Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products

Resource

Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products Graphical Abstract

Authors Caiping Tian, Rui Sun, Keke Liu, ..., Wanqi Zhou, Yong Yang, Jing Yang

Correspondence [email protected]

In Brief Tian et al. develop a chemoproteomic strategy, termed multiplexed thiol reactivity profiling (MTRP), to sitespecifically map protein targets of several electrophilic natural products, including gambogic acid, acetylbritannilactone, costunolide, dehydrocostus lactone, eupalinolide A, eupalinilide B, isoalantolactone, and yejunualactone.

Highlights d

MTRP enables site-specific target profiling of electrophilic natural products

d

Gambogic acid as the first covalent inhibitor of XPO2mediated nuclear transportation

d

d

Structurally diversified a,b-unsaturated g-lactones exhibit disparate target profiles Acetylbritannilactone inhibits HSP60 chaperone activity through covalent binding

Tian et al., 2017, Cell Chemical Biology 24, 1–12 November 16, 2017 ª 2017 Elsevier Ltd. http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Cell Chemical Biology

Resource Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products Caiping Tian,1 Rui Sun,1,2 Keke Liu,1 Ling Fu,1 Xiaoyu Liu,3 Wanqi Zhou,3 Yong Yang,2 and Jing Yang1,4,* 1State Key Laboratory of Proteomics, Beijing Proteome Research Center, National Center for Protein Sciences - Beijing, Beijing 102206, China 2State Key Laboratory of Natural Medicines, Jiangsu Key Laboratory of Drug Discovery for Metabolic Disease, Center for New Drug Safety Evaluation and Research, China Pharmaceutical University, Nanjing 211198, China 3State Key Laboratory of Bioactive Substances and Functions of Natural Medicines, Institute of Materia Medica, Beijing Key Laboratory of Active Substances Discovery and Druggability Evaluation, Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing 100050, China 4Lead Contact *Correspondence: [email protected] http://dx.doi.org/10.1016/j.chembiol.2017.08.022

SUMMARY

Electrophilic groups, such as Michael acceptors, expoxides, are common motifs in natural products (NPs). Electrophilic NPs can act through covalent modification of cysteinyl thiols on functional proteins, and exhibit potent cytotoxicity and anti-inflammatory/cancer activities. Here we describe a new chemoproteomic strategy, termed multiplexed thiol reactivity profiling (MTRP), and its use in target discovery of electrophilic NPs. We demonstrate the utility of MTRP by identifying cellular targets of gambogic acid, an electrophilic NP that is currently under evaluation in clinical trials as anticancer agent. Moreover, MTRP enables simultaneous comparison of seven structurally diversified a,b-unsaturated g-lactones, which provides insights into the relative proteomic reactivity and target preference of diverse structural scaffolds coupled to a common electrophilic motif and reveals various potential druggable targets with liganded cysteines. We anticipate that this new method for thiol reactivity profiling in a multiplexed manner will find broad application in redox biology and drug discovery.

INTRODUCTION Natural products (NPs) have historically been the valuable inspiration for drug discovery and chemical biology (Newman and Cragg, 2016; Rodrigues et al., 2016). Electrophilic groups, such as Michael acceptors, epoxides, are common motifs in NPs (Gersch et al., 2012). Electrophilic NPs can act through covalent modification of biological nucleophiles, especially reactive cysteinyl thiols on functional proteins, and exhibit potent cytotoxicity and anti-inflammatory/cancer activities. Understanding the protein targets of electrophilic NPs is essential to deconvoluting the mechanisms of action underlying their biological or therapeutic action. Although many pharmacologically active electrophilic NPs have been undergoing development as drugs

or lead compounds, it has been difficult to determine the reactivity of these chemicals across native proteomes using traditional biochemical and pharmacological approaches. In the last decade, there have been tremendous advancements in the development and use of chemoproteomics to investigate target profile and engagement of thiol-reactive substances, including electrophilic NPs (Su et al., 2013; Wright and Sieber, 2016; Yang et al., 2016). Many studies have developed and synthesized functional analogs of lead compounds bearing either biotin or ‘‘clickable’’ handles for capturing their targeted proteins by covalent mechanism. The captured proteins can then be identified by mass spectrometry (MS)-based proteomics. This probe-centric chemoproteomic approach has been successfully applied to identify the cellular targets of many electrophilic NPs, such as adenanthin (Liu et al., 2012), ainsliadimer A (Dong et al., 2015), aminoepoxybenzoquinones (Mandl et al., 2016), myrtucommulone (Wiechmann et al., 2017), and kongensin A (Li et al., 2016). However, this directprobing approach might not always be applicable due to complicity of NP total-synthesis or the lack of information about structure-activity relationship in particular cases. Moreover, this approach can neither directly identify nor quantify the sitespecific electrophile-thiol reaction, which makes it difficult to understand the potency and target selectivity of these reactions. An alternative approach to characterizing the protein targets of electrophilic chemicals is to adapt activity-based protein profiling (ABPP) strategy to indirectly determine the proteomewide interactions of thiol-reactive electrophiles. For example, Cravatt and colleagues introduced a chemoproteomic platform termed competitive isoTOP (isotopic tandem orthogonal proteolysis)-ABPP and its uses in target discovery of hydrogen peroxide (Deng et al., 2013), lipid-derived electrophiles (Wang et al., 2014), environmental chemicals (Medina-Cleghorn et al., 2015), electrophilic ligands (Backus et al., 2016; Bateman et al., 2017), and reactive metabolites (Ford et al., 2017; Whitby et al., 2017). However, neither probe-centric chemoproteomic nor isoTOP-ABPP enables high-throughput quantification and comparison of changes of reactive thiol proteomes under various stimulations or perturbations. Here we describe a new chemoproteomic method, termed multiplexed thiol reactivity profiling (MTRP), for simultaneous determination of site-specific changes of cellular thiol proteome

Cell Chemical Biology 24, 1–12, November 16, 2017 ª 2017 Elsevier Ltd. 1

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Figure 1. Method Development and Validation of MTRP (A) Schematic workflow of MTRP. (B) Representative MS/MS spectrum of THUMPD1 C31 peptide labeled by both IPM and iTRAQ used for sequence assignment and reporter ion quantification. HeLa proteomes were labeled with the alkyne-tagged thiol-reactive reagent, IPM, and digested into tryptic peptides. The digest mixture was split into eight identical aliquots. Each was then labeled with one of the eight isobaric iTRAQ reagents, and the derivatized digests combined in a predefined ratio (1:1:2:2:5:5:10:10). After click chemistry and affinity enrichment, the alkylated peptides were photoreleased and analyzed by LC-MS/MS. The iTRAQ-tagged N terminus in the peptide sequence is labeled with red asterisk. (C) Intensity of iTRAQ reporter ions for IPMmodified peptides were measured as (B). Ratios were calculated relative to the mean peak intensity at 119.1 and 121.1. The distributions of these ratios demonstrate the accuracy of MTRP. Data are displayed using a log 2 scale on the x axis.

under up to eight different conditions. We demonstrate the utility of this method by global profiling the target engagement of several electrophilic NPs, including gambogic acid (GA) and seven naturally occurring electrophilic g-lactones with diverse structural scaffolds. Generally, our multiplexed quantification platform would greatly facilitate the analysis of target engagement of a variety of thiol-reactive substances, such as oxidants, metals, endogenous electrophiles, environmental contaminants, and covalent inhibitors. RESULTS AND DISCUSSION Method Development and Validation In previous works, we developed several quantitative chemoproteomic approaches to comprehensively analyze oxidative posttranslational modifications, such as S-sulfenylation and lipid electrophile-derived protein adductions (Gupta et al., 2017; Yang et al., 2014, 2015a, 2015b). Here we sought to combine the well-established chemoproteomic workflow with isobaric labeling techniques, because isobaric labels offer many advantages for quantitative proteomic analysis of chemical modifications. First, isobaric labeling facilitates a decrease in input material used for enrichment, because a peptide sequence with isobaric signatures from multiple samples appear as single MS1 peak in a mass spectrum. In addition, isobaric labels minimize run-to-run variations by enabling measurements across all samples with a single liquid 2 Cell Chemical Biology 24, 1–12, November 16, 2017

chromatography-tandem mass spectrometry (LC-MS/MS) experiment. This combination led to the development of a new method called MTRP, which enables simultaneous measurement of the reactivity of cysteinyl thiols toward various electrophilic NPs stimulation (up to eight different conditions including vehicle control) in native proteomes without requiring any chemical modification to the stimuli themselves. The workflow of MTRP is shown in Figure 1A. The electrophile-treated cellular thiol proteome samples are labeled with an alkynylated iodoacetamide probe (IPM) and digested with trypsin (Figure 1A). The resulting peptides from eight different samples are further derivatized with the 8-plex iTRAQ reagents (Ross et al., 2004), respectively, and then combine together equally. The iTRAQ and IPM doubly labeled peptides are conjugated by CuAAC (copper-catalyzed azide-alkyne cycloaddition) to an azide-biotin tag with photocleavable linker, followed by affinity capture, photorelease, and LC-MS/MS analysis (Figure 1A). Peptide identification and protein assembly are performed using a well-established informatics workflow (Ma et al., 2011; Zhang et al., 2014). Electrophilic NP-reactive cysteines are quantified by measuring the peak intensities of iTRAQ reporter ions and calculating the ratios for each reporter ion channels (electrophile treated) over the m/z 113.1 channel (vehicle control), with lower ratios representing greater sensitivity to the electrophile. Although iTRAQ was used in the MTRP workflow outlined here, it can be replaced with other isobaric labeling techniques of choice (e.g., TMT, NeuCode, DiLeu) (Hebert et al., 2013; Thompson et al., 2003; Xiang et al., 2010). To validate the qualitative capacity and quantitative accuracy of MTRP, eight aliquots of tryptic digests of the IPM-labeled HeLa proteome were derivatized with the 8-plex iTRAQ reagents, and then combined in a mixture of varying proportions

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Figure 2. Chemical Structures of Electrophilic Natural Products Used in this Study The major pharmacore (a,b-unsaturated ketone) of GA is shown in blue color, while the a-methylene-g-butyrolactone motifs are depicted in red color.

