Muscle LIM Protein Is Expressed in the Injured Adult CNS and Promotes Axon Regeneration

Article

Muscle LIM Protein Is Expressed in the Injured Adult CNS and Promotes Axon Regeneration Graphical Abstract

Authors Evgeny Levin, Marco Leibinger, Philipp Gobrecht, Alexander Hilla, Anastasia Andreadaki, Dietmar Fischer

Correspondence [email protected]

In Brief Levin et al. identify muscle LIM protein (MLP) as a regeneration-associated gene in adult rat retinal ganglion cells. Its overexpression markedly promotes axon regeneration of peripheral as well as central neurons by acting as an actin cross-linker, thereby facilitating filopodia formation in axonal growth cones.

Highlights d

MLP is a regeneration-associated gene expressed in adult neurons of mammals

d

As an actin cross-linker, MLP facilitates filopodia formation in axonal growth cones

d

MLP overexpression facilitates CNS and PNS axon regeneration

Levin et al., 2019, Cell Reports 26, 1021–1032 January 22, 2019 ª 2018 The Authors. https://doi.org/10.1016/j.celrep.2018.12.026

Cell Reports

Article Muscle LIM Protein Is Expressed in the Injured Adult CNS and Promotes Axon Regeneration Evgeny Levin,2 Marco Leibinger,1,2 Philipp Gobrecht,1,2 Alexander Hilla,1,2 Anastasia Andreadaki,1,2 and Dietmar Fischer1,2,3,* 1Department

of Cell Physiology, Ruhr University of Bochum, Universita¨tsstraße 150, 44780 Bochum, Germany € sseldorf, Germany of Experimental Neurology, Medical Faculty, Heinrich Heine University, Merowingerplatz 1a, 40225 Du 3Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2018.12.026 2Division

SUMMARY

Muscle LIM protein (MLP) has long been regarded as a muscle-specific protein. Here, we report that MLP expression is induced in adult rat retinal ganglion cells (RGCs) upon axotomy, and its expression is correlated with their ability to regenerate injured axons. Specific knockdown of MLP in RGCs compromises axon regeneration, while overexpression in vivo facilitates optic nerve regeneration and regrowth of sensory neurons without affecting neuronal survival. MLP accumulates in the cell body, the nucleus, and in axonal growth cones, which are significantly enlarged by its overexpression. Only the MLP fraction in growth cones is relevant for promoting axon extension. Additional data suggest that MLP acts as an actin cross-linker, thereby facilitating filopodia formation and increasing growth cone motility. Thus, MLP-mediated effects on actin could become a therapeutic strategy for promoting nerve repair. INTRODUCTION The visual system is frequently used as a versatile model for the investigation of CNS injuries and potential therapeutic approaches to promote axonal regeneration (Fischer and Leibinger, 2012; Harvey, 2014). Retinal ganglion cells (RGCs), the final output neurons of the vertebrate retina, are susceptible to genetic manipulations in vivo and in vitro, and their projecting axons within the optic nerve are readily accessible to minimally invasive surgery (Leibinger et al., 2013a, 2016). Like other CNS neurons, mature RGCs are normally unable to regenerate lesioned axons and die after optic nerve injury (Berkelaar et al., 1994; Fischer et al., 2000), leading to irreversible visual loss. This regenerative failure has partly been attributed to an insufficient intrinsic regenerative capacity of CNS neurons as well as to axonal growth inhibitory molecules within CNS myelin and the glial scar (Fischer and Leibinger, 2012; Silver and Miller, 2004). However, various experimental approaches have been developed in recent years to promote axonal re-growth beyond

the lesion site after optic nerve injury. For example, retrolental puncture of the lens capsule stimulates retinal astrocytes and €ller cells to secrete IL-6-type cytokines, thereby mediating Mu neuroprotection and stimulating axon regeneration (Fischer €ller et al., 2000, 2004; Leibinger et al., 2009; Leon et al., 2000; Mu et al., 2007). This so-called inflammatory stimulation (IS), which is associated with a change of gene expression (Fischer et al., 2004), can thus be used to increase the regenerative capacity of mouse and rat RGCs (Leibinger et al., 2017). To investigate the molecular mechanisms underlying IS-stimulated axon regeneration, we previously screened microarrays for genes that are differently expressed in the IS-induced regenerative state compared to naive and solely injured RGCs, respectively (Fischer et al., 2004). Muscle LIM protein (MLP) was among the candidate genes found in this screen with an induction of mRNA expression after optic nerve injury alone and a significant stonger upregulation after additional IS, suggesting that this protein may be expressed in the adult CNS and potentially involved in regenerative processes (Fischer et al., 2004). MLP is a cysteine-rich protein of the large LIM-domain-protein superfamily and has long been regarded as cardiac and skeletal muscle-specific before we found an expression in cholinergic amacrine cells, which was, however, restricted to the first few postnatal weeks (Levin et al., 2014). In myocytes, MLP is detectable from early stages of terminal differentiation to adulthood (Arber et al., 1994) and has been implicated a key role in normal muscle physiology as well as pathogenesis. Mutations of MLP are directly associated with dilated and hypertrophic cardiomyopathies, and altered expression levels are observed in human failing hearts and various skeletal myopathies (Gehmlich et al., 2008; Kno¨ll et al., 2002; Sanoudou et al., 2006; Winokur et al., 2003). The two LIM domains of MLP independently mediate interactions with multiple proteins at different subcellular locations, thus determining its complex and diverse functional roles in muscle development and cytoarchitecture (Vafiadaki et al., 2015). For example, cytoplasmic MLP interacts either directly with actin to confer cross-linking and to promote actin bundling, or indirectly with actin-binding proteins such as cofilin or a-actinin to increase actin dynamics in myocytes (Arber and Caroni, 1996; Flick and Konieczny, 2000; Hoffmann et al., 2014; Louis et al., 1997; Papalouka et al., 2009). MLP may also act as a mechanical stress sensor, entering and accumulating in nuclei of cardiomyocytes, where it modulates gene expression (Boateng

Cell Reports 26, 1021–1032, January 22, 2019 ª 2018 The Authors. 1021 This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

et al., 2007; Buyandelger et al., 2011; Kno¨ll et al., 2002; Kong et al., 1997). The present study investigated whether MLP protein is expressed in the adult CNS and whether it is involved in regenerative processes of injured axons. Indeed, we found a correlation of MLP expression with the regenerative state of rat RGCs, making it a regeneration-associated protein. MLP co-localized with the actin cytoskeleton in axonal growth cones, and its overexpression markedly promoted axonal regeneration in culture and in vivo. Contrary to that, knockdown or expression of a dominant-negative variant showed the opposite effect. Although MLP was absent in murine RGCs or peripheral sensory neurons, exogenous expression in these neurons significantly increased axon growth and optic nerve regeneration. Thus, MLP also has physiological functions outside of muscle tissue and might be a potential target for the development of therapeutic strategies to facilitate nerve repair, either alone or in combination with other approaches. RESULTS Axonal Injury Induces Robust MLP Expression in Rat RGCs We previously detected MLP protein in a subpopulation of adult rat sensory neurons upon sciatic nerve crush (Levin et al., 2017). To investigate whether similar induction might also occur in adult CNS tissue, we initially performed quantitative real-time PCR and then western blot analyses on retinal lysates from uninjured control rats or 5 d after optic nerve crush (ONC). Additional experimental groups received lens injuryinduced IS either alone or in combination with ONC to increase the regenerative capacity of RGCs (Fischer and Leibinger, 2012; Fischer et al., 2004). As expected, very low mRNA expression, but no MLP protein was detected in naive control retinae or after IS only (Figures 1A–1C). However, transcript (Figure 1A) and protein levels (Figures 1B and 1C) were induced upon ONC and further increased upon ONC+IS. These results were verified by immunohistochemistry on flat-mounted retinae (Figure 1D), showing no signal in naive and IS-treated retinae, but a few MLP-positive RGCs with axons (identified by bIII-tubulin labeling) 5 d after ONC. Additional IS further increased their number and staining intensity (Figure 1D) and retinal cross-sections revealed MLP expression in injured RGCs only (Figure 1D). Next, we determined the time course of retinal expression (Figures 1E–1I). Induction of Mlp transcripts were already detected 3 d after ONC+IS and progressively increased at 5 and 7 d (Figure 1E). Western blots, revealed steady MLP levels from 5 d to at least 14 d after surgery (Figures 1F and 1G). As RGCs continuously die within this time period (Fischer et al., 2000, 2004), these results indicated preferential survival of MLP-expressing RGCs and/or continued rising expression in surviving neurons over time. Quantification in retinal flat-mounts revealed similar percentages of MLP-positive neurons in the surviving population of RGCs at 7 and 14 d after ONC+IS (Figures 1H and 1I). However, the percentage of strongly stained RGCs significantly increased from 7 to 14 d (Figure 1I), indicating further accumulation of MLP in the surviving RGCs.

