair of primers that yields from 74 to 143 bp of amplifying products to type. We then modified the 5 0 end of these reverse primers for strong promotion of adenylation. In this multiplex PCR system using a newly designed pair of primers shown Table 1, the Taq DNA polymerase resulted in the completely successful addition of an adenosine to the 3 0 end of PCR-amplified products (1A effect or adenylation). Although signals were weak, allele typing was successful using only 40 pg template DNA. However, we set the low template level to 80 pg in order to avoid allele drop-out. When the amount of template DNA was increased to 1 ng, the peak height increased significantly, while all allele typing became easier. This is shown in Fig. 1. The successful range for allele typing was 80 pg to 2 ng DNA usage. Broad, incomplete adenylation, and non-specific peaks were observed with DNA of 5 ng or more. The results of allele typing from blood from one

241

hundred individuals using the newly designed multiplex system were completely consistent with those obtained with the GenePrint Fluorescent STR Multiplex Systems CTTv from Promega. 3.2. Typing blood stains Based on analysis of the quality of DNA extracted from old bloodstains used in this experiment using agarose gel electrophoresis, we found that all of the extracted DNA showed smear patterns without high molecular DNA, indicating highly degraded DNA. When using as templates DNA extracted from bloodstains left for 18 years, we found that increasing the amount of template DNA made allele typing easier, more successful, and more accurate (Fig. 2). The same phenomenon was observed with bloodstain specimens 17 and 19 years old. The results of allele typing using DNA extracted from bloodstains left for 22 years were similar to those of allele typing of bloodstains left for 17–19 years. However, more non-specific peaks were observed than with bloodstain specimens 17–19 years old. When using 1 ng of DNA extracted from bloodstains left for 26 years, we achieved completely successful allele typing with only six samples. However, with 10 ng of DNA serving as the template, the results improved by another 11 samples, for 17 samples providing successful allele typing (Fig. 3). Non-specific peaks were observed regardless of the amount of DNA. In amplification of DNA using as templates bloodstains left for 17–26 years with the GenePrint Fluorescent STR Multiplex Systems CTTv, no signal peaks

Fig. 1. Electropherogram of amplified DNA from cell line K562. PCR amplification was carried out using 80 pg (A), using 1 ng (B) DNA as a template (allele 9.3 for TH01, alleles 9–10 for CSF1PO, alleles 8–9 for TPOX, and allele 16 for vWA).

242

K. Tsukada et al. / Legal Medicine 4 (2002) 239–245

Fig. 2. Electropherogram of amplified DNA from bloodstain left for 18 years. PCR amplification was carried out using 1 ng (A), using 10 ng (B) extracted DNA as template. (alleles 6–9 for TH01, alleles 11–12 for CSF1PO, alleles 9–11 for TPOX, and alleles 14–18 for vWA).

Fig. 3. Electropherogram of amplified DNA from bloodstain left for 26 years. Panel (A) shows that all allele typing was successful when using only 1 ng DNA, while panel (B) shows results for 10 ng DNA (alleles 8–9 for TH01, alleles 12–13 for CSF1PO, allele 8 for TPOX, and alleles 16–17 for vWA) Panels (C–E) show the results for 1, 5, and 10 ng DNA, respectively. (alleles 6–9 for TH01, alleles 10–12 for CSF1PO, allele 8 for TPOX, and alleles 16–18 for vWA). Asterisks do not indicate the peak of the TH01 locus, since the dye differs from that for TH01 locus.

Table 2 The results of allele typing using the newly developed multiplex PCR system and the GenePrint Fluorescent STR Multiplex Systems CTTv a Age (years) Total sample no. DNA amount (ng) Newly developed multiplex PCR system

TH01 TPOX CSF1PO 17

3

18

9

19

5

22

17

26

20

a

1 5 10 1 5 10 1 5 10 1 5 10 1 5 10

2 2 3 6 7 7 3 4 4 10 15 15 6 14 17

2 loci TH01 CSF1PO vWA

TH01 CSF1PO

1 locus TH01 vWA

CSF1PO vWA

ND ND

TH01 CSF1PO

1 1 1

2 2 1 1 1

1

1

2 4

1

2 1 1 7 1 1

1 1

1

2

1 1 1

1 2 1 1

1

1

3 3 3 9 9 9 5 5 5 17 17 17 20 20 20

K. Tsukada et al. / Legal Medicine 4 (2002) 239–245

4 loci 3 loci

CTTv

CTTv, GenePrint Fluorescent STR Multiplex Systems CTTv; ND, number of loci not detected.