(1:1:2:2:5:5:10:10). After CuAAC and affinity enrichment, the IPM-modified peptides were photoreleased and analyzed using a single 75 min LC-MS/MS run, which enabled identification and quantification of 3,381 distinct matches from 2,526 peptides labeled by both IPM and iTRAQ tag (Table S1). As shown in Figure 1B, a typical MS/MS spectrum of this type of peptides would generate (1) backbone fragment ions such as b- and y-type ions for identifying the sequence assignment and site-localization, (2) diagnostic fragment ions from IPM-derived modification (DFI: m/z 311.1), along with (3) iTRAQ report ions, which can be used for multiplexed quantification. As demonstrated in Figure 1C, the measured ratios between the eight iTRAQ channels closely matched the known proportions across all the quantifiable cysteine containing peptides. Moreover, the peptide intensities from the paired iTRAQ channels with the same predefined proportion were highly correlated (Pearson correlation coefficient = 0.925–0.995; Figure S1A). The average coefficient of variation values of peptide intensity calculated from these paired iTRAQ channels range from 5.7% to 21.4%, demonstrating high precision of the MTRP workflow (Figure S1B). Identification and Validation of XPO2 as a Novel Cellular Target of GA GA (Figure 2) is an electrophilic NP from Garcinia hanburyi with well-documented anti-tumor activities both in vitro and in vivo (Gu et al., 2008; Kasibhatla et al., 2005; Li et al., 2013; Shi et al., 2014). Furthermore, GA has been approved by the Chinese Food and Drug Administration for the treatment of different cancers in clinical trials (Zhou and Wan, 2007). A number of GA targets have been characterized up to date. For example, GA has been suggested to directly inhibit various functionally important proteins, such as proteasome (Li et al., 2013), topoisomerase IIa (Qin et al., 2007), and Bcl-2 family proteins (Zhai et al., 2008). In addition, a few potential targets of GA including transferrin receptor and thioredoxins have been captured and elucidated with biotinylated GA probe and MS (Kasibhatla et al., 2005; Yang et al., 2012). More recently, the development of alkynyl

GA further facilitated global profiling of cellular targets of GA (Zhou et al., 2016). Nonetheless, the information about potency and site selectivity of GA on cellular thiol proteome remains largely unknown. To illustrate the utility of MTRP, we first applied it to globally investigate target engagement of GA in tumor cells. We treated U2OS cells with different concentration of GA (from 0.05 to 5 mM) for 2 hr. The cellular proteomes were harvested, lysed, and labeled with IPM probe, followed by tryptic digestion. The resulting peptides were then labeled with 8-plex isobaric tags and combined in mixture of equal proportions. The IPM-labeled peptides were enriched and analyzed as aforementioned. We identified a cluster of cysteines of which the reactivities toward IPM were competitively inhibited by GA in a dose-dependent manner, whereas the majority of protein thiols display low or none-reactivity toward GA (Figure 3A; Table S2). To further determine the potency of GA-thiol binding activities, we estimated half maximal inhibitory concentration (IC50) values for GA-blockage of thiol-reactive probe labeling and then defined 22 cysteine sites on 19 proteins with IC50 values less than 5 mM as the most likely targets of GA (Table S3). Notably, almost half of these candidate targets can also be found in the list of potential GA targets revealed by a probe-centric chemoproteomic analysis reported recently (Zhou et al., 2016) (Figure S2A; Table S3). Besides, the latter approach identified many more candidate targets compared with MTRP (Figure S2A and Table S3). However, a major limitation of such protein-level identifications is false-positive identifications due to nonspecifically captured proteins and other co-captured proteins binding to the direct targets of a tested compound. Moreover, probecentric chemoproteomics may identify many electrophile-protein adductions with low stoichiometry, which do not necessarily imply any functional consequences (Federspiel et al., 2016). Accordingly, it remains unknown how many of proteins captured and identified exclusively by the probe-centric approach are the direct targets of GA and what are the relative occupancies of GAderived adductions on them. Theoretically, GA may also react with other nucleophilic amino acids beyond cysteine in proteomes, and these reactions could not be quantitatively profiled by MTRP. However, we and others demonstrated previously that GA as well as other a,b-unsaturated ketones predominately target protein cysteinyl thiols in biological systems (Weerapana et al., 2008; Yang et al., 2012; Yang et al., 2015b). Using gene ontology (GO) classification, we found that 19 candidate targets of GA identified in this study are significantly enriched in nuclear transport process (p = 6.4 3 10 4). Among the proteins in this GO-classified module was XPO2 (also known Cell Chemical Biology 24, 1–12, November 16, 2017 3

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Figure 3. Identification and Functional Validation of XPO2 as a Major Cellular Target of GA (A) Boxplot showing the distribution of measured ratios for the cysteines quantified by MTRP in each concentration group. (B) IC50 curves derived from MTRP experiment showing the potency of GA on C842 and C939 in XPO2. (C) Representative MS/MS spectra of XPO2 C842 (upper) and C939 (lower) peptide labeled by both IPM and iTRAQ tag. The iTRAQ-tagged N terminus and/or lysine in the peptide sequence are labeled with red asterisks. (D–E) Western blot derived from iso-thermo dose-response experiment (D) and thermo shift assay (E) confirming the stabilization of XPO2 by GA in U2OS cell lysates. (F) Densitometric analysis of XPO2 bands in the U2OS cell lysates treated with or without GA shown in (E). Data are presented as mean values ± SD, n = 3. (G) Binding of XPO2 in U2OS cells to different dose of GA-biotin were captured by streptavidin beads and detected by western blotting. (H) Protein binding to GA-biotin (5 mM) with or without GA competition (2.5 mM) was subjected to streptavidin enrichment and western blotting. (I) GA disrupts XPO2-mediated nuclear transportation. U2OS cells were treated with 5 mM GA for 1 hr. The distribution of XPO2 (red) and its cargo protein KPNA2 (green) were detected by immunofluorescence as described in the STAR Methods. Scale bars represent 10 mm.

as the human cellular apoptosis susceptibility protein, hCSE1L/ CAS), a nuclear transporter that plays an important role in nuclear-to-cytoplasm transport and chromosome segregation during mitosis, cellular proliferation, and apoptosis (Alnabulsi et al., 2012; Pimiento et al., 2016). C842 of XPO2 was reactive to GA with relatively high potency (IC50 = 3.1 mM), while C939 was moderately responsive to GA treatment (Figures 3B and 3C). The expression of this protein was unchanged upon 2 hr GA treatment, which ruled out the possibility that the reductions in probe labeling for these detected cysteines reflect a decrease in its overall protein abundance (Figure S2B). We next sought to validate whether XPO2 was targeted directly by GA using several orthogonal approaches. First, in an iso-thermo dose-response experiment (Jafari et al., 2014), an increased presence of XPO2 was observed as the GA concentration is increased (Figure 3D). Second, in a thermal shift assay (Martinez Molina et al., 2013), GA could efficiently stabilize XPO2 with the tested temperature range, whereas the vehicle did 4 Cell Chemical Biology 24, 1–12, November 16, 2017

not result in any stabilization (Figure 3E). The thermal shift (DTm) was determined as 7.7 C by comparing DMSO-treated samples with GA-treated samples by fitting a sigmoid model to each (Figure 3F). If a protein is bound or modified by a small molecule, it can be stabilized compared with the non-engaged counterpart (Martinez Molina et al., 2013). These results therefore clearly demonstrated a direct binding of GA to XPO2. To further confirm this finding, we treated U2OS cells with a biotinylated GA (Figures S2C and S2D) and captured its binding targets with streptavidin. The pull-down proteins were detected by western blotting with the antibody against XPO2. The signal intensity of the band corresponding to XPO2 increased along with the treatment of GA-biotin in a concentration-dependent manner (Figure 3G). In addition, the signal generated by GA-biotin-XPO2 interaction could be abolished by pre-incubation of GA (Figure 3H). Furthermore, double mutation of C842 and C939 to alanine almost completely abolished GA’s ability to bind to XPO2 (Figure S2E). Taken together, these results confirmed that GA can efficiently

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

molecular sensor for DNA damage (Collis et al., 2005), displays varying sensitivity to GA (IC50 values range from 0.11 to 4.59 mM; Table S3), suggesting a potential role of this protein in regulation of GA-triggered DNA damage (Rong et al., 2010). Another interesting candidate target of GA is C222 of TELO2 (telomere maintenance 2, IC50 = 4.35 mM; Table S3), a regulator of telomere length linked to cell-cycle progression and apoptosis (Jiang et al., 2003). Whether GA-targeted TELO2 can synergize with the inhibitory effect of GA on telomerase reported previously (Wu et al., 2004; Zhao et al., 2008) and promote telomere shortening in cancer cells merits further exploration. Regardless, our results together with previous findings point to the potential for GA to produce polypharmacological effects by acting on multiple biologically important targets in cells.

Figure 4. Working Model: GA Binds to XPO2 and Interrupts Its Function

and specifically interact with XPO2 by covalently modifying two reactive cysteines. Because XPO2 is associated with tumor cell proliferation, and apoptosis and is overexpressed in many cancers (Tanaka et al., 2007; Winkler et al., 2014), we next asked whether the anti-tumor effect of GA is due to the disruption of XPO2-mediated nuclear transportation. We transiently transfected U2OS cells with small interfering RNA and found that the knock down of XPO2 could phenocopy results obtained using GA by inducing apoptosis (Figure S3). This finding mechanistically corroborates the evidence that XPO2 is one of the major targets of GA. Because short-term GA treatment was not able to induce dramatic changes in expression level of XPO2 (Figure S2B), we hypothesized that GA might regulate this protein by disrupting its cellular location and transporter function. We therefore sought to use an immunofluorescence approach to directly visualize and track XPO2 and its major cargo protein, KPNA2 (also known as importin subunit a-1) (Kutay et al., 1997), in cells treated with or without GA. Interestingly, we found that XPO2 significantly increased in the nuclear while it decreased in the cytosol counterpart of U2OS cells upon GA treatment (Figure 3I). Meanwhile, KPNA2 also dramatically increased in the nuclear compartment upon GA treatment (Figure 3I), indicating that the nuclear-to-cytoplasm transport of KPNA2 mediated by XPO2 is inhibited by GA (Figure 4). Taken together, GA might function as, to the best of our knowledge, the first covalent inhibitor of XPO2-mediated nuclear transportation, although XPO2 could be targeted by other NPs such as tetrahydropyrans in a reversible manner (Voigt et al., 2013). In this regard, GA might serve as a chemical tool for better understanding the biological functions of XPO2. Although our results suggested that perturbation of nuclear transportation is an important component of GA action, it might not explain solely the full inhibitory effect of GA in tumor cells. Our data contain many other interesting candidate targets of GA for future studies. For example, we found three cysteines of PRKDC (DNA-dependent protein kinase catalytic subunit), a