1022 Cell Reports 26, 1021–1032, January 22, 2019

Intracellular Localization of MLP in RGCs We then investigated whether MLP expression is similarly induced in cultured adult rat RGCs upon axon and dendritic loss by the dissociation process. Quantitative real-time PCR revealed significantly increased amounts of Mlp transcripts after 3 d compared to 2 hr in culture (Figure 2A). Consistently, protein expression was detected in
3% of bIII-tubulin-positive RGCs at 2 d and
10% at 3 d in culture (Figures 2B and 2C). Thus, similar to ONC in vivo, MLP-protein induction in culture was low, but clearly found in the cytoplasm and in the nuclei of RGCs (Figure 2D). Within the axonal compartment, MLP was particularly detected in growth cones and co-localized with F-actin (Figure 2E). We also subjected rats to ONC+IS and anterogradely labeled regenerating axons in the optic nerve by intravitreal injection of fluorescent cholera toxin subunit B (CTB). These nerves were isolated 14 d after injury and used for tissue clearing after MLP immunostaining to visualize the protein throughout the whole optic nerve (Figure 2F). Image analysis revealed that 74% ± 4.5% of axonal growth cones in the distal part of the nerve were MLP-positive. Hence, as in cell culture, endogenous MLP was also localized in axonal growth cones in vivo. Activation of the Janus kinase (JAK)/signal transducer and activator of transcription 3 (STAT3) and phosphatidylinositol 3-kinase (PI3K)/AKT/mammalian target of rapamycin (mTOR) pathway have been shown to contribute to axon regeneration (Fischer and Leibinger, 2012). To test whether MLP expression depends on the activity of one of these pathways, we cultured adult rat RGCs in the presence of the JAK/STAT3 pathway inhibitor AG490, the PI3K inhibitor LY294002, or the mTOR inhibitor rapamycin. After either 2 hr or 3 days, RGCs were fixed for immunocytochemical staining. At concentrations that blocked neurite growth without affecting survival (Figures S1D and S1F), AG490 did not significantly affect MLP, but GAP43 expression (Figures S1A–S1C and S1E). However, LY294002 and rapamycin markedly suppressed MLP expression and neurite growth, while inhibition of phosphatase and tensin homolog (PTEN) by bisperoxovanadium (BPV) had the opposite effects (Figures S1A–S1D). In contrast to MLP, GAP43 expression was not affected by LY294002, rapamycin, or BPV (Figures S1B and S1E). We next tested whether inhibition of mTOR may also suppress injury-induced MLP expression in RGCs in vivo. To this end, rats were treated either with rapamycin or vehicle and received ONC + IS. Retinal flat-mounts were prepared 5 days afterwards. Rapamycin treatment reduced MLP expression compared to similar treated controls (Figures S1I and S1J), as well as the number of pS6-positive RGCs (Figures S1G and S1H), indicating effective mTOR inhibition. Thus, MLP protein expression is PI3K/AKT/ mTOR activity dependent, but JAK/STAT3 independent. MLP Expression Is Correlated with RGCs’ Regenerative State The rather small proportion of MLP-positive RGCs (<10% at 3 d) in cultures from naive (in vivo untreated) retinae (Figures 2C and S2H) and the occurring extensive axotomy-induced cell death at later time points (Grozdanov et al., 2010) precluded reliable knockdown experiments to functionally assess the role of

Figure 1. Induction of MLP upon Rat Optic Nerve Crush and Inflammatory Stimulation (A) Quantitative real-time PCR analysis: Retinal RNA was collected from untreated rats (Con) or from animals subjected to either optic nerve crush (ONC) or ONC with additional inflammatory stimulation (ONC/IS) 5 days prior to tissue isolation. Mlp transcripts were quantified relative to Gapdh and normalized to controls (DDCT) using at least 3 retinae per group with 2 technical replicates for each sample (n = 6). Values represent means ± SEM. Treatment effects: ***p < 0.001 (oneway ANOVA with Holm-Sidak post hoc test). (B) Western blot analysis: Animals were treated as described in (A) with an additional experimental group that received IS only. Heart tissue served as a positive control for the detection of MLP and tubulin (Tub) as loading control. (C) Densitometric quantification of western blots as described in (B). Band intensities of MLP were normalized to the tubulin loading control and to untreated controls. Results represent the mean value ± SEM of three experiments using independent biological replicates. Treatment effects compared to untreated controls: **p < 0.01; ***p < 0.001; ns, non-significant; treatment effect compared to ONC: ###p < 0.001 for 3 retinae (n = 3) per experimental group (one-way ANOVA with Holm-Sidak post hoc test). (D) Immunostaining of flat-mounted or cross-sectioned retinae from rats treated as described in (A) and (B) showing specific MLP expression (red) in bIII-tubulinpositive RGCs (Tub, green). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. Scale bar: 50 mm. (E) Time course of retinal Mlp expression analyzed by quantitative real-time PCR. RNA was isolated from rat retinae at 0, 3, 5, and 7 days post (dp) ONC/IS, respectively. Values represent means ± SEM. Treatment effects: ***p < 0.001 for 2–4 retinae per experimental group with 2 technical replicates for each sample (n = 4–8) (one-way ANOVA with Holm-Sidak post hoc test). (F) Time course of retinal MLP expression analyzed by western blot. Protein lysates were prepared at 0, 5, 7, 10, and 14 dp ONC/IS, respectively. b-actin (Act) served as loading control as Tub expression declined with ongoing RGC degeneration. (G) Densitometric quantification of western blots as described in (F). Band intensities of MLP were normalized to the b-actin loading control and to untreated controls. Values represent means ± SEM. Treatment effects between ONC/IS-treated groups: ns, non-significant for at least 3 retinae per experimental group (n = 3) (one-way ANOVA with Holm-Sidak post hoc test). (H) Flat-mounted retinae isolated from rats at 7 and 14 d after ONC/IS, respectively, and immunostained for MLP (red) and bIII-tubulin (Tub, green). Scale bar: 50 and 20 mm for magnification, respectively. Arrows mark cells with strong and arrowheads with intermediate MLP expression, respectively. (I) Quantification of MLP-positive RGCs in flat-mounted retinae as described in (H), discriminating between intermediate (+) and strong (++) expression levels 7 and 14 d after ONC/IS in flat-mounted retinal quadrants (n = 4). Values represent means ± SEM. Effect: **p < 0.01 (Student’s t test).

endogenous MLP in these cultures. For this reason, we prepared retinal cultures 7 d after ONC+IS in vivo, when the protein was already detectable in >50% of all RGCs (Figures 1 and S2H) and the RGCs were already in a regenerative state (Fischer et al., 2004). Expectedly, these cultures contained many more MLP-positive RGCs than ‘‘naive’’ preparations (68% ± 4 at 1 d). Interestingly, the proportion of neurite-bearing RGCs that had spontaneously regenerated after 24 hr was significantly higher in the MLP-expressing RGC population (59% for RGCs with strong [++] and 49% for RGCs with moderate [+] MLP expression) compared to MLP-negative () RGCs (30%) (Figures S2A and S2B), implying that neurons’ regenerative state was correlated with endogenous MLP expression. To study a functional involvement of MLP in neurite growth, we first blocked its induction using efficient and previously characterized short hairpin RNA (shRNA) (Levin et al., 2017). Recombinant adeno-associated viruses (AAVs) were used to deliver either

Mlp-specific shRNA (shMlp) or scrambled control shRNA (shScr) into RGCs in vivo, both achieving comparable transduction rates of
50% as indicated by GFP co-expression (Figure S2C). Accordingly, immunostained retinal flat-mounts showed no MLP in GFP-positive/shMlp-transduced RGCs 7 days after ONC+IS (Figure S2D). Consistent with the transduction rate of the shMLP-AAV, quantitative real-time PCR (Figure S2E) and western blot analysis (Figures S2F and S2G) revealed about 50% reduced MLP expression in the entire retinae, verifying efficient knockdown in transduced RGCs. We then prepared retinal cultures to determine spontaneous neurite growth within 24 hr (Figures S2H–S2J). Comparable neurite lengths were quantified for GFP-positive/shScr transduced RGCs and nontransduced RGCs, indicating that AAV-mediated expression of GFP or non-targeting control shRNA per se had no influence on neurite growth (Figure S2J). In contrast, shMlp-mediated knockdown of the protein in GFP-positive RGCs reduced neurite

Cell Reports 26, 1021–1032, January 22, 2019 1023

Figure 2. MLP Expression in Retinal Cell Cultures and Optic Nerve (A) Quantitative real-time PCR analysis of Mlp expression in retinal cultures prepared from uninjured (naive) rats. Total retinal RNA was isolated after either 2 hr or 3 d in culture. Mlp transcripts were quantified relative to Gapdh and normalized to expression at 2 hr (DDCT). Values represent means ± SEM. Treatment effect: ***p < 0.001 for 2 independent experiments using independent biological samples and 2 technical replicates each (n = 4) (Student’s t test). (B) Cultured RGCs from uninjured rats immunostained for MLP (red) and bIII-tubulin (Tub, green) either 2 hr or 3 d after cell preparation. Scale bar: 25 mm. (C) Quantification of MLP-positive RGCs from uninjured rats cultured for either 2 hr, 1 d, 2 d, or 3 d. Values represent means ± SEM. Treatment effect: **p < 0.01 for 2 experiments with independent biological samples and 4 technical replicates each (n = 8) (one-way ANOVA with Holm-Sidak post hoc test). (D) Cultured RGC soma co-stained for MLP (red), for bIII-tubulin (Tub, green), and with DAPI (blue) with detectable MLP in the cytoplasm and the nucleus. Scale bar: 10 mm. (E) Growth cones of cultured RGCs co-stained for MLP (red) and either F-actin (white) or bIII-tubulin (Tub, green). Scale bar: 10 mm. (F) Confocal image of MLP immunolabeled (green) and cleared rat optic nerve 14 d after ON+IS with CTB-labeled axons. Most regenerating axons (74%) beyond the lesion site (dashed line) had MLP-positive axonal tips (white arrowheads). Selected axonal growth cones in the dashed box are shown at larger magnification. Scale bars: 50 mm.