243

244

K. Tsukada et al. / Legal Medicine 4 (2002) 239–245

were detected in a range of 1–10 ng DNA usage (Table 2).

4. Discussion It has been reported that the addition of a final extension step of 60 or 72 8C for 10–30 min to the PCR amplification protocol can lead to a nucleotide that is essentially complete [13,17,18]. However, in this experiment, we designed the 5 0 end of reverse primer consisting of GTTTX (X ¼ A, C, or G) by inducing complete nucleotide addition to the 3 0 end of PCR amplified products. It appears that adenylation was completely successful, since no double peak was observed by allele typing using the ABI Prism 310 Genetic Analyzer. This newly developed multiplex system is one of the most sensitive systems known [1,2,19]. It was able to determine every allele of four loci, even with 80 pg of template DNA. It offers the potential for easy, effective typing of different alleles of four loci using limited samples. The DNA extracted from old bloodstains was highly degraded. However, in our experiment, when PCR amplification was performed using DNA extracted from old specimens and the amount of template DNA increased, alleles were easily detected, since sufficient PCR products were obtained. But despite increasing the amount of template DNA, we failed to type some specimens. These were the same specimens in each case. We believe these specimens were very highly degraded. On the other hand, although the size of the amplicon of the TH01 locus was smallest, some specimens could be identified only by the CSF1PO locus, which is larger than the TH01 locus. However, when the amount of template DNA was increased, other loci containing TH01 locus were also detected. We speculated that it had influenced that degradation occurs at random rather than occurs regularly. In our study, even if multiplex PCR did not successfully detect all the loci, we found that allele typing of three or two or one loci to be successful. It was easier to detect TH01 and CSF1PO loci than TPOX and vWA using DNA extracted from bloodstains left for 17–26 years. The size of the amplicon appears to significantly influence PCR amplification efficiency,

since the amplicon of TH01 and CSF1PO loci is smaller than that of TPOX and vWA loci. Our results demonstrate that small amplicons are suitable for degraded specimens, which was also shown in previous papers [20,21]. In this experiment, we designed pair of primers so that the amplicon might be less than 150 bp. However, for success with highly degraded specimens, we must design primers such that the amplicon is 100 bp or less. When increasing the template DNA extracted from hair or bone for PCR amplification, we know that the prevention substance left behind and not removed in the extraction prevents PCR reactions [22–24]. When using DNA extracted from bloodstains left for 26 years, we found that PCR efficiency did not depend on template DNA concentrations, in contrast to results with bloodstains of 17–19 or 22 years old. Apparently, the degradation of DNA and/or a PCR inhibitor that remains behind in the extraction step may be created by aging. Thus, we believe it is necessary to examine the method of DNA extraction for the allele typing of degraded specimens, and that PCR amplification is carried out with the amount of template DNA suitable for the condition of the specimens. This multiplex PCR system enabled allele typing of DNA samples from old bloodstains, demonstrating potential as a powerful tool for the identification of individuals in forensic science.

References [1] Fujii K, Senju H, Yoshida K, Sekiguchi K, Imaizumi K, Kasai K, Sato H. Multiplex PCR amplification of TH01, D9S304, and D3S1744 loci. J Hum Genet 2000;45(5):303–304. [2] Lederer T, Seidl S, Graham B, Betz P. A new pentaplex PCR system for forensic casework analysis. Int J Legal Med 2000;114(1-2):87–92. [3] Ota M, Katsuyama Y, Liu C, Takayanagi K, Asamura H, Fukushima H. Allelic structure and distribution of two STR loci, D8S580 and D22S442, in the Japanese population. Forensic Sci Int 2001;119(1):82–86. [4] Liu C, Ota M, Katsuyama Y, Takayanagi K, Asamura H, Fukushima H. The structure, frequency, and forensic application of the STR locus D16S543 in the Japanese population. J Forensic Sci 2001;46(1):116–119. [5] Liu C, Takayanagi K, Asamura H, Ota M, Saito S, Tsukada K, Fukushima H. Investigation of ACTBP2 mutations in the Japanese population. Legal Med. 2000;2:75–78. [6] Edwards A, Hammond HA, Jin L, Caskey CT, Chakraborty R. Genetic variation at five trimeric and tetrameric tandem repeat