Disparate Thiol Reactivity Profiles of a,b-Unsaturated g-Lactones The a-methylene-g-butyrolactone structural motif is found in approximately 3% of all known NPs (Kitson et al., 2009). They feature an exocyclic Michael acceptor that is believed to serve as the electrophilic center (Kunzmann et al., 2011). Notably, many of these g-lactones possess useful biological activities against cancer, malaria, bacteria, and viruses (Cantrell et al., 1998; Choi, 2011; Jeong et al., 2007; Kretschmer et al., 2012; Peng et al., 2017). However, the protein targets of these bioactive g-lactones, as well as the mechanisms of action underlying their therapeutic effects, remain largely unknown. Here we utilized MTRP to globally and simultaneously profile site-specific targets of seven structurally diversified a,b-unsaturated g-lactones with different levels of cytotoxicity (Figures 2 and S4A), including acetylbritannilactone (ACE), costunolide (COS), dehydrocostus lactone (DEH), eupalinolide A (EUA), eupalinilide B (EUB), isoalantolactone (ISO), and yejunualactone (YEJ). HeLa lysates were pretreated with DMSO(vehicle control) or an a,b-unsaturated g-lactone and then labeled with IPM. The labeled lysates were then processed to tryptic peptides, labeled with isobaric mass tags, and combined equally. The peptide mixture was conjugated with azido-UV-biotin via CuAAC, enriched with streptavidin, and photoreleased for LC-MS/MS analysis. The m/z 113.1-report ion channel was reserved for the vehicle control, which provided a normalization value to calculate competition ratios for each tested lactone. We screened these NPs at two different concentrations, 30 and 300 mM, respectively. A 30 mM concentration was used mainly for target discovery, since it is close to the median of the IC50 values of all cytotoxic lactones examined (range from 16.5 to 63.2 mM) (Figure S4A). A 300 mM concentration, similar to the compound concentrations used in fragment-based ligand discovery (Backus et al., 2016; Bateman et al., 2017; Parker et al., 2017), was, however, applied to investigate the ligandability of cysteines in native proteome. In total, 2,523 cysteines of 1,482 proteins were quantified across the obtained datasets (Figure S4B; Table S4). Lactone-targeted cysteines were defined as those showing R50% reductions in IPM labeling (R % 0.5). The proteomic reactivity value of each lactone was then calculated as percentage of the cysteines targeted by a lactone per total quantified cysteines in MTRP experiments. As a result, all tested lactones exhibited a low reactivity across the thiol proteome at a low concentration (30 mM), with a proteomic reactivity range Cell Chemical Biology 24, 1–12, November 16, 2017 5

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Figure 5. Analysis of Interactions between Electrophilic Lactones and Thiol Proteome (A) Comparison of the proteomic reactivities of lactones screened at 30 versus 300 mM concentration in cell lysates. (B) Heatmap showing R values for all cysteines that can be targeted by at least one g-lactone examined at a 30 mM concentration (R%0.5). (C) Representative MS/MS spectra of EEF2 C41 peptide labeled by both IPM and iTRAQ tag from low (upper) and high (lower) concentration treatment experiments. The iTRAQ-tagged N terminus and/or lysine in the peptide sequence are labeled with red asterisks. (D) Principal coordinates analysis showing disparate target profiles of seven lactones at 30 and 300 mM concentrations in cell lysates.

from 0.22% to 1.71% (Figure 5A). Increase of concentration dramatically enhanced the proteomic reactivity of most lactones, including ACE, COS, DEH, EUA, and EUB. Although ISO showed the highest level of proteomic reactivity among all tested lactones at a 30 mM concentration, a 10-fold increase of ISO concentration only slightly changed its overall reactivity toward thiol proteome, which reflected rapid kinetics of ISO-cysteine reactions. Meanwhile, the low proteomic reactivity of YEJ was maintained along with the increase of its concentration, which suggested the lack of potency of this lactone. Of interest, YEJ showed negligible cytotoxicity to HeLa cells (Figure S4A). C41 of EEF2 represented a clear example of cysteines that could be targeted solely by ISO at low mM concentration (R30 = 0.47), while responded to, at high mM concentration, all examined lactones except YEJ (Figures 5B and 5C). Furthermore, no correlation was observed between the overall proteomic reactivity and the cytotoxicity profiles of the examined lactones (Figure S4C). This finding suggests that the cytotoxicity of an electrophilic 6 Cell Chemical Biology 24, 1–12, November 16, 2017

NP may not be simply predicted by its overall reactivity with proteomic thiols. On the other hand, based on the theory of Hard and Soft, Acids and Bases (Lopachin et al., 2012), the a-methylene-g-butyrolactone structural motif of the tested lactones is considered as a ‘‘hard’’ electrophile, which is lack of potency in reaction with a ‘‘soft’’ nucleophile-like protein cysteinyl thiol group. The specific covalent binding of these lactones to proteins should occur in at least two steps as described previously (Singh et al., 2011): the compound must first bind non-covalently to the target protein, placing its moderately reactive electrophile close to a specific thiol group on the protein. The resulting complex then undergoes specific bond formation, which gives rise to the covalently adducted complex. Because the tested lactones share the identical electrophilic motif, the potency and selectivity of these NPs and the resulting disparate thiol reactivity profiles (Figure 5D) should be mainly attributed to the non-covalent binding mediated by their distinct structural scaffolds. In other words, an electrophilic lactone, with a relatively low overall proteomic reactivity, can still selectively bind to a specific protein target. For example, despite the greater overall proteomic reactivity of ISO relative to other six lactones at a 30 mM concentration, several cysteines were preferentially targeted by the latter lactones rather than ISO (Figure 5B). In particular, among three cysteines of HSP60 (also known as HSPD1; Figure 6A), C442 was preferentially targeted by ACE (R30 = 0.45; Figures 6B and 6C). We also found reactivity of HSP60 C442 against ACE was concentration dependent (R300 = 0.03; Figures 6B and 6C). At a high mM concentration, ACE also marginally inhibited the probe-labeling reactivity of HSP60 C237 (R300 = 0.67), while COS and EDH exhibited considerable reactivity toward this site (R300 = 0.20 and 0.23, respectively). To verify the selectivity of ACE toward HSP60, we incubated recombinant HSP60 with seven examined

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Figure 6. Confirmation and Functional Analysis of ACE-Cysteine Interactions in HSP60 (A) Crystal structure of human HSP60 (PDB: 4PJ1). The structures were visualized using Discovery Studio v2.5. The annotated cysteine residues were shown in stick style. (B) Heatmap showing R values for the reactivity of three cysteines of HSP60 toward seven examined g-lactones. (C) Representative MS/MS spectrum of HSP60 C442 peptide labeled by both IPM and iTRAQ tag (113, DMSO; 114, COS; 115, YEJ; 116, EUA; 117, ACE; 118, ISO; 119, DEH; 121, EUB). The iTRAQ-tagged N terminus in the peptide sequence is labeled with red asterisks. (D) ACE preferentially blocked BIAM labeling of human recombinant HSP60. Human recombinant HSP60 (1 mM) was pre-incubated with the indicated lactones (3 mM) for 2 hr at 37 C and then a labeled 2 mM BIAM probe for 1 hr at room temperature. The BIAM-labeled proteins were detected with western blotting using HRP-streptavidin. (E) Representative MS/MS spectrum of HSP60 C442 peptide covalently modified with ACE. (F) ACE inhibited HSP60 chaperone activity in a concentration-dependent manner. Denatured MDH was incubated with pre-formed HSP60-HSP10 complex for 5 min at 27 C. HSP60 was treated with or without ACE. The refolding reaction was initialed by 2 mM ATP for 30 min at 27 C, and terminated by addition of glucose/ hexohinase, NADH, and oxaloacetate. Absorbance was monitored at 360 nm at 30 C. YEJ was used as a negative control. (G) ACE exhibited no inhibitory effect on native MDH activity. For (F) and (G), data are presented as mean values ± SD, n = 3.

lactones. After 2 hr of incubation, the reaction mixtures were then labeled with biotinylated iodoacetamide (BIAM) for 1 hr. The labeled proteins were analyzed with western blotting. As shown in Figure 6D, pre-incubation of ACE preferentially blocked BIAM labeling of HSP60. Furthermore, to verify the covalent nature of ACE-HSP60 interaction, we incubated recombinant HSP60 with ACE, and then subjected the digested peptides to LCMS/MS analysis. We identified an ACE-modified peptide bearing C442 of HSP60. As shown in Figure 6E, a group of modificationspecific fragment ions in the MS/MS spectra unequivocally pinpointed C442 as the precise adduction site of ACE on HSP60. Since C442 is critical to HSP60 chaperone activity (Nagumo et al., 2005), we next asked whether the binding of ACE to

HSP60 affected its ability to unfold aggregated malate dehydrogenase (MDH). When we pre-incubated HSP60 with ACE, MDH refolding was significantly inhibited in a concentration-dependent manner (Figure 6F). Meanwhile, we ruled out direct inhibitory effects of ACE on MDH function (Figure 6G). Of interest, HSP60 and other chaperones have been suggested as promising druggable targets for anticancer therapy (Taldone et al., 2014; Wu et al., 2017). Moreover, many naturally occurring compounds, including avrainvillamide (Wulff et al., 2007), 4-hydroxynonenal (Vila et al., 2008), and epolactaene (Nagumo et al., 2005), can either irreversibly or reversibly bind to HSP60 and inhibit its chaperone activity. Also, a recent study discovered myrtucoomulone as a novel binding partner and inhibitor of Cell Chemical Biology 24, 1–12, November 16, 2017 7

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Figure 7. Liganded Cysteines Targeted by Electrophilic Lactones (A) Heatmap showing R values for all g-lactone-liganded cysteines. (B) Percentage of proteins with g-lactone-liganded cysteines found in DrugBank. (C) Functional classification of DrugBank and non-DrugBank proteins with liganded cysteines.