length by 54% compared to non-transduced cells in the same cultures (Figures S2I and S2J). The specificity of this effect and its dependence on endogenous MLP expression were verified with a second experiment using retinal cultures from naive/uninjured rats, that showed only very few MLP-positive RGCs after 2 d (see Figures 2C and S2H). In these cultures, transduction with shMlp had no discernable effect on neurite outgrowth compared to non-transduced controls at 3 d in cell culture (Figure S2K). In all these experiments (Figures S2I–S2K), the number of RGCs per well was not significantly affected by any treatment. As induction of endogenous MLP upon axonal injury seemed to facilitate neurite growth of RGCs, we investigated whether exogenous MLP expression might further promote this effect. To this end, recombinant AAV encoding MLP and GFP (MLPAAV) were intravitreally injected into adult rat eyes, transducing
50% of all RGCs (Figure S3A). Accordingly, RGCs of these animals expressed MLP even without prior ONC- or ONC+IS-mediated induction (Figure S3B), and retinal cultures prepared 3 weeks after viral application contained transduced, MLP/ GFP-expressing next to non-transduced, MLP/GFP-negative RGCs (Figure S3C). Because viral transduction per se did not affect neurite growth (Figures S2J), non-transduced RGCs in the same cultures were used as an internal control. Compared to these, MLP overexpression induced a 2.7-fold increase in RGC neurite length (Figures S3C and S3D). Addition of ciliary neurotrophic factor (CNTF) to the medium similarly promoted neurite growth of MLP-expressing as well as non-transduced RGCs, demonstrating that the effects of the cytokine and MLP were independent from each other (Figure S3D). As disinhibition

1024 Cell Reports 26, 1021–1032, January 22, 2019

toward inhibitory molecules is also relevant for successful CNS regeneration, we grew MLP-expressing and non-transduced RGCs on inhibitory myelin extract. However, in contrast to the disinhibitory ROCK inhibitor Y27632, neurite growth on myelin was similarly reduced for transduced and non-transduced RGCs compared to cultures on laminin (Figure S3E). In all culture experiments (Figures S3C–S3E), the numbers of RGCs per well were similar and not significantly affected by any treatment. Thus, MLP expression correlated with the regenerative state and facilitated neurite growth without conferring disinhibition. Endogenous MLP Facilitates Rat Optic Nerve Regeneration, but Not Survival of RGCs We next assessed the role of MLP in optic nerve regeneration in vivo using shRNA-mediated knockdown or RGC-specific overexpression, respectively. Adult rats received intravitreal injections of either control GFP-AAV, shMlp-AAV, or MLP-AAV (see Figures S2C–S2G, S3A, and S3B) and were subjected to ONC+IS 3 weeks thereafter. The enhanced regenerative capacity of RGCs upon IS treatment enabled regeneration of GAP43positive axons into the distal part of the crushed optic nerve in GFP-AAV-injected control animals (Figures 3A, 3B, and S4A– S4C). In comparison, the number and length of regenerating axons was significantly reduced upon neuronal Mlp knockdown, while MLP overexpression, on the other hand, increased axon regeneration (Figures 3A, 3B, and S4A–S4C). These effects on optic nerve regeneration were independent of neuronal survival as the numbers of RGCs in retinal flat-mounts were comparable for all 3 experimental groups both after sole ONC or ONC+IS

Figure 3. Endogenous MLP Is Involved in Rat Optic Nerve Regeneration (A) Longitudinal optic nerve sections with regenerating, GAP43-positive RGC axons. Adult rats received intravitreal injections of either GFP-AAV (GFP), shMlpAAV (shMlp) for MLP knockdown or MLP-AAV (MLP) for MLP overexpression 3 weeks prior to ONC and inflammatory stimulation (ONC/IS). Optic nerves were isolated 3 weeks thereafter to detect GAP43-positive regenerating axons. Asterisks mark the lesion site, and arrows indicate the longest regenerated axons in distal optic nerves. Scale bar: 200 mm. (B) Quantification of regenerating axons on sections as described in (A) at 0.5, 0.75, 1, 1.25, and 1.5 mm from the lesion site. Values represent means ± SEM. Treatment effects: **p < 0.01, ***p < 0.001 (one-way ANOVA with Holm-Sidak post hoc test). Experimental groups contained 10 (GFP; n = 10), 5 (shMlp; n = 5), and 7 (MLP, n = 7) rats, respectively. (C) Representative pictures of GFP-, shMlp-, or MLP-transduced, flat-mounted rat retinae, respectively, immunostained for bIII-tubulin (Tub) to detect surviving RGCs 3 weeks after ONC or ONC/IS. Scale bar: 100 mm. (D) Quantification of surviving bIII-tubulin-positive RCGs as described in (C). Percentage of surviving RGCs was calculated relative to uninjured controls (1,766 RGCs/mm2). Neither depletion nor overexpression of MLP affected RGC survival significantly. Values represent means ± SEM. Treatment effects compared to control GFP-AAV-transduced retinae: ns, non-significant for 5 animals per experimental group (n = 5) (two-way ANOVA with Holm-Sidak post hoc test).

(Figures 3C and 3D). Hence, the role of MLP was restricted to axon growth promotion. Promotion of Mouse Optic Nerve Regeneration upon Ectopic MLP Expression We next investigated whether MLP might be also expressed in axotomized RGCs or sensory dorsal root ganglion (DRG) neurons of mice. As in rats, very few Mlp transcripts and no MLP protein were detected in naive adult BL6-mouse retinae (Figures S5A and S5B) or DRG neurons of the same animals (Figures S5L–S5N). However, MLP expression was not induced upon ONC or ONC+IS in the retina or in sensory neurons after sciatic nerve crush (SNC) (Figures S5L–S5O) either, revealing a difference between rats and mice. This result was not caused by a selective specificity of the antibody for rat MLP as the respective mouse protein was readily detected in murine heart lysate (Figures S5B and S5M). To investigate whether the lack of MLP induction was due to the mouse strain (inbred versus outbred), we also measured retinal MLP expression in C57BL/ 6,129/Ola(B6CF1) (inbred) and jOrl:SWISS mice (outbred). However, both strains showed very similar results. This rather unexpected finding hence presented us the opportunity to determine the effect of ectopic MLP expression on axon regeneration without endogenous expression/induction in the background. Intravitreal injection of MLP-AAV in adult mice transduced
60% of RGCs (Figure S5C) and RGC-specific MLP expression was detectable in retinal whole mounts as well as cell cultures (Figures S5D and S5E). As in rat cultures, neurite growth of naive mouse RGCs was significantly increased upon MLP expression compared to non-transduced cells (Figures S5F and S5G). Again, CNTF equally promoted neurite growth of MLP-expressing and non-transduced RGCs further, indicating additive effects (Figures S5F and S5G). To exclude the possibility that this outcome might have been influenced by MLP

expression prior to cell culture preparation, as retinae were routinely isolated 3 weeks after intravitreal AAV transduction in vivo, we took advantage of a recently described baculoviral approach to efficiently and swiftly transduce adult RGCs after culture preparation (Levin et al., 2016). To this end, mouse retinal cell cultures were treated with baculoviruses encoding either HA-tagged MLP (MLP-HA-bv) or Cre-recombinase (CreHA-bv) as control (Figure S5H), achieving
50% transduction of RGCs and recombinant expression in less than 24 hr (Levin et. al 2016). As before, MLP expression markedly increased RGC neurite lengths in comparison to control transduced cells (Figures S5H and S5I), indicating that MLP was required postaxotomy to promote neurite growth. Similarly, baculovirusmediated MLP expression in cultured adult mouse sensory DRG neurons significantly enhanced axon growth compared to respective controls (Figures S5J and S5K). Thus, exogenous MLP expression promotes neurite/axon extension of PNS and CNS neurons. In order to test whether exogenous MLP would also enhance in vivo optic nerve regeneration in mice, either MLP-AAV or control GFP-AAV were intravitreally injected 3 weeks prior to either ONC or ONC+IS. Like in rats, the number of regenerating axons was significantly increased upon MLP expression either without or with additional IS compared to respective controls (Figures 4A–4C, 4F–4H, and S4D–S4G), while RGC survival remained unaffected (Figures 4D, 4E, 4I, and 4J). Therefore, molecular premises required for MLP to promote axonal growth seem to be fulfilled in mouse RGCs, although endogenous MLP was absent in these cells. MLP in Growth Cones Is Required to Promote RGC Neurite Growth The detection of nuclear MLP in RGCs raised the possibility that it could, as in myocytes, act as a transcriptional co-factor (Arber

Cell Reports 26, 1021–1032, January 22, 2019 1025

Figure 4. Exogenous MLP Expression in RGCs Enhances Mouse Optic Nerve Regeneration (A) Representative pictures of longitudinal optic nerve sections with regenerating RGC axons. Adult mice received intravitreal injections of either GFP-AAV (GFP) or MLP-AAV (MLP) for MLP overexpression 3 weeks prior to ONC. Optic nerves were isolated 3 weeks thereafter, and regenerating axons were detected with Alexa Fluor 555-labeled CTB. Asterisks mark the lesion site. Scale bar: 200 mm. (B) Magnifications of optic nerve segments at 1 and 2 mm, respectively, distal to the lesion site as indicated in (A). Scale bar: 100 mm. (C) Quantification of regenerating axons on sections as described in (A) at 0.5, 1, 1.5, and 2 mm from the lesion site. Values represent means ± SEM. Treatment effects: **p < 0.01 (one-way ANOVA with Holm-Sidak post hoc test) for 6 (GFP; n = 7) and 5 (MLP; n = 5) animals, respectively. (D) Representative pictures of GFP- or MLPtransduced, flat-mounted mouse retinae of animals as described in (A)–(D), immunostained for bIII-tubulin (Tub) to detect surviving RGCs. Scale bar: 50 mm. (E) Quantification of surviving bIII-tubulin-positive RCGs as described in (D). Percentage of survival was calculated relative to uninjured controls (1,750 RGCs/mm2). Values represent means ± SEM. Treatment effects compared to control GFP-AAV-transduced retinae: ns, non-significant for at least 5 retinae (n R 5) per experimental group (one-way ANOVA with Holm-Sidak post hoc test). (F) Representative pictures of longitudinal optic nerve sections with regenerating RGC axons. Adult mice received intravitreal injections of either GFP-AAV (GFP) or MLP-AAV (MLP) for MLP overexpression 3 weeks prior to ONC and lens injury (IS). Optic nerves were isolated 3 weeks thereafter and regenerating axons detected with Alexa Fluor 555-labeled CTB. Asterisks mark the lesion site. Scale bar: 200 mm. (G) Magnifications of optic nerve segments at 1 and 2 mm, respectively, distal to the lesion site as indicated in (F). Scale bar: 100 mm. (H) Quantification of regenerating axons on sections as described in (F) at 0.5, 1, 1.5, and 2 mm from the lesion site. Values represent means ± SEM. Treatment effects: ***p < 0.001 (one-way ANOVA with Holm-Sidak post hoc test) for 6 (GFP; n = 6) and 5 (MLP; n = 5) animals, respectively. (I) Representative pictures of GFP- or MLP-transduced, flat-mounted mouse retinae of animals as described in (F), immunostained for Tub to detect surviving RGCs. Scale bar: 50 mm. (J) Quantification of surviving bIII-tubulin-positive RCGs as described in (D). Percentage of survival was calculated relative to uninjured controls (1,750 RGCs/mm2). Values represent means ± SEM. Treatment effects compared to control GFP-AAV-transduced retinae: ns, non-significant for at least 5 (n R 5) retinae per experimental group (one-way ANOVA with Holm-Sidak post hoc test).