K. Tsukada et al. / Legal Medicine 4 (2002) 239–245

[7] [8]

[9]

[10]

[11]

[12]

[13] [14]

[15]

[16]

loci in four human population groups. Genomics 1992;12:241–253. Caskey CT, Hammond HA. Forensic use of short tandem repeats via PCR. Adv Forensic Haemogenet 1992;4:18–25. Roewer L, Epplen JT. Rapid and sensitive typing of forensic stains by PCR amplification of polymorphic simple repeat sequences in case work. Forensic Sci Int 1992;53:163–171. Hellmann A, Rohleder U, Schmitter H, Wittig M. STR typing of human telogen hairs–a new approach. Int J Legal Med 2001;114(4-5):269–273. Wiegand P, Kleiber M. Less is more – length reduction of STR amplicons using redesigned primers. Int J Legal Med 2001;114:285–287. Wallin JM, Buoncristiani MR, Lazaruk K, Fildes N, Holt C, Walsh PS. TWGDAM validation of the AmpFlSTRTM Blue PCR Amplification Kit for forensic casework analysis. J Forensic Sci 1998;43(4):854–870. Anker R, Steinbrueck T, Donis-Keller H. Tetranucleotide repeat polymorphism at the human thyroid peroxidase (hTPO) locus. Hum Mol Genet 1992;1:137. Promega Corporation. Gene Print STR technical manual. Madison, WI: Promega, 1999. Smith JR, Carpten JD, Brownstein MJ, Ghosh S, Magnuson VL, Gilbert DA, Trent JM, Collins FS. Approach to genotyping errors caused by nontemplated nucleotide addition by Taq DNA polymerase. Genome Res 1995;5(3):312–317. Ginot F, Bordelais I, Nguyen S, Gyapay G. Correction of some genotyping errors in automated fluorescent microsatellite analysis by enzymatic removal of one base overhangs. Nucleic Acids Res 1996;24(3):540–541. Michael J, Brownstein MJ, Carpten JD, Smith JR. Modulation of non-templated nucleotide addition by Taq DNA polymer-

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

245

ase: primer modifications that facilitate genotyping. Biotechniques. 1996;20(6):1004–1010. Walsh PS, Fildes NJ, Reynolds R. Sequence analysis and characterization of stutter products at the tetranucleotide repeat locus vWA. Nucleic Acids Res 1996;24(14):2807– 2812. Junge A, Steevens M, Madea B. ACTBP2, D21S11, and D12S391: Experiences with the ABI Prism(TM) 310 Genetic Analyzer. Prog Forensic Genet 2000;8:448–450. Schroer K, Schmitt C, Staak M. Analysis of the co-amplified STR loci D1S1656, D12S391 and D18S51: population data and validation study for a highly discriminating triplex-PCR. Forensic Sci Int 2000;113(1-3):17–20. Yoshida K, Sekiguchi K, Kasai K, Sato H, Seta S, Sensabaugh GF. Evaluation of new primers for CSF1PO. Int J Legal Med 1997;110(1):36–38. Takeshita H, Yasuda T, Nakajima T, Nakashima Y, Mori S, Mogi K, Kishi K. Simultaneous typing of the STR loci, vWA and HumTPO, using discontinuous polyacrylamide gel electrophoresis. Legal Med 1999;1:135–139. Yoshii T, Tamura K, Ishiyama I. Presence of a PCR-inhibitor in hairs (in Japanese). Nippon Hoigaku Zasshi 1992;46(5):313–316. Yoshii T, Tamura K, Taniguchi T, Akiyama K, Ishiyama I. Water-soluble eumelanin as a PCR-inhibitor and a simple method for its removal (in Japanese). Nippon Hoigaku Zasshi 1993;47(4):323–329. Cattaneo C, Craig OE, James NT, Sokol RJ. Comparison of three DNA extraction methods on bone and blood stains up to 43 years old and amplification of three different gene sequences. J Forensic Sci 1997;42(6):1126–1135.