HSP60 (Wiechmann et al., 2017). In addition to HSP60, other chaperone proteins can also be targeted by various NPs (Chini et al., 2016; Khandelwal et al., 2016; Li et al., 2016). These studies highlighted NPs as a valuable source to screen and discover lead compounds targeting key chaperones for anticancer therapy. Our dataset also provided an opportunity to assess the ligandability of cysteines in native proteome. In this regard, we defined liganded cysteines as those targeted by at least one examined lactone at 300 mM concentration (R300 % 0.5). In total, 339 liganded cysteines were identified on 264 proteins 8 Cell Chemical Biology 24, 1–12, November 16, 2017

(Table S5). Notably, only two proteins with liganded cysteines could be targeted by all seven lactones, including IPO7 (C736) and VDAC2 (C47), while most liganded cysteines exhibited distinct reactivity toward the lactones examined (Figure 7A). For example, C51 of PRDX4 (peroxiredoxin 4), a noncatalytic cysteine critical for the formation of active oligomer (Tavender et al., 2008), was solely targeted by EUA. In another example, the active cysteine of UBA6 (ubiquitin-like modifieractivating enzyme 6), C625 (Pelzer et al., 2007), was preferentially targeted by COX and DEH. GO classification further revealed that proteins with liganded cysteines were widely distributed in all major cellular compartment and mainly enriched in translation (p = 2.3 3 10 19, false discovery rate = 3.7 3 10 16, Table S6). Notably, cancer cells generally exhibited aberrant protein synthesis machinery and appear more vulnerable to inhibition of translation (Bhat et al., 2015; Silvera et al., 2010). Of interest, a variety of naturally occurring inhibitors of eukaryotic translation have been discovered and shown potent anticancer activity, including agelastatin A (McClary et al., 2017), lactimidomycin (Garreau de Loubresse et al., 2014; Schneider-Poetsch et al., 2010), mycalamide B (Dang et al., 2011), homoharringtonine (Stall and Knopf, 1978), and pateamine A (Low et al., 2005). Notably, one of these NPs, homoharringtonine (also known as omacetaxine, Synribo), has been approved by the US Food and Drug Administration as a treatment of chronic myeloid leukemia (Alvandi et al., 2014), which further validates inhibition of translation as a valuable anticancer strategy. Thus, our data would facilitate the future rational design of inhibitors of eukaryotic translation with improved potency, selectivity, and druggability for anticancer therapy. Notably, 22% of the proteins bearing lactone-liganded cysteines were found in the DrugBank database (Figure 7B; Table S5), which is much higher than that (14%) of synthetic fragment electrophile-liganded cysteines (Backus et al., 2016). Further, 76% DrugBank proteins with lactone-liganded cysteines possess enzymatic activities, while the non-DrugBank counterparts included diverse classes of proteins, including transporters, transcriptional factors, and translation regulators (Figure 7C). Among non-DrugBank proteins with liganded cysteines, many were considered difficult for synthetic small molecules to target. For example, signal transducer and activator of transcription 1 (STAT1) has been demonstrated as a viable target in the development of immunosuppressive agents (Frank et al., 1999). However, it has been challenging to develop a selective and potent inhibitor of this transcriptional factor. To date, the only one selective inhibitor of STAT1 is fludarabine, which was discovered almost two decades ago (Frank et al., 1999). Our data revealed a distinct interaction between ACE and C155 of STAT1 (Figure 7A). Future study about structure-activity relationship of this interaction might lead to the discovery of a novel class of STAT1 inhibitors. Conclusion In summary, the MTRP workflow outlined here represents a unique method for target discovery of electrophilic NPs. Notably, it offers a number of advantages over other existing chemoproteomic methods. First, MTRP enables target identifications in a site-specific and multiplexed manner with sufficient throughput for electrophilic NPs-based drug discovery. Second, MTRP

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

requires only 250 mg of input materials for each sample from different experimental groups. Third, MTRP, as an iTRAQ-based method, ensures a much faster and easier automatic readout of MS quantitation results, whereas the current quantitative chemoproteomic platforms typically require much longer analysis time for extracted ion chromatogram peak extraction and tedious manual inspection in some cases. Last, but not the least, MTRP can be easily adopted by researchers from academy and the pharmaceutical industry, since all reagents used in MTRP are commercially available. In addition, we include a step-by-step protocol of the MTRP method in the Supplemental Information. More generally, the ability to perform quantitative thiol reactivity profiling in a multiplexed manner would greatly facilitate the analysis of target profile and engagement of any thiol-reactive substances or spatiotemporal changes of redox proteomes.

B

Probe Labeling and Proteomic Sample Preparation LC-MS/MS B Peptide Identification and Quantification B R Ratio Processing and IC50 Calculation B Iso-Thermo Dose-Response Experiment B Thermal Shift Assay B HSP60 Adduction by ACE B Immunofluorescence B Immunoprecipitation B BIAM Labeling B Western Blotting B MDH Reactivation Assay B MTT Assay B Apoptosis Assay B Bioinformatics and Statistics DATA AND SOFTWARE AVAILABILITY B

d

SIGNIFICANCE SUPPLEMENTAL INFORMATION

Electrophilic natural products (ENPs) generally exhibit promising cytotoxicity and anti-inflammatory/cancer activities. Elucidating targets of bioactive ENPs is critical not only for better understanding of their mechanism of actions, but also for discovery of potential druggable targets. Here we describe a new chemoproteomic strategy, called multiplexed thiol reactivity profiling (MTRP), and its use to map the proteomic cysteine reactivity of several ENPs with intriguing biological activities. We first apply MTRP to gambogic acid, an ENP from Garcinia hanburyi with well-documented anti-tumor activities, and show that it can covalently modify two cysteine residues of XPO2 (C842 and C939), thereby resulting in the disruption of nuclear transportation and tumor cell death. Moreover, comparison of seven structurally diversified a,b-unsaturated g-lactones provides insights into the relative proteomic reactivity and target preference of diverse structural scaffolds coupled to a common reactive motif, and reveals a variety of potential druggable targets with liganded cysteines. These results highlight the utility of using MTRP to uncover global target profiles of ENPs and quantify the corresponding target engagement in parallel. In general, MTRP strategy would provide a potential framework for high-throughput screening any thiol-reactive chemicals, such as oxidants, metals, endogenous electrophiles, reactive drug metabolites, environmental contaminants, and covalent inhibitors. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cell Culture METHOD DETAILS B siRNA Transfection B Expression of Flag-Tagged XPO2/CSE1L Proteins B In Situ GA Treatment and Cell Lysis B In Vitro Lactones Treatment

Supplemental Information includes four figures, six tables, and supplemental text and can be found with this article online at http://dx.doi.org/10.1016/j. chembiol.2017.08.022. AUTHOR CONTRIBUTIONS J.Y. conceived and supervised the project, designed and developed the method, analyzed the data, and wrote the manuscript. C.T. performed all the experiments with help of S.R., L.F., L.K., Z.W., and Y.Y. X.L. synthesized the biotinylated GA. ACKNOWLEDGMENT This work was supported by the National Key R&D Program of China (no. 2016yfa0501303), the National Natural Science Foundation of China (no. 31500666 and no. 81573395), the Beijing Natural Science Foundation (no. 5162009), and Beijing Nova Program (no. z171100001117014) to J.Y. We thank Mr. Quan Zhou and Dr. Wenchuan Leng from analytical proteomics platform of National Center for Protein Sciences, Beijing, for their help and technical supports, Dr. Tetsuji Okamoto from Hiroshima University for kindly providing Flag-XPO2/CSE1L plasmid and its vector. Received: July 17, 2017 Revised: August 6, 2017 Accepted: August 30, 2017 Published: October 5, 2017 REFERENCES Alnabulsi, A., Agouni, A., Mitra, S., Garcia-Murillas, I., Carpenter, B., Bird, S., and Murray, G.I. (2012). Cellular apoptosis susceptibility (chromosome segregation 1-like, CSE1L) gene is a key regulator of apoptosis, migration and invasion in colorectal cancer. J. Pathol. 228, 471–481. Alvandi, F., Kwitkowski, V.E., Ko, C.W., Rothmann, M.D., Ricci, S., Saber, H., Ghosh, D., Brown, J., Pfeiler, E., Chikhale, E., et al. (2014). U.S. Food and Drug Administration approval summary: omacetaxine mepesuccinate as treatment for chronic myeloid leukemia. Oncologist 19, 94–99. Backus, K.M., Correia, B.E., Lum, K.M., Forli, S., Horning, B.D., GonzalezPaez, G.E., Chatterjee, S., Lanning, B.R., Teijaro, J.R., Olson, A.J., et al. (2016). Proteome-wide covalent ligand discovery in native biological systems. Nature 534, 570–574. Bateman, L.A., Nguyen, T.B., Roberts, A.M., Miyamoto, D.K., Ku, W.M., Huffman, T.R., Petri, Y., Heslin, M.J., Contreras, C.M., Skibola, C.F., et al. (2017). Chemoproteomics-enabled covalent ligand screen reveals a cysteine hotspot in reticulon 4 that impairs ER morphology and cancer pathogenicity. Chem. Commun. (Camb.) 53, 7234–7237.

Cell Chemical Biology 24, 1–12, November 16, 2017 9

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Bhat, M., Robichaud, N., Hulea, L., Sonenberg, N., Pelletier, J., and Topisirovic, I. (2015). Targeting the translation machinery in cancer. Nat. Rev. Drug Discov. 14, 261–278.

Jiang, N., Benard, C.Y., Kebir, H., Shoubridge, E.A., and Hekimi, S. (2003). Human CLK2 links cell cycle progression, apoptosis, and telomere length regulation. J. Biol. Chem. 278, 21678–21684.

Cantrell, C.L., Nunez, I.S., Castaneda-Acosta, J., Foroozesh, M., Fronczek, F.R., Fischer, N.H., and Franzblau, S.G. (1998). Antimycobacterial activities of dehydrocostus lactone and its oxidation products. J. Nat. Prod. 61, 1181–1186.

Kasibhatla, S., Jessen, K.A., Maliartchouk, S., Wang, J.Y., English, N.M., Drewe, J., Qiu, L., Archer, S.P., Ponce, A.E., Sirisoma, N., et al. (2005). A role for transferrin receptor in triggering apoptosis when targeted with gambogic acid. Proc. Natl. Acad. Sci. USA 102, 12095–12100.

Chini, M.G., Malafronte, N., Vaccaro, M.C., Gualtieri, M.J., Vassallo, A., Vasaturo, M., Castellano, S., Milite, C., Leone, A., Bifulco, G., et al. (2016). Identification of Limonol derivatives as heat shock protein 90 (Hsp90) inhibitors through a multidisciplinary approach. Chemistry 22, 13236–13250.

Kessner, D., Chambers, M., Burke, R., Agus, D., and Mallick, P. (2008). ProteoWizard: open source software for rapid proteomics tools development. Bioinformatics 24, 2534–2536.

Choi, E.M. (2011). Dehydrocostus lactone prevents mitochondrial dysfunction in osteoblastic MC3T3-E1 cells. Eur. J. Pharmacol. 664, 1–7.

Khandelwal, A., Crowley, V.M., and Blagg, B.S.J. (2016). Natural product inspired N-terminal Hsp90 inhibitors: from bench to bedside? Med. Res. Rev. 36, 92–118.