and Caroni, 1996; Arber et al., 1997; Kong et al., 1997) and increase the regenerative capacity of neurons by influencing gene expression. To address this possibility, we transduced mouse RGCs by intravitreal application of MLP-AAV (see Figure S5C) and performed ONC and ONC+IS 3 weeks thereafter. Five days after injury, we isolated retinal RNA and assessed the expression of regeneration-associated genes (Gap43, Sprr1a, and Galanin) using real-time PCR. As shown previously (Leibinger et al., 2013a; Sengottuvel et al., 2011), ONC+IS markedly induced the expression of these genes, thereby reflecting the increased regenerative state of the neurons (Figures 5A–5C). However, although exogenous MLP expression increased axon regeneration, it did not affect the mRNA levels of Gap43, Sprr1a, or Galanin (Figures 5A–5C). We next reasoned whether nuclear or somal MLP was sufficient to promote neurite growth of adult mouse RGCs. To this end, we prepared a baculovirus to express a MLP protein with a N-terminal nuclear localization signal (NLS-MLP) (Figure 5D) (Kong et al., 1997). The functional activity of this construct on F-actin and filo-

1026 Cell Reports 26, 1021–1032, January 22, 2019

podia formation was verified later in COS7 cells (Figures 7B and 7C). Although the overexpression of this protein in RGCs was not restricted to the nucleus only, but also detected in the cytosol of the cell body, an accumulation of the protein in long neurite tips as typical for wild-type MLP was prevented (Figures 5E and 5F). Significantly, in contrast to wild-type MLP, NLS-MLP failed to enhance neurite growth of cultured RGCs (Figure 5G) or axon regeneration in the optic nerve, when virally overexpressed in vivo (Figures S7A–S7C). Additionally, overexpression of NLS-MLP did not affect the survival of RGCs (Figures S7D and S7E). Thus, localization of MLP in the growth cone is necessary for its regeneration-promoting activity. MLP Promotes Neurite Growth by Cross-Linking F-Actin in Filopodia MLP reportedly induces stress fibers in myoblasts by cross-linking of actin bundles (Hoffmann et al., 2014). Because of the co-localization of MLP and F-actin (Figure 2E) and the necessity of its presence in axonal tips to promote neurite growth, we

Figure 5. Nuclear MLP Does Not Affect Regeneration (A–C) Quantitative real-time PCR analysis: mice received intravitreal injections of MLP-AAV or control AAV (GFP) and were subjected to ONC/IS 3 weeks thereafter. Retinal RNA was isolated 5 d after surgery. Gap43 (A), Galanin (B), and Sprr1a (C) transcripts were quantified relative to Gapdh and normalized to controls (DDCT). ONC+IS induced gene expression of regeneration-associated genes was not affected by MLP expression. Each experiment was done for 3 independent retinae per group using 2 technical replicates each (n = 6). Values represent means ± SEM. Treatment effects: ns, non-significant (oneway ANOVA with Holm-Sidak post hoc test). (D) Scheme of full-length (native) MLP with two LIM domains and NLS-MLP with an additional N-terminal nuclear localization signal KKKRRVE (yellow rectangle). Blue squares represent glycine-rich regions. (E) Mouse retinal cultures were baculovirally transduced either with MLP-HA or NLS-MLP and stained for MLP (green) and bIII-tubulin (Tub, red). Photos in the right row show magnifications of the respective growth cones indicated with arrows. Scale bar: 50 mm and, for magnifications, 3 mm. (F) Intensity of MLP staining in somas and growth cones of RGCs in cultures as described in (E). Values represent means ± SEM. Effects: ***p < 0.001; ns, nonsignificant for at least 81 cells per experimental group from 2 independent experiments (one-way ANOVA with Holm-Sidak post hoc test). (G) Quantification of RGC neurite growth in cultures as described in (E). In contrast to MLP-HA, expression of NLS-MLP failed to improve neurite growth compared to transduced control cultures (). Values represent means ± SEM. Treatment effects compared to control: ***p < 0.001; ns, non-significant; treatment effect between MLP-HA and NLS-MLP: ##p < 0.01 for 2 independent experiments including 4 technical replicates each (n = 8) (one-way ANOVA with Holm-Sidak post hoc test).

speculated that it could play a similar role in neurons and facilitate the formation of actin-rich filopodia. Consistent with this idea, we noticed that MLP overexpression markedly enlarged the area of F-actin (stained by phalloidin-TRITC) in growth cones

of cultured RGCs (2.5-fold; Figures 6A and 6B) and in adult DRG neurons (2-fold; Figures S6A–S6C) compared to nontransduced cells. To functionally test the relevance of F-actin formation in this context, we cultured mouse RGCs 3 weeks after intravitreal AAV-MLP transduction in vivo. After 48 hr, neurite growth of some cultures was stopped by fixation and evaluated. Other cultures were treated with either vehicle or 0.1 mM latrunculin A (LatA), an F-actin-depolymerizing toxin disrupting the actin cytoskeleton without affecting axonal microtubules (Cojoc et al., 2007; Gallo et al., 2002; Hasaka et al., 2004) and incubated for 1 additional day. Exposure to LatA significantly compromised the actin structures in RGC growth cones (Figure 6C). Moreover, while control RGCs continued to extend their neurites between day 2 and 3 similarly with and without LatA treatment (Figures 6D and 6E), the effect of exogenous MLP expression was strongly compromised by LatA (Figure 6E), indicating that the formation of F-actin was indispensable for MLP-mediated neurite growth promotion. We then tested the hypothesis that MLP self-associates through its N-terminal LIM domain (Lim1 domain) and binds to actin filaments through its C-terminal LIM domain (Lim2 domain) to cross-link and stabilize actin filaments in growth cones as previously shown in myocytes (Hoffmann et al., 2014). To this end, we took advantage of a previously described recombinant MLP mutant (Figure 7A) and an established assay that allows testing of actin-dependent filopodia formation in COS-7 cells (Ma et al., 2011; Worth et al., 2013). Expression of wild-type MLP in COS-7 caused extensive filopodia formation, almost tripling their length compared to control transfected cells, while co-expression of a HA-tagged MLP construct lacking the first LIM domain (DL1-MLP-HA) abrogated this effect (Figures 7B and 7C). Thus, consistent with the idea that this LIM1 domain cross-links two MLP proteins, which then interact with F-actin via the second LIM domain (Hoffmann et al., 2014), DL1-MLPHA disrupted this actin bundling in a dominant-negative fashion. Accordingly, expression of DL1-MLP-HA on its own was unable to induce filopodia formation in COS-7 cells (data not shown). We then investigated the functional consequences of DL1MLP-HA expression for rat RGCs. To this end, rat RGCs were transduced in vivo with the AAV expressing DL1-MLP-HA, and 3 weeks thereafter, animals were subjected to ONC/IS to induce endogenous MLP expression (see Figures 1, 2, and 3). Retinal cultures were prepared 7 days after injury and kept for 24 hr to assess spontaneous neurite growth. In comparison to nontransduced RGCs in the same cultures, DL1-MLP-HA-expressing RGCs showed strongly reduced neurite growth (Figures 7D and 7E). In order to verify that this negative effect of DL1-MLPHA was specific against endogenous rat MLP, we performed the same experiment in mouse RGCs that do not normally express MLP (see Figures S5A and S5B). In contrast to rat RGCs, DL1-MLP-HA did not compromise neurite growth of ONC/ IS-stimulated mouse RGCs (Figure 7F). Moreover, baculoviral co-expression of DL1-MLP-HA in cultured naive MLP transduced mouse RGCs abrogated the positive effect of exogenous MLP on neurite growth and on increasing the size of actin-rich growth cone area (Figures 7G and 7H). Therefore, dominantnegative DL1-MLP-HA compromised MLP-induced F-actin formation and neurite growth.

Cell Reports 26, 1021–1032, January 22, 2019 1027

Figure 6. F-Actin-Dependent Growth Promotion by MLP

Neurite

(A) RGCs isolated from adult rats that had received intravitreal injections of MLP-AAV 3 weeks before they were cultured for 3 d and co-stained with phalloidin-TRITC (white) to detect F-actin and GFP antibody to identify transduced cells (GFP+/MLP+). Scale bar: 10 mm. (B) Quantification of the growth cone area for RGCs as described in (A). The mean phalloidinTRITC area was significantly increased in transduced (MLP+) RGCs compared to non-transduced (MLP-) cells. Values represent means ± SEM. Effect: ***p < 0.001 for at least 100 cells per experiment from 2 independent experiments (n = 200) (Student’s t test). (C) Retinal cell cultures were prepared as described in (A) and treated either with vehicle () or 0.1 mM latrunculin A (LatA) after 2 d in culture. F-actin was detected 24 hr later. Filopodia formation in growth cones was strongly compromised upon LatA treatment. Scale bar: 10 mm. (D) Retinal cell cultures were treated as described in (C) and co-stained for bIII-tubulin (Tub, red) to identify RGCs and GFP (green) as transduction marker at 2 and 3 days (d) in culture, respectively. Scale bar: 50 mm. (E) Quantification of neurite growth in retinal cell cultures as described in (D). Neurite lengths per RGC were normalized to untreated non-transduced (MLP) cells at 3 d with 33.2 mm/RGC. Values represent means ± SEM for 3 independent experiments including 4 technical replicates each (n = 12). Treatment effects compared to untreated non-transduced (MLP) cells at 3 d: *p < 0.05; ***p < 0.001; ns, non-significant; treatment effect between untreated and LatA-treated transduced cells: ###p < 0.001 (two-way ANOVA with Holm-Sidak post hoc test).

DISCUSSION The current study shows expression of MLP in the adult CNS and its functional involvement in axon regeneration by modulating the dynamics of the actin cytoskeleton in growth cones. Thus, MLP is a regeneration-associated protein and modulation of its activity may be useful for developing approaches aiming to facilitate nerve repair. MLP has been long regarded as a muscle-specific protein. We have recently demonstrated that this protein is transiently expressed in postnatal amacrine cells under physiological conditions (Levin et al., 2014). The role of MLP in these cells is currently unknown. Here, we report the expression of MLP in the adult CNS, its correlation with the intrinsic regenerative state of injured neurons and its functional involvement in axon regeneration. Like other regeneration-associated genes, such as Gap43, Galanin, or Sprr1a (Fischer et al., 2004), neuronal Mlp expression was primarily induced by axotomy and further increased by growth-stimulatory IS, while IS alone remained ineffective. Moreover, the expression temporally correlated with the previously shown transformation of RGCs into a regenerative state, which starts in adult rats between 2 and 3 days after ONC+IS and further increases over the following days (Fischer et al., 2004). A correlation with the regenerative state was also observed in cell culture experiments, where MLPpositive RGCs showed stronger spontaneous neurite growth than MLP-negative neurons after prior in vivo stimulation (Figures S2A and S2B). Whether MLP is also expressed by other CNS neurons upon axonal damage, for example after

1028 Cell Reports 26, 1021–1032, January 22, 2019

spinal cord injury in the cortex, needs to be investigated in the future. The functional involvement of endogenous MLP in regeneration processes of injured rat axons was confirmed by shRNAmediated knockdown experiments revealing markedly reduced neurite growth of cultured RGCs and compromised nerve regeneration in vivo. Moreover, also expression of dominant-negative DL1-MLP diminished neurite growth of in vivo-primed rat RGCs and exogenously expressed protein in murine neurons. The specificity of DL1-MLP-mediated growth inhibition was verified by the absence of any effect in similarly treated, but non-MLPexpressing mouse RGCs. Knockdown or overexpression of MLP did not affect the survival of axotomized RGCs or the neuroprotective effects of IS. In addition, overexpression of the protein did not overcome myelin inhibition as previously shown for other molecules that promoted IS-induced optic nerve regeneration (Heskamp et al., 2013; Leibinger et al., 2013b, 2016, 2017). A combination with other neuroprotective and/or disinhibitory treatments might therefore further improve axon regeneration in the injured optic nerve. This possibility will be addressed in future studies. AAV-driven MLP expression in RGCs substantially promoted optic nerve regeneration in mice and rats. Since the naturally occurring induction of high MLP levels in axotomized rat RGCs took about 5–7 days in vivo, pre-injury MLP expression seemed to increase axon growth by providing a head start of regeneration. In support of this notion, cultures prepared from in vivo untreated rats, which showed only <10% of MLP-positive RGCs after 3 d, doubled their neurite growth already within this time

Figure 7. MLP in the Growth Cone Promotes RGC Neurite Growth (A) Schematic of full-length (native) MLP with two LIM domains and DL1-MLP (DL1) with the first LIM1 domain (red, amino acids 9–61) deleted. Blue squares represent glycine-rich regions. (B) COS-7 cells expressing MLP, MLP+DL1-MLP-HA (MLP/DL1), or NLS-MLP (NLS) were stained with phalloidin-TRITC to detect F-actin 48 hr after baculoviral transduction. Extensive filopodial protrusions were observed after MLP and NLS-MLP expression compared to control-treated cells (). MLP-induced filopodia formation was abrogated upon DL1-MLP-HA co-expression. Scale bars: 20 mm (upper row) and 5 mm (for the magnifications in the bottom row). (C) Quantification of the total filopodial length per cell as described in (B). Only filopodia >5 mm were included. Values represent means ± SEM of 83 to 408 cells per experimental group from at least 2 independent experiments (n R 83). Treatment effects compared to control (): ***p < 0.001; ns, non-significant; treatment effects compared to MLP: ###p < 0.001 (one-way ANOVA with Holm-Sidak post hoc test). (D) About 30% of rat RGCs were transduced after intravitreal injection of DL1-MLP-HA-AAV. Three weeks thereafter, rats were subjected to ONC/IS. RGCs were isolated 7 days after surgery and incubated for 24 hr to determine spontaneous neurite growth. In contrast to non-transduced bIII-tubulin-positive RGCs () in the same cultures, DL1-MLP-HA-expressing RGCs (detected by HA-tag, green) showed barely any neurite growth. Scale bar: 50 mm. (E) Quantification of cultures as described in (D) after 24 hr. Data were normalized to non-transduced RGCs showing an average neurite length of 6.4 mm/neuron. Values represent means ± SEM of 2 independent experiments including 4 technical replicates each (n = 8). Treatment effect: ***p < 0.001 (Student’s t test). (F) Quantification of neurite growth in mouse retinal cultures similarly treated as described in (D) for rats. Neurite growth of mouse RGCs not expressing endogenous MLP was not reduced upon DL1-MLP-HA expression compared to non-transduced controls (). Data were normalized to non-transduced RGCs showing an average neurite length of 2.6 mm/neuron. Treatment effect: ns, non-significant for 2 independent experiments with 4 technical replicates (n = 8) (Student’s t test). (G) Quantification of neurite growth in naive mouse RGC cultures. Cells were transduced using a MLP expressing baculovirus. After 3 days, cultures were cotransduced with DL1-MLP-HA-GFP or GFP as a control and fixed after additional 2 days. Expression of DL1-MLP-HA significantly reduced neurite growth compared to control transduced cultures (). Data were normalized to MLP + GFP-transduced controls with an average neurite length of 14 mm/RGC. Values represent means ± SEM in 2 independent experiments with 4 technical replicates respectively (n = 8). Treatment effects compared to control: ***p < 0.001, (Student’s t test). (H) Quantification of the growth cone area for RGCs as described in (G) and RGCs without MLP transduction prior to DL1-MLP-HA-GFP or GFP. Expression of DL1-MLP-HA significantly compromised MLP-induced increase in the mean phalloidin-TRITC growth cone area, whereas it had no effect in non-MLP-expressing controls (con). Effect: ***p < 0.001; ns, non-significant (one-way ANOVA with Holm-Sidak post hoc test). Values represent means ± SEM of 80–240 cells from 2 independent experiments (n R 160).

period, if transduced before in vivo. Because of the lack of endogenous MLP protein, mouse RGCs might have benefitted even more from this experimental manipulation. Moreover, the fact that MLP was also able to promote axon regeneration in mice indicates conserved molecular mechanisms and machineries in different species. It is therefore possible that, in mice, other proteins play a similar functional role as MLP in rat neurons. Whether primary neurons of other animals or humans express endogenous MLP upon injury, is currently unknown. In contrast to axotomized rat sensory neurons, where endogenous MLP expression is restricted to a small subpopulation

of injured non-peptidergic nociceptive neurons (Levin et al., 2017), >50% of axotomized RGCs with different sizes were MLP positive. Although these data suggest that the protein was not confined to a specific RGC subtype (Sanes and Masland, 2015), it still needs to be investigated why protein levels remained below detection levels in a significant percentage of RGCs even 14 days after ONC+IS. In contrast to postnatal amacrine cells (Levin et al., 2014), endogenous MLP was detected not only in the cytoplasm, axons, and growth cones, but also in the nuclei of injured RGCs. Thus, the intracellular distribution seems to vary between different neuronal