Collis, S.J., DeWeese, T.L., Jeggo, P.A., and Parker, A.R. (2005). The life and death of DNA-PK. Oncogene 24, 949–961.

Kim, S., and Pevzner, P.A. (2014). MS-GF+ makes progress towards a universal database search tool for proteomics. Nat. Commun. 5, 5277.

Dang, Y., Schneider-Poetsch, T., Eyler, D.E., Jewett, J.C., Bhat, S., Rawal, V.H., Green, R., and Liu, J.O. (2011). Inhibition of eukaryotic translation elongation by the antitumor natural product Mycalamide B. RNA 17, 1578–1588.

Kitson, R.R., Millemaggi, A., and Taylor, R.J. (2009). The renaissance of alpha-methylene-gamma-butyrolactones: new synthetic approaches. Angew. Chem. Int. Ed. 48, 9426–9451.

Deng, X., Weerapana, E., Ulanovskaya, O., Sun, F., Liang, H., Ji, Q., Ye, Y., Fu, Y., Zhou, L., Li, J., et al. (2013). Proteome-wide quantification and characterization of oxidation-sensitive cysteines in pathogenic bacteria. Cell Host Microbe 13, 358–370.

Kretschmer, N., Rinner, B., Stuendl, N., Kaltenegger, H., Wolf, E., Kunert, O., Boechzelt, H., Leithner, A., Bauer, R., and Lohberger, B. (2012). Effect of costunolide and dehydrocostus lactone on cell cycle, apoptosis, and ABC transporter expression in human soft tissue sarcoma cells. Planta Med. 78, 1749–1756.

Dong, T., Li, C., Wang, X., Dian, L., Zhang, X., Li, L., Chen, S., Cao, R., Li, L., Huang, N., et al. (2015). Ainsliadimer A selectively inhibits IKKalpha/beta by covalently binding a conserved cysteine. Nat. Commun. 6, 6522. Federspiel, J.D., Codreanu, S.G., Goyal, S., Albertolle, M.E., Lowe, E., Teague, J., Wong, H., Guengerich, F.P., and Liebler, D.C. (2016). Specificity of protein covalent modification by the electrophilic proteasome inhibitor Carfilzomib in human cells. Mol. Cell. Proteomics 15, 3233–3242.

Kunzmann, M.H., Staub, I., Bottcher, T., and Sieber, S.A. (2011). Protein reactivity of natural product-derived gamma-butyrolactones. Biochemistry 50, 910–916. Kutay, U., Bischoff, F.R., Kostka, S., Kraft, R., and Gorlich, D. (1997). Export of importin alpha from the nucleus is mediated by a specific nuclear transport factor. Cell 90, 1061–1071.

Ford, B., Bateman, L.A., Gutierrez-Palominos, L., Park, R., and Nomura, D.K. (2017). Mapping proteome-wide targets of Glyphosate in mice. Cell Chem. Biol. 24, 133–140.

Li, X., Liu, S., Huang, H., Liu, N., Zhao, C., Liao, S., Yang, C., Liu, Y., Zhao, C., Li, S., et al. (2013). Gambogic acid is a tissue-specific proteasome inhibitor in vitro and in vivo. Cell Rep. 3, 211–222.

Frank, D.A., Mahajan, S., and Ritz, J. (1999). Fludarabine-induced immunosuppression is associated with inhibition of STAT1 signaling. Nat. Med. 5, 444–447.

Li, D., Li, C., Li, L., Chen, S., Wang, L., Li, Q., Wang, X., Lei, X., and Shen, Z. (2016). Natural product Kongensin A is a non-canonical HSP90 inhibitor that blocks RIP3-dependent necroptosis. Cell Chem. Biol. 23, 257–266.

Garreau de Loubresse, N., Prokhorova, I., Holtkamp, W., Rodnina, M.V., Yusupova, G., and Yusupov, M. (2014). Structural basis for the inhibition of the eukaryotic ribosome. Nature 513, 517–522.

Liu, C.X., Yin, Q.Q., Zhou, H.C., Wu, Y.L., Pu, J.X., Xia, L., Liu, W., Huang, X., Jiang, T., Wu, M.X., et al. (2012). Adenanthin targets peroxiredoxin I and II to induce differentiation of leukemic cells. Nat. Chem. Biol. 8, 486–493.

Gersch, M., Kreuzer, J., and Sieber, S.A. (2012). Electrophilic natural products and their biological targets. Nat. Prod. Rep. 29, 659–682. Gu, H., Wang, X., Rao, S., Wang, J., Zhao, J., Ren, F.L., Mu, R., Yang, Y., Qi, Q., Liu, W., et al. (2008). Gambogic acid mediates apoptosis as a p53 inducer through down-regulation of mdm2 in wild-type p53-expressing cancer cells. Mol. Cancer Ther. 7, 3298–3305. Gupta, V., Yang, J., Liebler, D.C., and Carroll, K.S. (2017). Diverse redoxome reactivity profiles of carbon nucleophiles. J. Am. Chem. Soc. 139, 5588–5595. Hebert, A.S., Merrill, A.E., Bailey, D.J., Still, A.J., Westphall, M.S., Strieter, E.R., Pagliarini, D.J., and Coon, J.J. (2013). Neutron-encoded mass signatures for multiplexed proteome quantification. Nat. Methods 10, 332–334. Holman, J.D., Ma, Z.Q., and Tabb, D.L. (2012). Identifying proteomic LC-MS/ MS data sets with Bumbershoot and IDPicker. Curr. Protoc. Bioinformatics Chapter 13, Unit13.17. Huang da, W., Sherman, B.T., and Lempicki, R.A. (2009). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44–57. Jafari, R., Almqvist, H., Axelsson, H., Ignatushchenko, M., Lundback, T., Nordlund, P., and Martinez Molina, D. (2014). The cellular thermal shift assay for evaluating drug target interactions in cells. Nat. Protoc. 9, 2100–2122. Jeong, G.S., Pae, H.O., Jeong, S.O., Kim, Y.C., Kwon, T.O., Lee, H.S., Kim, N.S., Park, S.D., and Chung, H.T. (2007). The alpha-methylene-gamma-butyrolactone moiety in dehydrocostus lactone is responsible for cytoprotective heme oxygenase-1 expression through activation of the nuclear factor E2-related factor 2 in HepG2 cells. Eur. J. Pharmacol. 565, 37–44.

10 Cell Chemical Biology 24, 1–12, November 16, 2017

Lopachin, R.M., Gavin, T., Decaprio, A., and Barber, D.S. (2012). Application of the hard and soft, acids and bases (HSAB) theory to toxicant–target interactions. Chem. Res. Toxicol. 25, 239–251. Low, W.K., Dang, Y., Schneider-Poetsch, T., Shi, Z., Choi, N.S., Merrick, W.C., Romo, D., and Liu, J.O. (2005). Inhibition of eukaryotic translation initiation by the marine natural product pateamine A. Mol. Cell 20, 709–722. Ma, Z.Q., Tabb, D.L., Burden, J., Chambers, M.C., Cox, M.B., Cantrell, M.J., Ham, A.J., Litton, M.D., Oreto, M.R., Schultz, W.C., et al. (2011). Supporting tool suite for production proteomics. Bioinformatics 27, 3214–3215. Mandl, F.A., Kirsch, V.C., Ugur, I., Kunold, E., Vomacka, J., Fetzer, C., Schneider, S., Richter, K., Fuchs, T.M., Antes, I., et al. (2016). Natural-product-inspired aminoepoxybenzoquinones kill members of the Gram-negative pathogen salmonella by attenuating cellular stress response. Angew. Chem. Int. Ed. 55, 14852–14857. Martinez Molina, D., Jafari, R., Ignatushchenko, M., Seki, T., Larsson, E.A., Dan, C., Sreekumar, L., Cao, Y., and Nordlund, P. (2013). Monitoring drug target engagement in cells and tissues using the cellular thermal shift assay. Science 341, 84–87. McClary, B., Zinshteyn, B., Meyer, M., Jouanneau, M., Pellegrino, S., Yusupova, G., Schuller, A., Reyes, J.C.P., Lu, J., Guo, Z., et al. (2017). Inhibition of eukaryotic translation by the antitumor natural product Agelastatin A. Cell Chem. Biol. 24, 605–613.e5. Medina-Cleghorn, D., Bateman, L.A., Ford, B., Heslin, A., Fisher, K.J., Dalvie, E.D., and Nomura, D.K. (2015). Mapping proteome-wide targets of environmental