Cell Reports 26, 1021–1032, January 22, 2019 1029

cell types and opened the question whether nuclear MLP could be involved in neuronal gene regulation. In fact, nuclear accumulation of MLP is reportedly induced by biomechanical stress in myocytes (Boateng et al., 2007) and modulates gene expression by interacting with transcription factors, such as MyoD, myogenin, and MRF4 (Kong et al., 1997). Although we cannot exclude any role of nuclear MLP in injured RGCs, our data suggest no essential involvement in axon growth promotion. Consistently, overall expression of other regeneration-associated genes (Gap43, Galanin, Sprr1a) was not altered by exogenous MLP expression. Furthermore, the active MLP construct with nuclear localization signal, which was absent in neuronal growth cones, failed to enhance axon regeneration of RGCs in culture and in vivo. Our data rather support the notion that MLP associated with F-actin in growth cones is required to promote axon growth. In accordance with this idea, we found MLP particularly in the F-actinrich parts of axonal growth cones and its overexpression increased their sizes, a feature that is typically associated with enhanced motility and neurite elongation (Argiro et al., 1984). In fact, in myocytes, MLP directly binds actin filaments and promotes actin bundling upon self-dimerization (Hoffmann et al., 2014). Because overexpression of recombinant MLP without the dimerizing LIM1 domain blocked MLP-mediated filopodia formation in COS7 cells as well as neurite extension of rat RGCs in a dominant-negative way, a similar function as previously described for other actin cross-linkers is conceivable for MLP in neuronal growth cones (Chen et al., 2011; Gomez and Letourneau, 2014; Harder et al., 2008; Mizui et al., 2009; Worth et al., 2013). MLP-mediated cross-linking of F-actin, however, did neither confer disinhibition toward CNS myelin nor mitigate the sensitivity toward the actin depolarization agent LatA upon MLP expression. On the contrary, the neurite growth-promoting effect of MLP was abolished upon LatA treatment, demonstrating that it was dependent on the formation of F-actin. Thus, MLP might have increased filopodia formation, a prerequisite for highly motile growth cones without affecting F-actin stabiity (Gallo et al., 2002). Microtubules are known to provide the main force for neurite extension, as even without actin dynamics axonal elongation proceeds by microtubule advance and plasma membrane expansion. However, in this case, axonal elongation is slow and unresponsive to extrinsic cues (Gomez and Letourneau, 2014; Hur et al., 2011, 2012). Consistently, LatA treatment did not block neurite extension of cultured RGCs per se but only compromised the MLP effect. In addition to directly acting on F-actin, MLP might also affect other actin-associated proteins such as cofilin and a-actinin, which themselves have been assigned important roles for neurite growth (Flynn et al., 2012; Letourneau and Shattuck, 1989). However, a potential interaction of these proteins as shown in muscle tissue (Flick and Konieczny, 2000; Papalouka et al., 2009) would have to be confirmed for neurons. Alternatively, MLP might interact with additional or other proteins in neurons than in myocytes, which could be identified in a future proteomics study. Mlp together with the previously identified regenerationassociated genes Gap43 and Sprr1a was one of the strongest upregulated genes in regenerating neurons in our previous microarray study (Fischer et al., 2004). Interestingly all of these proteins are involved in the regulation of the actin cytoskeleton

1030 Cell Reports 26, 1021–1032, January 22, 2019

(Benowitz and Routtenberg, 1997; Bonilla et al., 2002; Frey et al., 2000). Nevertheless, MLP belongs to another protein family and is structurally distinct from Gap43, Cap23, and Sprr1a and the underlying actin-dependent mechanism is different. While overexpression of Gap43, Cap23, and Sprr1a reportedly promote axon regeneration by regulating actin dynamics (Bonilla et al., 2002; Frey et al., 2000), our data suggest that MLP supports axon growth by cross-linking actin filaments and thereby facilitating filopodia formation. Moreover, increased growth cones sizes as found for MLP overexpression were not reported after Sprr1a, Gap43, or CAP23 overexpression. Interestingly, we found a regulation of GAP43 and MLP expression by different signaling pathways. While, consistent with previous work (Leibinger et al., 2013a), GAP43 expression depended on the JAK/STAT3 pathway, but not on mTOR activity, MLP expression was not affected by JAK-inhibition, but depended on mTOR activity. Whether the inhibitory effect of rapamycin on neurite growth occurring in rat but not in mouse RGCs (Heskamp et al., 2013; Leibinger et al., 2012), is due to its suppression of endogenous MLP and whether overexpression of MLP together with one of the other RAGs has additional effects on axonal growth need to be addressed in the future. Furthermore, future research should investigate whether MLP might also promote the regeneration of other central or peripheral axons in vivo. In the case of similar beneficial effects, MLP might be a potential target for the development of novel therapeutic approaches aiming to facilitate nerve repair. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Animals B Cell lines B Primary cell cultures METHOD DETAILS B Gene constructs B Generation of AAV2 and baculoviruses B Surgical procedures B RNA Isolation and quantitative real-time PCR B Western Blot B Immunohistochemistry B Dissociated retinal cell cultures B DRG cultures B COS-7 cell assay B Optic nerve tissue clearing QUANTIFICATION AND STATISTICAL ANALYSIS B Statistics B Quantification of regenerating axons in the optic nerve B Quantification of RGCs in retinal whole-mounts

SUPPLEMENTAL INFORMATION Supplemental Information includes seven figures and can be found with this article online at https://doi.org/10.1016/j.celrep.2018.12.026.

ACKNOWLEDGMENTS We would like to thank Marcel Kohlhaas for technical support and Dr. Heike Diekmann for helpful comments on the manuscript. This work was supported by the German Research Foundation (FI 867/17-1). AUTHOR CONTRIBUTIONS D.F. designed the concept and supervised research. E.L., M.L., A.H., P.G., and D.F. performed research. E.L., M.L., A.A., P.G., A.H., and D.F. analyzed data. E.L., M.L., and D.F. wrote the paper. DECLARATION OF INTERESTS

Fischer, D., Pavlidis, M., and Thanos, S. (2000). Cataractogenic lens injury prevents traumatic ganglion cell death and promotes axonal regeneration both in vivo and in culture. Invest. Ophthalmol. Vis. Sci. 41, 3943–3954. Fischer, D., Petkova, V., Thanos, S., and Benowitz, L.I. (2004). Switching mature retinal ganglion cells to a robust growth state in vivo: gene expression and synergy with RhoA inactivation. J. Neurosci. 24, 8726–8740. Flick, M.J., and Konieczny, S.F. (2000). The muscle regulatory and structural protein MLP is a cytoskeletal binding partner of betaI-spectrin. J. Cell Sci. 113, 1553–1564. Flynn, K.C., Hellal, F., Neukirchen, D., Jacob, S., Tahirovic, S., Dupraz, S., Stern, S., Garvalov, B.K., Gurniak, C., Shaw, A.E., et al. (2012). ADF/cofilinmediated actin retrograde flow directs neurite formation in the developing brain. Neuron 76, 1091–1107.

The authors declare no competing interests.

Frey, D., Laux, T., Xu, L., Schneider, C., and Caroni, P. (2000). Shared and unique roles of CAP23 and GAP43 in actin regulation, neurite outgrowth, and anatomical plasticity. J. Cell Biol. 149, 1443–1454.

Received: December 19, 2017 Revised: September 5, 2018 Accepted: December 5, 2018 Published: January 22, 2019

Gallo, G., Yee, H.F., Jr., and Letourneau, P.C. (2002). Actin turnover is required to prevent axon retraction driven by endogenous actomyosin contractility. J. Cell Biol. 158, 1219–1228.

REFERENCES Ahmed, Z., Mazibrada, G., Seabright, R.J., Dent, R.G., Berry, M., and Logan, A. (2006). TACE-induced cleavage of NgR and p75NTR in dorsal root ganglion cultures disinhibits outgrowth and promotes branching of neurites in the presence of inhibitory CNS myelin. FASEB J. 20, 1939–1941. Arber, S., and Caroni, P. (1996). Specificity of single LIM motifs in targeting and LIM/LIM interactions in situ. Genes Dev. 10, 289–300. Arber, S., Halder, G., and Caroni, P. (1994). Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation. Cell 79, 221–231. Arber, S., Hunter, J.J., Ross, J., Jr., Hongo, M., Sansig, G., Borg, J., Perriard, J.C., Chien, K.R., and Caroni, P. (1997). MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell 88, 393–403. Argiro, V., Bunge, M.B., and Johnson, M.I. (1984). Correlation between growth form and movement and their dependence on neuronal age. J. Neurosci. 4, 3051–3062. Benowitz, L.I., and Routtenberg, A. (1997). GAP-43: an intrinsic determinant of neuronal development and plasticity. Trends Neurosci. 20, 84–91. Berkelaar, M., Clarke, D.B., Wang, Y.C., Bray, G.M., and Aguayo, A.J. (1994). Axotomy results in delayed death and apoptosis of retinal ganglion cells in adult rats. J. Neurosci. 14, 4368–4374. Boateng, S.Y., Belin, R.J., Geenen, D.L., Margulies, K.B., Martin, J.L., Hoshijima, M., de Tombe, P.P., and Russell, B. (2007). Cardiac dysfunction and heart failure are associated with abnormalities in the subcellular distribution and amounts of oligomeric muscle LIM protein. Am. J. Physiol. Heart Circ. Physiol. 292, H259–H269. Bonilla, I.E., Tanabe, K., and Strittmatter, S.M. (2002). Small proline-rich repeat protein 1A is expressed by axotomized neurons and promotes axonal outgrowth. J. Neurosci. 22, 1303–1315. Buyandelger, B., Ng, K.E., Miocic, S., Piotrowska, I., Gunkel, S., Ku, C.H., and Kno¨ll, R. (2011). MLP (muscle LIM protein) as a stress sensor in the heart. Pflugers Arch. 462, 135–142. Chen, Y., Wang, F., Long, H., Chen, Y., Wu, Z., and Ma, L. (2011). GRK5 promotes F-actin bundling and targets bundles to membrane structures to control neuronal morphogenesis. J. Cell Biol. 194, 905–920.

€rst, D., and Ehler, E. (2008). Back to Gehmlich, K., Geier, C., Milting, H., Fu square one: what do we know about the functions of muscle LIM protein in the heart? J. Muscle Res. Cell Motil. 29, 155–158. Gobrecht, P., Leibinger, M., Andreadaki, A., and Fischer, D. (2014). Sustained GSK3 activity markedly facilitates nerve regeneration. Nat. Commun. 5, 4561. Gobrecht, P., Andreadaki, A., Diekmann, H., Heskamp, A., Leibinger, M., and Fischer, D. (2016). Promotion of functional nerve regeneration by inhibition of microtubule detyrosination. J. Neurosci. 36, 3890–3902. Gomez, T.M., and Letourneau, P.C. (2014). Actin dynamics in growth cone motility and navigation. J. Neurochem. 129, 221–234. Grozdanov, V., Muller, A., Sengottuvel, V., Leibinger, M., and Fischer, D. (2010). A method for preparing primary retinal cell cultures for evaluating the neuroprotective and neuritogenic effect of factors on axotomized mature CNS neurons. Curr. Protoc. Neurosci. Chapter 3, Unit 3.22. Harder, J., Xu, X., Letourneau, P., and Lanier, L.M. (2008). The actin cross-linking protein AFAP120 regulates axon elongation in a tyrosine phosphorylationdependent manner. Neurosci. Lett. 444, 132–136. Harvey, A.R. (2014). Gene therapy and the regeneration of retinal ganglion cell axons. Neural Regen. Res. 9, 232–233. Hasaka, T.P., Myers, K.A., and Baas, P.W. (2004). Role of actin filaments in the axonal transport of microtubules. J. Neurosci. 24, 11291–11301. Heskamp, A., Leibinger, M., Andreadaki, A., Gobrecht, P., Diekmann, H., and Fischer, D. (2013). CXCL12/SDF-1 facilitates optic nerve regeneration. Neurobiol. Dis. 55, 76–86. Hoffmann, C., Moreau, F., Moes, M., Luthold, C., Dieterle, M., Goretti, E., Neumann, K., Steinmetz, A., and Thomas, C. (2014). Human muscle LIM protein dimerizes along the actin cytoskeleton and cross-links actin filaments. Mol. Cell. Biol. 34, 3053–3065. Hur, E.M., Yang, I.H., Kim, D.H., Byun, J., Saijilafu, Xu, W.L., Nicovich, P.R., Cheong, R., Levchenko, A., Thakor, N., and Zhou, F.Q. (2011). Engineering neuronal growth cones to promote axon regeneration over inhibitory molecules. Proc. Natl. Acad. Sci. USA 108, 5057–5062. Hur, E.M., Saijilafu, and Zhou, F.Q. (2012). Growing the growth cone: remodeling the cytoskeleton to promote axon regeneration. Trends Neurosci. 35, 164–174. Kno¨ll, R., Hoshijima, M., Hoffman, H.M., Person, V., Lorenzen-Schmidt, I., Bang, M.L., Hayashi, T., Shiga, N., Yasukawa, H., Schaper, W., et al. (2002). The cardiac mechanical stretch sensor machinery involves a Z disc complex that is defective in a subset of human dilated cardiomyopathy. Cell 111, 943–955.

Cojoc, D., Difato, F., Ferrari, E., Shahapure, R.B., Laishram, J., Righi, M., Di Fabrizio, E.M., and Torre, V. (2007). Properties of the force exerted by filopodia and lamellipodia and the involvement of cytoskeletal components. PLoS One 2, e1072.

Kong, Y., Flick, M.J., Kudla, A.J., and Konieczny, S.F. (1997). Muscle LIM protein promotes myogenesis by enhancing the activity of MyoD. Mol. Cell. Biol. 17, 4750–4760.

Fischer, D., and Leibinger, M. (2012). Promoting optic nerve regeneration. Prog. Retin. Eye Res. 31, 688–701.

€ller, A., Andreadaki, A., Hauk, T.G., Kirsch, M., and Fischer, Leibinger, M., Mu D. (2009). Neuroprotective and axon growth-promoting effects following

Cell Reports 26, 1021–1032, January 22, 2019 1031

inflammatory stimulation on mature retinal ganglion cells in mice depend on ciliary neurotrophic factor and leukemia inhibitory factor. J. Neurosci. 29, 14334–14341.

McManus, E.J., Sakamoto, K., Armit, L.J., Ronaldson, L., Shpiro, N., Marquez, R., and Alessi, D.R. (2005). Role that phosphorylation of GSK3 plays in insulin and Wnt signaling defined by knockin analysis. EMBO J 24, 1571–1583.

Leibinger, M., Andreadaki, A., and Fischer, D. (2012). Role of mTOR in neuroprotection and axon regeneration after inflammatory stimulation. Neurobiol. Dis. 46, 314–324.

Mizui, T., Kojima, N., Yamazaki, H., Katayama, M., Hanamura, K., and Shirao, T. (2009). Drebrin E is involved in the regulation of axonal growth through actinmyosin interactions. J. Neurochem. 109, 611–622.

Leibinger, M., Andreadaki, A., Diekmann, H., and Fischer, D. (2013a). Neuronal STAT3 activation is essential for CNTF- and inflammatory stimulation-induced CNS axon regeneration. Cell Death Dis. 4, e805.

€ller, A., Hauk, T.G., and Fischer, D. (2007). Astrocyte-derived CNTF Mu switches mature RGCs to a regenerative state following inflammatory stimulation. Brain 130, 3308–3320.

€ller, A., Gobrecht, P., Diekmann, H., Andreadaki, A., and Leibinger, M., Mu Fischer, D. (2013b). Interleukin-6 contributes to CNS axon regeneration upon inflammatory stimulation. Cell Death Dis. 4, e609.

Papalouka, V., Arvanitis, D.A., Vafiadaki, E., Mavroidis, M., Papadodima, S.A., Spiliopoulou, C.A., Kremastinos, D.T., Kranias, E.G., and Sanoudou, D. (2009). Muscle LIM protein interacts with cofilin 2 and regulates F-actin dynamics in cardiac and skeletal muscle. Mol. Cell. Biol. 29, 6046–6058.

Leibinger, M., Andreadaki, A., Gobrecht, P., Levin, E., Diekmann, H., and Fischer, D. (2016). Boosting central nervous system axon regeneration by circumventing limitations of natural cytokine signaling. Mol. Ther. 24, 1712–1725. Leibinger, M., Andreadaki, A., Golla, R., Levin, E., Hilla, A.M., Diekmann, H., and Fischer, D. (2017). Boosting CNS axon regeneration by harnessing antagonistic effects of GSK3 activity. Proc. Natl. Acad. Sci. USA 114, E5454–E5463. Leon, S., Yin, Y., Nguyen, J., Irwin, N., and Benowitz, L.I. (2000). Lens injury stimulates axon regeneration in the mature rat optic nerve. J. Neurosci. 20, 4615–4626. Letourneau, P.C., and Shattuck, T.A. (1989). Distribution and possible interactions of actin-associated proteins and cell adhesion molecules of nerve growth cones. Development 105, 505–519. Levin, E., Leibinger, M., Andreadaki, A., and Fischer, D. (2014). Neuronal expression of muscle LIM protein in postnatal retinae of rodents. PLoS One 9, e100756. Levin, E., Diekmann, H., and Fischer, D. (2016). Highly efficient transduction of primary adult CNS and PNS neurons. Sci. Rep. 6, 38928. Levin, E., Andreadaki, A., Gobrecht, P., Bosse, F., and Fischer, D. (2017). Nociceptive DRG neurons express muscle lim protein upon axonal injury. Sci. Rep. 7, 643. Louis, H.A., Pino, J.D., Schmeichel, K.L., Pomie`s, P., and Beckerle, M.C. (1997). Comparison of three members of the cysteine-rich protein family reveals functional conservation and divergent patterns of gene expression. J. Biol. Chem. 272, 27484–27491. Ma, L., Greenwood, J.A., and Schachner, M. (2011). CRP1, a protein localized in filopodia of growth cones, is involved in dendritic growth. J. Neurosci. 31, 16781–16791.

1032 Cell Reports 26, 1021–1032, January 22, 2019

Renier, N., Wu, Z., Simon, D.J., Yang, J., Ariel, P., and Tessier-Lavigne, M. (2014). iDISCO: a simple, rapid method to immunolabel large tissue samples for volume imaging. Cell 159, 896–910. Sanes, J.R., and Masland, R.H. (2015). The types of retinal ganglion cells: current status and implications for neuronal classification. Annu. Rev. Neurosci. 38, 221–246. Sanoudou, D., Corbett, M.A., Han, M., Ghoddusi, M., Nguyen, M.A., Vlahovich, N., Hardeman, E.C., and Beggs, A.H. (2006). Skeletal muscle repair in a mouse model of nemaline myopathy. Hum. Mol. Genet. 15, 2603–2612. Sengottuvel, V., Leibinger, M., Pfreimer, M., Andreadaki, A., and Fischer, D. (2011). Taxol facilitates axon regeneration in the mature CNS. J. Neurosci. 31, 2688–2699. Silver, J., and Miller, J.H. (2004). Regeneration beyond the glial scar. Nat. Rev. Neurosci. 5, 146–156. Vafiadaki, E., Arvanitis, D.A., and Sanoudou, D. (2015). Muscle LIM protein: master regulator of cardiac and skeletal muscle functions. Gene 566, 1–7. Winokur, S.T., Chen, Y.W., Masny, P.S., Martin, J.H., Ehmsen, J.T., Tapscott, S.J., van der Maarel, S.M., Hayashi, Y., and Flanigan, K.M. (2003). Expression profiling of FSHD muscle supports a defect in specific stages of myogenic differentiation. Hum. Mol. Genet. 12, 2895–2907. Worth, D.C., Daly, C.N., Geraldo, S., Oozeer, F., and Gordon-Weeks, P.R. (2013). Drebrin contains a cryptic F-actin-bundling activity regulated by Cdk5 phosphorylation. J. Cell Biol. 202, 793–806. Zolotukhin, S., Byrne, B.J., Mason, E., Zolotukhin, I., Potter, M., Chesnut, K., Summerford, C., Samulski, R.J., and Muzyczka, N. (1999). Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther. 6, 973–985.