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

chemicals using reactivity-based chemoproteomic platforms. Chem. Biol. 22, 1394–1405. Nagumo, Y., Kakeya, H., Shoji, M., Hayashi, Y., Dohmae, N., and Osada, H. (2005). Epolactaene binds human Hsp60 Cys442 resulting in the inhibition of chaperone activity. Biochem. J. 387, 835–840. Newman, D.J., and Cragg, G.M. (2016). Natural products as sources of new drugs from 1981 to 2014. J. Nat. Prod. 79, 629–661. Parker, C.G., Galmozzi, A., Wang, Y., Correia, B.E., Sasaki, K., Joslyn, C.M., Kim, A.S., Cavallaro, C.L., Lawrence, R.M., Johnson, S.R., et al. (2017). Ligand and target discovery by fragment-based screening in human cells. Cell 168, 527–541.e29. Pelzer, C., Kassner, I., Matentzoglu, K., Singh, R.K., Wollscheid, H.P., Scheffner, M., Schmidtke, G., and Groettrup, M. (2007). UBE1L2, a novel E1 enzyme specific for ubiquitin. J. Biol. Chem. 282, 23010–23014. Peng, Z., Wang, Y., Fan, J., Lin, X., Liu, C., Xu, Y., Ji, W., Yan, C., and Su, C. (2017). Costunolide and dehydrocostuslactone combination treatment inhibit breast cancer by inducing cell cycle arrest and apoptosis through c-Myc/ p53 and AKT/14-3-3 pathway. Sci. Rep. 7, 41254. Pimiento, J.M., Neill, K.G., Henderson-Jackson, E., Eschrich, S.A., Chen, D.T., Husain, K., Shibata, D., Coppola, D., and Malafa, M.P. (2016). Knockdown of CSE1L gene in colorectal cancer reduces tumorigenesis in vitro. Am. J. Pathol. 186, 2761–2768. Qin, Y., Meng, L., Hu, C., Duan, W., Zuo, Z., Lin, L., Zhang, X., and Ding, J. (2007). Gambogic acid inhibits the catalytic activity of human topoisomerase IIalpha by binding to its ATPase domain. Mol. Cancer Ther. 6, 2429–2440. Rodrigues, T., Reker, D., Schneider, P., and Schneider, G. (2016). Counting on natural products for drug design. Nat. Chem. 8, 531–541. Rong, J.J., Hu, R., Song, X.M., Ha, J., Lu, N., Qi, Q., Tao, L., You, Q.D., and Guo, Q.L. (2010). Gambogic acid triggers DNA damage signaling that induces p53/p21(Waf1/CIP1) activation through the ATR-Chk1 pathway. Cancer Lett. 296, 55–64. Ross, P.L., Huang, Y.N., Marchese, J.N., Williamson, B., Parker, K., Hattan, S., Khainovski, N., Pillai, S., Dey, S., Daniels, S., et al. (2004). Multiplexed protein quantitation in Saccharomyces cerevisiae using amine-reactive isobaric tagging reagents. Mol. Cell. Proteomics 3, 1154–1169. Schneider-Poetsch, T., Ju, J., Eyler, D.E., Dang, Y., Bhat, S., Merrick, W.C., Green, R., Shen, B., and Liu, J.O. (2010). Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nat. Chem. Biol. 6, 209–217. Shi, X., Chen, X., Li, X., Lan, X., Zhao, C., Liu, S., Huang, H., Liu, N., Liao, S., Song, W., et al. (2014). Gambogic acid induces apoptosis in imatinibresistant chronic myeloid leukemia cells via inducing proteasome inhibition and caspase-dependent Bcr-Abl downregulation. Clin. Cancer Res. 20, 151–163. Silvera, D., Formenti, S.C., and Schneider, R.J. (2010). Translational control in cancer. Nat. Rev. Cancer 10, 254–266. Singh, J., Petter, R.C., Baillie, T.A., and Whitty, A. (2011). The resurgence of covalent drugs. Nat. Rev. Drug Discov. 10, 307–317. Spitzer, M., Wildenhain, J., Rappsilber, J., and Tyers, M. (2014). BoxPlotR: a web tool for generation of box plots. Nat. Methods 11, 121–122. Stall, A.M., and Knopf, P.M. (1978). The effect of inhibitors of protein synthesis on the reexpression of surface immunoglobulin following antigenic modulation. Cell 14, 33–42. Su, Y., Ge, J., Zhu, B., Zheng, Y.G., Zhu, Q., and Yao, S.Q. (2013). Target identification of biologically active small molecules via in situ methods. Curr. Opin. Chem. Biol. 17, 768–775. Taldone, T., Ochiana, S.O., Patel, P.D., and Chiosis, G. (2014). Selective targeting of the stress chaperome as a therapeutic strategy. Trends Pharmacol. Sci. 35, 592–603. Tanaka, T., Ohkubo, S., Tatsuno, I., and Prives, C. (2007). hCAS/CSE1L associates with chromatin and regulates expression of select p53 target genes. Cell 130, 638–650.

Tavender, T.J., Sheppard, A.M., and Bulleid, N.J. (2008). Peroxiredoxin IV is an endoplasmic reticulum-localized enzyme forming oligomeric complexes in human cells. Biochem. J. 411, 191–199. Thompson, A., Schafer, J., Kuhn, K., Kienle, S., Schwarz, J., Schmidt, G., Neumann, T., Johnstone, R., Mohammed, A.K., and Hamon, C. (2003). Tandem mass tags: a novel quantification strategy for comparative analysis of complex protein mixtures by MS/MS. Anal. Chem. 75, 1895–1904. Vila, A., Tallman, K.A., Jacobs, A.T., Liebler, D.C., Porter, N.A., and Marnett, L.J. (2008). Identification of protein targets of 4-hydroxynonenal using click chemistry for ex vivo biotinylation of azido and alkynyl derivatives. Chem. Res. Toxicol. 21, 432–444. Vizcaı´no, J.A., Csordas, A., Del-Toro, N., Dianes, J.A., Griss, J., Lavidas, I., Mayer, G., Perez-Riverol, Y., Reisinger, F., Ternent, T., et al. (2016). 2016 update of the PRIDE database and its related tools. Nucleic Acids Res. 44, D447–D456. Voigt, T., Gerding-Reimers, C., Ngoc Tran, T.T., Bergmann, S., Lachance, H., Scholermann, B., Brockmeyer, A., Janning, P., Ziegler, S., and Waldmann, H. (2013). A natural product inspired tetrahydropyran collection yields mitosis modulators that synergistically target CSE1L and tubulin. Angew. Chem. Int. Ed. 52, 410–414. Wang, C., Weerapana, E., Blewett, M.M., and Cravatt, B.F. (2014). A chemoproteomic platform to quantitatively map targets of lipid-derived electrophiles. Nat. Methods 11, 79–85. Weerapana, E., Simon, G.M., and Cravatt, B.F. (2008). Disparate proteome reactivity profiles of carbon electrophiles. Nat. Chem. Biol. 4, 405–407. Whitby, L.R., Obach, R.S., Simon, G.M., Hayward, M.M., and Cravatt, B.F. (2017). Quantitative chemical proteomic profiling of the in vivo targets of reactive drug metabolites. ACS Chem. Biol. 12, 2040–2050. Wiechmann, K., Muller, H., Konig, S., Wielsch, N., Svatos, A., Jauch, J., and Werz, O. (2017). Mitochondrial chaperonin HSP60 is the apoptosis-related target for myrtucommulone. Cell Chem. Biol. 24, 614–623.e6. Winkler, J., Ori, A., Holzer, K., Sticht, C., Dauch, D., Eiteneuer, E.M., Pinna, F., Geffers, R., Ehemann, V., Andres-Pons, A., et al. (2014). Prosurvival function of the cellular apoptosis susceptibility/importin-alpha1 transport cycle is repressed by p53 in liver cancer. Hepatology 60, 884–895. Wright, M.H., and Sieber, S.A. (2016). Chemical proteomics approaches for identifying the cellular targets of natural products. Nat. Prod. Rep. 33, 681–708. Wu, Z.Q., Guo, Q.L., You, Q.D., Zhao, L., and Gu, H.Y. (2004). Gambogic acid inhibits proliferation of human lung carcinoma SPC-A1 cells in vivo and in vitro and represses telomerase activity and telomerase reverse transcriptase mRNA expression in the cells. Biol. Pharm. Bull. 27, 1769–1774. Wu, J., Liu, T., Rios, Z., Mei, Q., Lin, X., and Cao, S. (2017). Heat shock proteins and cancer. Trends Pharmacol. Sci. 38, 226–256. Wulff, J.E., Herzon, S.B., Siegrist, R., and Myers, A.G. (2007). Evidence for the rapid conversion of stephacidin B into the electrophilic monomer avrainvillamide in cell culture. J. Am. Chem. Soc. 129, 4898–4899. Xiang, F., Ye, H., Chen, R., Fu, Q., and Li, L. (2010). N,N-Dimethyl leucines as novel isobaric tandem mass tags for quantitative proteomics and peptidomics. Anal. Chem. 82, 2817–2825. Yang, J., Li, C., Ding, L., Guo, Q., You, Q., and Jin, S. (2012). Gambogic acid deactivates cytosolic and mitochondrial thioredoxins by covalent binding to the functional domain. J. Nat. Prod. 75, 1108–1116. Yang, J., Gupta, V., Carroll, K.S., and Liebler, D.C. (2014). Site-specific mapping and quantification of protein S-sulphenylation in cells. Nat. Commun. 5, 4776. Yang, J., Gupta, V., Tallman, K.A., Porter, N.A., Carroll, K.S., and Liebler, D.C. (2015a). Global, in situ, site-specific analysis of protein S-sulfenylation. Nat. Protoc. 10, 1022–1037. Yang, J., Tallman, K.A., Porter, N.A., and Liebler, D.C. (2015b). Quantitative chemoproteomics for site-specific analysis of protein alkylation by 4-hydroxy-2-nonenal in cells. Anal. Chem. 87, 2535–2541. Yang, J., Carroll, K.S., and Liebler, D.C. (2016). The expanding landscape of the Thiol redox proteome. Mol. Cell. Proteomics 15, 1–11.

Cell Chemical Biology 24, 1–12, November 16, 2017 11

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Zhai, D., Jin, C., Shiau, C.W., Kitada, S., Satterthwait, A.C., and Reed, J.C. (2008). Gambogic acid is an antagonist of antiapoptotic Bcl-2 family proteins. Mol. Cancer Ther. 7, 1639–1646. Zhang, B., Wang, J., Wang, X., Zhu, J., Liu, Q., Shi, Z., Chambers, M.C., Zimmerman, L.J., Shaddox, K.F., Kim, S., et al. (2014). Proteogenomic characterization of human colon and rectal cancer. Nature 513, 382–387. Zhao, Q., Yang, Y., Yu, J., You, Q.D., Zeng, S., Gu, H.Y., Lu, N., Qi, Q., Liu, W., Wang, X.T., et al. (2008). Posttranscriptional regulation of the telomerase

12 Cell Chemical Biology 24, 1–12, November 16, 2017

hTERT by gambogic acid in human gastric carcinoma 823 cells. Cancer Lett. 262, 223–231. Zhou, Z.T., and Wan, J.W. (2007). Phase I human tolerability trial of gambogic acid. Chin. J. New Drug 1, 679–852. Zhou, Y., Li, W., Zhang, X., Zhang, H., and Xiao, Y. (2016). Global profiling of cellular targets of gambogic acid by quantitative chemical proteomics. Chem. Commun. (Camb.) 52, 14035–14038.

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Anti Flag

CWBI (http://www.cwbiotech.com/)

CW0287M

Anti XPO2/CSE1L

Abcam

Cat# ab96755; RRID: AB_10865417

Anti KPNA2

Sigma-Aldrich

Cat# I1784; RRID: AB_477088

Anti Beta-Actin

ZSGB-BIO (http://www.zsbio.com/)

TA-09

HRP-straptavidin

Cell Signaling Technologies

Cat# 3999S; RRID: AB_10830897

Antibodies

Streptavidin sepharose

General Electric Life Science

17-5113-01

Flag magnetic beads

Sigma-Aldrich

Cat# A2220; RRID: AB_10063035

Alexa-488-conjugated anti-mouse IgG

ZSGB-BIO

ZF-0512

Alexa-594-conjugated anti-rabbit IgG

ZSGB-BIO

ZF-0516

Goat anti mouse-HRP

ZSGB-BIO

ZDR5307

Goat anti rabbit-HRP

ZSGB-BIO

ZDR5306

Chemicals, Peptides, and Recombinant Proteins DMEM medium

HyClone, Logan, Utah, USA

SH30022.01

Fetal bovine serum (cell culture)

Life technologies

10270

DMSO

Sigma-Aldrich

D8418

Iodo-N-(prop-2-yn-1-yl) acetamide, IPM

KeraFast

EVU111

Iodoacetamide, IAM

Sigma-Aldrich

V900335

DTT

BBI Life Sciences

A100281

BIAM

Sigma-Aldrich

B2059

Azido-Biotin

KeraFast

EVU101

Azido-UV-Biotin

KeraFast

6720

Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA)

Sigma-Aldrich

678937

Sodium Ascobate

Sigma-Aldrich

A7631

CuSO4

Thermo Fisher Scientific

C493-500

Gambogic acid

Huzhou zhanshu bio technology co., ltd (http://www.zsuchem.com/)

2752-65-0

Biotinylated gambogic acid

Synthesized as we previously described.

Yang, et al., 2012

Acetylbritannilactone

Yuanye Biological (http://www.shyuanye.com/)

B21408

Costunolide

Yuanye Biological

B20891

Dehydrocostus lactone

Yuanye Biological

B21026

Eupalinolide A

Yuanye Biological

B21482

Eupalinilide B

Yuanye Biological

B20738

Isoalantolactone

Yuanye Biological

B21560

Yejunualactone

Yuanye Biological

B21481

DAPI

ZSGB-BIO

ZLI-9557

Sequencing grade trypsin

Promega

V5113

Bovine serum albumin

AMRESCO

0332

Catalase

Sigma-Aldrich

C9322

Human recombinant HSP60

Sino Biological (http://www.sinobiological.com/)

11322-H20E

Human recombinant HSP10

Sino Biological

11330-H07E (Continued on next page)

Cell Chemical Biology 24, 1–12.e1–e5, November 16, 2017 e1

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Human recombinant MDH

Sigma-Aldrich

M1567-5KU

ATP disodium salt

Sigma-Aldrich

10519987001

NADH disodium salt

Sigma-Aldrich

N8129

Critical Commercial Assays 8-plex iTRAQ kit

Sigma-Aldrich

4381663

BCA protein assay kit

Life Technologies

23225

HLB extraction cartridges

Waters

186000383

SCX spin columns

The Nest Group

SMM HIL-SCX

GenePharma (http://www.genepharma.com/)

N/A

Oligonucleotides siRNA: control UUCUCCGAACGUGUCACGUTT siRNA: XPO2 CGGGUCAAGAGGUUAAAUATT

GenePharma

N/A

Prime: XPO2 C842A GTAGAGAAAAAGATCGCCGCGG TTGGCATAAC

Tsingke (http://www.tsingke.net/)

N/A

Prime: XPO2 C939A CTTCACAAGTTGTCTACCGCCG CCCCAGGAAGGGTTCCATCAATG

Tsingke

N/A

HeLa

National Infrastructure of Cell Line Resource, Beijing, China

3111C0001CCC000011

U2OS

National Infrastructure of Cell Line Resource, Beijing, China

3111C0001CCC000028

This paper

PXD007575, 10.6019/ PXD007575.

MSConverter

http://proteowizard.sourceforge.net/tools.shtml

Version 3.0.5211

MS-GF+

https://omics.pnl.gov/software/ms-gf

version 9979

IDPicker

http://proteowizard.sourceforge.net/tools.shtml

version 3.1.10199.0

Origin

http://www.OriginLab.com

version 8

SPSS Statistics

https://www.ibm.com/analytics/us/en/technology/ spss/

version 22

Excel 2016

https://products.office.com/en/excel

N/A

Adobe Illustrator

http://www.adobe.com/Illustrator

version CS5.1

BoxPlotR

http://shiny.chemgrid.org/boxplotr

N/A

Experimental Models: Cell Lines

Deposited Data The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository Software and Algorithms

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources, reagents and the troubleshooting of MTRP protocol should be directed to and will be fulfilled by the Lead Contact, Jing Yang ([email protected]) EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Culture HeLa and U2OS cells were maintained at 37 C in a 5% CO2, humidified atmosphere and were cultured in DMEM medium containing 10% fetal bovine serum supplemented with 10% FBS, penicillin (100 U/mL), and streptomycin (100 mg/mL). METHOD DETAILS siRNA Transfection The siRNA duplexes were obtained from Genepharma (Suzhou, China). siRNA transfections were performed using RNAiMAX (Invitrogen, 13778-075), according to the manufacturer’s instructions. In brief, U2OS cells were seeded onto 6 cm diameter dishes to e2 Cell Chemical Biology 24, 1–12.e1–e5, November 16, 2017

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

reach 70-80% confluence. Cells were transfected twice with 10 nM control siRNA or CSE1L siRNA (5 mL of a 20 mM stock) using 7.5 mL RNAiMAX reagent. After 48 h of transfection, the XPO2/CSE1L knockdown cells were used for treatment or subjected to analysis. Expression of Flag-Tagged XPO2/CSE1L Proteins Full-length cDNA encoding human XPO2/CSE1L with Flag tag in pcDNA3.1/myc-His(-) A was kindly provided by Dr. Tetsuji Okamoto. C842A, C939A, C842/939A mutants were generated by QuikChange site-directed mutagenesis using the primers described in Key Resources Table and then cloned into pcDNA3.1/myc-His(-) A vector. Transfection was performed by incubating 30 mg of each of plasmids and 240 mL of polyethylenimine into 80%-confluent U2OS cells on a 10-cm dish. After 6 h of transfection, cells were cultured in regular DMEM medium with 10% FBS for another 48 h. In Situ GA Treatment and Cell Lysis U2OS cells were grown until 80–90% confluency, rinsed with 1X PBS quickly, and treated with GA prepared in serum-free medium as indicated concentrations and time. Treatments were stopped by removing the medium. Cells were then lifted with 0.25% trypsinEDTA (Invitrogen) and harvested by centrifugation at 1,500 x g for 3 min. Cell pellets were lysed on ice for 20 min in four volumes of NETN buffer (50 mM HEPES pH 7.5, 150 mM NaCl, and 1% Igepal) supplemented with inhibitor cocktails containing 200 unit/mL catalase. After centrifugation at 16,000 g for 5 min at 4 C, the supernatants were collected and adjusted to 2 mg/mL by BCA assay for the following preparation. In Vitro Lactones Treatment For each lactone treatment sample, 500 mL HeLa cell lysates were adjusted to 2.0 mg/mL and treated with 30 or 300 mM lactones by adding 100 mM stock solutions in DMSO. Probe Labeling and Proteomic Sample Preparation Protein samples from HeLa or U2OS cells were labeled with 100 mM IPM probe for 1h at room temperature (RT) with light protection. The labeling reactions were stopped by adding DTT (Final concentration=10 mM) and incubated at 75 C for another 15 min. The lysate was further incubated with 40 mM iodoacetamide at RT for 30 min in the dark. The reactions were quenched by protein precipitation, which was performed with a methanol-chloroform system (aqueous phase/methanol/chloroform, 4:4:1, v/v/v) as described previously (Yang et al., 2015a). In brief, proteins were collected at the aqueous/organic phase interface as a solid disk after centrifugation at 1,400 g for 20 min at 4 C. Liquid layers were discarded and the protein was washed twice in methanol/chloroform (1:1, v/v), followed by centrifugation at 16,000 x g for 10 min at 4 C to repellet the protein. The protein pellets were resuspended with 50 mM ammonium bicarbonate containing 0.2 M urea. For a typical MTRP experiment, each of the control and compound-treated proteome samples (2 mg protein/mL in 125 mL volume) were first digested with sequencing grade trypsin at a 1:50 (enzyme/substrate) ratio overnight at 37 C. A secondary digestion was performed by adding additional trypsin to a 1:100 (enzyme/substrate) ratio, followed by incubation at 37 C for additional 4 h. The tryptic digests were tried under vacuum with centrifugation, resuspended with 30 mL dissolution buffer (0.5 M triethylammonium Bicarbonate, TEAB, pH 8.5), and labeled with pre-dissolved 8-plex iTRAQ reagents (To each iTRAQ vial, add 50 mL isopropanol). After 2h reaction at RT, 8-plex iTRAQ-labeled samples were mixed and dried by under vacuum with centrifugation. The dried peptide mixtures were then dissolved and desalted with HLB extraction cartridges as previously described (Yang et al., 2015a). The desalted tryptic digests were reconstituted in a solution containing 30% acetonitrile (ACN). CuAAC reaction was performed in the presence of 1 mM Azido-UV-biotin, 10 mM sodium ascorbate, 1 mM TBTA, and 10 mM CuSO4. Samples were allowed to react at RT for 2 h in the dark with rotation. The excess biotin reagents were removed by strong cation exchange (SCX), as previously described (Yang et al., 2015a). In brief, the sample was diluted into SCX loading buffer (5 mM KH2PO4, 25% acetonitrile, pH 3.0), passed through the SCX spin columns, and washed with several column volumes of loading buffer. The retained peptides were eluted with SCX loading buffer containing 0.4 M NaCl. Eluent was diluted 10X with 50 mM sodium acetate buffer (NaAc, pH 4.5) and then allowed to interact with pre-washed streptavidin sepharose for 2 h at room temperature. Streptavidin sepharose then was washed with 50 mM NaAc, 50 mM NaAc containing 2 M NaCl, and water twice each with votexing and/or rotation to remove non-specific binding peptides, and resuspended in 25 mM ammonium bicarbonate. The suspension of streptavidin sepharose was transferred to several thin-walled borosilicate glass tubes, irradiated with 365 nm UV light for 2h at RT with stirring. The supernatant was collected, concentrated under vacuum, and desalted with HLB extraction cartridges as previously described (Yang et al., 2015a). The desalting peptides were evaporated to dryness and stored at -20 C until analysis. The detailed protocol is provided in Supplemental Information as Method S1. LC-MS/MS LC-MS/MS analyses were performed on Q Exactive plus (Thermo Fisher Scientific) operated with an Easy-nLC1000 system (Thermo Fisher Scientific). Samples were reconstituted in 0.1% formic acid followed by centrifugation (16,000g for 10 min) and the supernatants were pressure-loaded onto a 2 cm microcapillary precolumn packed with C18 (3 mm, 120 A˚, SunChrom, USA). The precolumn was connected to a 12 cm 150-mm-inner diameter microcapillary analytical column packed with C18 (1.9 mm, 120 A˚, Dr. Maisch GebH, Germany) and equipped with a homemade electrospray emitter tip. The spray voltage was set to 2.0 kV and the heated capillary temperature to 320 C. LC gradient consisted of 0 min, 7% B; 14 min, 10% B; 51 min, 20% B; 68 min, 30% B; 69-75 min, 95% B Cell Chemical Biology 24, 1–12.e1–e5, November 16, 2017 e3

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

(A = water, 0.1% formic acid; B = ACN, 0.1% formic acid) at a flow rate of 600 nL/min. HCD MS/MS spectra were recorded in the datadependent mode using a Top 20 method. MS1 spectra were measured with a resolution of 70,000, an AGC target of 3e6, a max injection time of 20 ms, and a mass range from m/z 300 to 1400. HCD MS/MS spectra were acquired with a resolution of 17,500, an AGC target of 1e6, a max injection time of 60 ms, a 1.6 m/z isolation window and normalized collision energy of 30. Peptide m/z that triggered MS/MS scans were dynamically excluded from further MS/MS scans for 18 s. Peptide Identification and Quantification Raw data files were converted to mzML format using Proteowizard (Kessner et al., 2008). The mzML files were searched against a decoy protein database consisting of forward and reversed Homo sapiens uniprot canonical database (Dec 2, 2016, 20,130 entries) using MS-GF+ algorithm (Kim and Pevzner, 2014). Precursor ion mass tolerance and fragmentation tolerance were both set as 10 ppm for the database search. The maximum number of modifications and missed cleavages allowed per peptide was three and three, respectively. 8-plex iTRAQ tags (+304.2054 Da) on the peptide N-terminus and lysine residues were search as static modifications Different modifications of methionine oxidation (+ 15.9949 Da), iodoacetamide alkylation (+57.0214 Da), and IPM-triazohexanoic acid (+252.1222 Da) were searched as variable modifications. Spectral identification mzID files generated from the MS-GF+ search was imported into IDPicker 3 software for protein assembly (Holman et al., 2012). The maximum Q value of peptide-spectrum matches (PSMs) was set as 1 % and each peptide should be identified by at least two spectra in MTRP experiments for each cell line. These stringent filters result in a final false-positive rate below 1% for peptides and their corresponding proteins groups. For peptide-level quantifications, spectra from mzML files were embedded into IDPicker software to extract peak intensity of 8-plex iTRAQ report ions at 20 ppm mass tolerance. Quantitation results were obtained from at least two biological replicates. R Ratio Processing and IC50 Calculation IC50 values were calculated with Origin 8 software using DoseResp function in Sigmidal category. Levenverg Marquardt was set as iteration algorithm. Iso-Thermo Dose-Response Experiment Iso-thermo dose-response experiment was performed as previously described (Jafari et al., 2014). In brief, U2OS cells were harvested at room temperature by centrifugation at 300g for 3 min. Pelleted cells were washed with 1X PBS containing protease inhibitor cocktail twice and then resuspend in the same buffer. Cells were freeze-thawed three times using liquid nitrogen and then incubated with titration of GA (23103, 13103, 53102, 13102, 23101, 2, 2310-1, 2310-2, 0 mM) for 30 min at 37 C with vibration. The samples were then divided equally into two aliquots, and heated at 37 C or 55 C for 3 min, respectively. The cell lysates were cooled and centrifuged at 20,000g for 20 min at 4 C to pellet cell debris together with aggregated proteins. The supernatants containing the soluble protein fraction were analyzed by western blotting. Thermal Shift Assay Thermal shift assay was performed as previously described (Martinez Molina et al., 2013). In brief, U2OS cells were elevated with trypsin and diluted to a density of 2 million cells per mL. U2OS cell suspensions were incubated with 2 mM GA or vehicle (DMSO) for 2h at 37 C. Cell suspensions were divided into twelve different 0.2-ml PCR tubes and heated with a designated temperature (40-65 C) on a PCR instrument. After 3 min incubation, cells were immediately freeze-thawed three times using liquid nitrogen and centrifuged at 20,000g for 20 min at 4 C to pellet cell debris together with aggregated proteins. The supernatants containing the soluble protein fraction were analyzed by western blotting. HSP60 Adduction by ACE Human recombinant HSP60 (0.1 mg/mL) was incubated with 30 mM ACE in 50mM AmBic buffer at 37 C for 2h, followed by tryptic digestion. The resulting peptides were evaporated to dryness by speed vacuum, and then desalted before LC-MS/MS analysis. Immunofluorescence U2OS cells were cultured onto confocal dishes and treated with or without 5 mM GA. After 2h incubation at 37 C, cells were fixed in paraformaldehyde for 30 min at RT and permeabilized with 0.2% TritonX-100 for 30 min at 4 C. Then cells were blocked in 3% BSA. Fixed cells were then incubated with the Anti-XPO2 and Anti-KPNA2 Antibodies, followed by exposure to the appropriate fluorescent secondary antibodies. Finally, stain nucleus with DAPI (ZSGB, ZLI-9557, diluted at 1:1000). Fluorescence was observed with a laserscanning microscope (ZEISS, LSM880 ELYRAS.1). Immunoprecipitation U2OS cells were treated with GA-Biotin as indicated concentrations at 37 C for 2h, washed twice with ice cold 1X PBS, and harvested. Cells were then lysed in NETN lysis buffer (50 mM HEPES, 150 mM NaCl, 1% Igepal, pH 7.5) containing inhibitor cocktail. Cell lysates (4 mg/mL, 0.5 mL) were incubated with 150 mL streptavidin sepharose beads at 4 C overnight, and then washed with lysis buffer for three times. Beads were then resuspended in loading buffer and boiled to release biotin-conjugated proteins or XPO2 proteins. The collected proteins were resolved on SDS-polyacrylamide gel electrophoresis gels and immunoblotted with anti-Flag antibody. Alternatively, cell lysates (4 mg/mL, 0.5 mL) were incubated with anti-Flag magnetic beads at 4 C overnight, e4 Cell Chemical Biology 24, 1–12.e1–e5, November 16, 2017

Please cite this article in press as: Tian et al., Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products, Cell Chemical Biology (2017), http://dx.doi.org/10.1016/j.chembiol.2017.08.022

and then washed with lysis buffer for three times. Beads were then resuspended in loading buffer and boiled to release XPO2 proteins in either modified or unmodified forms. The collected proteins were resolved on SDS-polyacrylamide gel electrophoresis gels and immunoblotted with HRP-conjugated streptavidin. BIAM Labeling Human recombinant HSP60 (1 mM) was pre-incubated with the indicated lactones for 2h at 37 C and then labeled 2 mM BIAM probe for 1h at RT. The protein samples were diluted with loading buffer, incubated for another 10 min at RT, and subjected to SDS-PAGE and western blotting. Western Blotting The protein samples were mixed with loading buffer, boiled for 10 min, and then resolved by SDS–PAGE. Proteins were transferred to PVDF membranes (Merck Millipore, IPVH00010), blocked with 5% milk in TBST at RT for 1h and probed with the indicated primary antibodies overnight at 4 C. After incubation, the membranes were washed three times with TBST and incubated with the appropriate HRP-conjugated specific secondary antibodies. Blots were visualized on a Tanon 5200 scanner (Shanghai, China), and analyzed using GelCap software using ECL chemiluminescence (CWBIO, CW0049S). MDH Reactivation Assay MDH reactivation assay was performed as previously described (Nagumo et al., 2005; Wiechmann et al., 2017). In brief, human recombinant HSP60 was preincubated with ACE or vehicle (1.0% DMSO) at 37 C for 1h, and incubated with its co-chaperonin HSP10 in reconstitution buffer (50 mM Tris/HCl, pH 7.6, 300 mM NaCl, 20 mM KCl, 20 mM magnesium acetate and 4 mM ATP) for 15 h at 4 C. Porcine MDH (1 mM) was denatured in 10 mM HCl at room temperature for 2 h and then diluted 10-fold in buffer A (0.1 M Tris/HCl, pH 7.6, 7 mM KCl, 7 mM MgCl2 and 10 mM dithiothreitol). Denatured MDH solution was then incubated with pre-mixed HSP60-HSP10 complex for 5 min at 27 C. The chaperone activity was initiated by addition of ATP (2 mM), and the refolding of MDH was performed for 30 min at 27 C. The reaction was quenched by addition of glucose (2 mM) and hexokinase (1KU) to consume the unreacted ATP. Samples were transferred into a 96-well plate, NADH (1 mM) and oxaloacetate (2.5 mM) were added into each well, and absorbance was immediately monitored at 360 nm at 30 C in a SpectraMax Paradigm Multi-Mode detection platform. MTT Assay HeLa or U2OS cells were seeded (33105/mL, 100 mL/well) into a 96-well plate in DMEM medium supplemented with 10% FBS, penicillin (100 U/mL), and streptomycin (100 mg/mL). Cells were treated with compounds as indicated for 24 h at 37 C, 5% CO2. 20 mL of 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) solution (5 mg/mL in PBS) was added into each well and incubated for another 4 h. MTT formazan was dissolved by addition of 150 mL of DMSO and samples were votexed for 10 min at RT. Absorbance was measured at 490 nm in a Multiskan microplate spectrophotometer. Experiments were performed in biological triplicates. Apoptosis Assay Cells treated with GA (2.5 mM) or transfected with siRNA were collected and then stained with annexin V FITC and propidium iodide (PI) as the manufacturer’s protocol (BD). The results were recorded on a BD FACSDiva 8.0.1. and analyzed with FlowJo software. All PI/annexin V experiments were performed in biological triplicate. Bioinformatics and Statistics GO enrichment (p < 0.01, FDR<0.01) analyses were performed by using the functional annotation tool DAVID (Huang da et al., 2009). Principal coordinates analysis, also known as multidimensional scaling, was performed with SPSS Statistics v22 to visualize similarities or dissimilarities of target profiles of seven lactones at both low and high concentrations. The determined ratios of each cysteines were set as variables. Euclidean distance was used as scaling model. S-stress convergence, minimum s-stress value, maximum iterations were set as 0.001, 0.005, and 30, respectively. Figure 3A was generated with BoxPlotR, a web-tool for generation of box plots (Spitzer et al., 2014). DATA AND SOFTWARE AVAILABILITY Datasets of all proteomics and bioinformatics analyses can be found in Tables S1–S6, which are attached as individual Excel files. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (Vizcaı´no et al., 2016) partner repository with the dataset identifier PXD007575 and 10.6019/PXD007575.

Cell Chemical Biology 24, 1–12.e1–e5, November 16, 2017 e5