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Antibodies MLP

United States Biological

RRID: AB_2087783

MLP

€ck Center for Dr. Geier, Max Delbru Molecular Medicine, Berlin, Germany

N/A

bIII-tubulin

Biolegend

RRID:AB_2313773

GFP

Thermo Fisher

RRID:AB_221570

pS6

Cell signaling technologies

RRID:AB_2181035

Baculovirus

Levin et al., 2016

N/A

AAV2

Zolotukhin et al., 1999

N/A

Adult mouse DRG neurons

Gobrecht et al., 2014

N/A

Adult mouse RGCs

Leibinger et al., 2009

N/A

Adult Rat RGCs

Grozdanov et al., 2010

N/A

Bacterial and Virus Strains

Biological Samples

Chemicals, Peptides, and Recombinant Proteins CNTF

Peprotech

Cat#450-50

LatA

Cayman

Cat#CAY10010520-50

rapamycin

LC-Laboratories

Cat#R-5000

AG490

Calbiochem

Cat#658401

LY 294002

Sigma

Cat#L9908

Thermo Fisher

Cat#A24227

Critical Commercial Assays ViraPower BacMam Expression System Deposited Data HA-tagged MLP (MLP-HA)

This paper

https://www.ebi.ac.uk/ena ERZ778054

NLS-MLP

This paper

https://www.ebi.ac.uk/ena ERZ778056

DL1-HA MLP

This paper

https://www.ebi.ac.uk/ena ERZ778058

MLP

This paper

https://www.ebi.ac.uk/ena ERZ778053

MLP shRNA

This paper

https://www.ebi.ac.uk/ena ERZ778059

COS-7 cells

N/A

N/A

AAV-293 cells

Stratagene

Cat#240073

C57BL/6JRj mice

Janvier

https://www.janvier-labs.com/rodentresearch-models-services/researchmodels/per-species/inbred-mice/ product/c57bl6jrj.html

C57BL/6,129/Ola(B6CF1) mice

provided by Prof. Dr. Dario Alessi (University of Dundee, UK); McManus et al., 2005

N/A

RjOrl:SWISS mice

Janvier

https://www.janvier-labs.com/rodentresearch-models-services/researchmodels/per-species/outbred-mice/ product/swiss.html

RjHan:SD. Sprague Dawley rats

Janvier

https://www.janvier-labs.com/rodentresearch-models-services/researchmodels/per-species/outbred-rats/ product/sprague-dawley.html

Experimental Models: Cell Lines

Experimental Models: Organisms/Strains

(Continued on next page)

Cell Reports 26, 1021–1032.e1–e6, January 22, 2019 e1

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

This paper

ENA# ERZ778053

This paper

ENA#ERZ778054

This paper

ENA# ERZ778058

This paper

ENA# ERZ778056

Levin et al., 2017

https://www.ebi.ac.uk/ena ERZ778059

MLP rn

QIAGEN

Cat#QT00183708

MLP mm

QIAGEN

Cat#QT01076936

Gap43

QIAGEN

Cat#QT00101955

Galanin

QIAGEN

Cat#QT249900

Gapdh

QIAGEN

Cat#QT01658692

Oligonucleotides MLP 50 -CTGAGTCTTCACCATGCCGA-30 and 50 -CACGCCG TTTCACTCCTTC-30 MLP-HA 50 -CTGAGTCTTCACCATGCCGA-30 and 50 -TCAAGC GTAATCTGGAACATCGTATGGGTACTCCTTCTTTTCC ACTTGGTG-3 MLP DL1-HA 50 -TATGGGCGCAAGTATGGCC-30 and 50 -TGCACCT CCACCCCAGTT-30 NLS-MLP 50 -GCTTTTTCTTCATGGTGAAGACTCAGAAGGG-30 and 5’-GACGAGTAGAACCGAACTGGGGTGGAGGT-3 MLP-sh 50 -GATCC-GGTTTACCATGCAGAAGAAAT-CTCGAGATTTCTTCTGCATGGTAAACC-TTTT-AGATCTA-30

Recombinant DNA HA-tagged MLP (MLP-HA)

This paper

https://www.ebi.ac.uk/ena ERZ778054

NLS-MLP

This paper

https://www.ebi.ac.uk/ena ERZ778056

DL1-HA MLP

This paper

https://www.ebi.ac.uk/ena ERZ778058

MLP

This paper

https://www.ebi.ac.uk/ena ERZ778053

MLP shRNA

This paper

https://www.ebi.ac.uk/ena ERZ778059

Axiovision 4.9

Zeiss

N/A

Zen black

Zeiss

N/A

LAS X

Leica

N/A

Sigma STAT 3.2

Systat Software

N/A

ImageJ

https://imagej.nih.gov/ij/

N/A

Software and Algorithms

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Dietmar Fischer ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Animals Mice and rats Seven to 12 week old male and female adult C57BL/6 (inbred), C57BL/6,129/Ola (B6CF1) (inbred), jOrl:SWISS (outbred) mice (20-25 g bodyweight) and adult Sprague Dawley rats (200-250 g bodyweight) were used for all experiments. Animals were housed under the same conditions for at least 10 d prior to use in experiments and maintained on a 12 hour light/dark cycle with ad libitum access to food and water. Littermates of the same sex were randomly assigned to experimental groups. All experimental procedures were approved by the local animal care committee (LANUV Recklinghausen) and conducted in compliance with federal and state guidelines for animal experiments in Germany (Permit Numbers: 84-02.04.2012.A300, 84-02.04.2015.A179). Rats were killed by CO2 inhalation and mice by cervical dislocation, respectively. Alternatively, animals were anesthetized by intraperitoneal application

e2 Cell Reports 26, 1021–1032.e1–e6, January 22, 2019

of ketamine (60–80 mg/kg; Pfizer) and xylazine (10–15 mg/kg; Bayer) and intracardially perfused with cold PBS (ThermoFisher) followed by 4% paraformaldehyde (PFA, Sigma) in PBS. Cell lines AAV-293 cells; COS-7 cells; SF9 cells COS-7 and AAV-293 cells were incubated at 37 C and 5% CO2 in DMEM (ThermoFisher) containing 10% fetal bovine serum (ThermoFisher) and 200 U/ml penicillin/streptomycin (Merck). For analysis, COS-7 cells were then plated on glass coverslips (VWR) coated with poly-D-lysine (0.1 mg/ml, molecular weight 70,000-150,000 Da, Sigma) whereas AAV-293 cells were plated on 150 mm culture dishes for AAV production (Sarstedt). SF9 cells were incubated in Sf-900TM III SFM medium (ThermoFisher) containing 12.5 U/ml penicillin/streptomycin as a suspension culture on an orbital shaker at 130 rpm and 27 C. Primary cell cultures Mouse DRG neurons; rat retinal ganglion cells; mouse retinal ganglion cells Primary cell cultures were obtained from 7-9 weeks old male and female C57BL/6 mice; C57BL/6,129/Ola(B6CF1) mice, or male and female Sprague Dawley rats. DRG cells were suspended in DMEM supplemented with 10% fetal bovine serum (ThermoFisher) and 500 U/ml penicillin/streptomycin (Merck) and 200–300 DRG neurons per well were cultured in 96-well plates (ThermoFischer), coated with 0.1 mg/ml poly-D-lysine (70,000-150,000 Da, Sigma) and 20 mg/ml laminin (Sigma). RGCs were suspended in DMEM (6.5 ml/rat retina, 1.5 ml/mouse retina) containing B27-supplement (1:50, ThermoFisher) and 200 U/ml penicillin/streptomycin (Merck) and cultured on tissue culture plates (4-well-plates; ThermoFisher), coated with poly-Dlysine (0.1 mg/ml, molecular weight 70,000-150,000 Da, Sigma) and in some cases with 20 mg/ml laminin (Sigma) as indicated. All primary cells were kept at 37 C and 5% CO2. METHOD DETAILS Gene constructs MLP was cloned from a rat subjected to ONC and IS 5 days prior to retina isolation using the following primers: 50 -CTGAGTCTTCACCATGCCGA-30 and 50 -CACGCCGTTTCACTCCTTC-30 (ENA# ERZ778053). HA-tagged MLP (MLP-HA; ENA# ERZ778054) was generated via PCR by adding the respective DNA sequence at the MLP C terminus using primers 50 -CTGAGTCTTCAC CATGCCGA-30 and 50 -TCAAGCGTAATCTGGAACATCGTATGGGTACTCCTTCTTTTCCACTTGGTG-30 . An MLP deletion construct without the first LIM domain (DL1-HA; ENA# ERZ778058) was generated using MLP-HA, the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) and primers 50 -TATGGGCGCAAGTATGGCC-30 and 50 -TGCACCTCCACCCCAGTT-30 to delete the DNA sequence encoding amino acids 9–61 (Hoffmann et al., 2014). The DNA sequence for the simian virus 40 nuclear localization signal (KKKRRVE) (Kong et al., 1997) was added to the N terminus of MLP using the Q5 Site-Directed Mutagenesis Kit and primers 50 -GCTTTTTCTTCATGGTGAAGACTCAGAAGGG-30 and 5’-GACGAGTAGAACCGAACTGGGGTGGAGGT-3’ to create NLS-MLP (ENA# ERZ778056). Respective cDNAs were cloned into pAAV-IRES-hrGFP vector (Agilent Technologies) for the production of AAV2 and into BacMam pCMV-Dest vector (ThermoFisher) for the generation of baculoviruses. Cre-HA plasmid that served as control was kindly provided by Dr. Zhigang He (Boston, USA). For MLP knockdown the following DNA-Sequence encoding an shRNA construct (Levin et al., 2017) (ENA# ERZ778059) was generated and cloned into pAAV-U6-EGFP vector (Vector Biolabs): 50 -GATCC-GGTTTACCATGCAGAAGAAAT-CTCGAGATTTCTTCTGCATGGTAAACC-TTTT-AGATCTA-3 0 . Generation of AAV2 and baculoviruses AAV2 expressing either MLP, MLP-shRNA, or scrambled shRNA were made by Vector Biolabs. For the generation of AAV2 expressing GFP and DL1-HA the respective AAV plasmid was co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap and the helper plasmid (Stratagene) encoding E24, E4, and VA into AAV-293 cells (Stratagene). Purification of virus particles was performed as described previously (Zolotukhin et al., 1999). Baculoviruses were prepared as described previously (Levin et al., 2016) using the ViraPower BacMam Expression System (ThermoFisher). Surgical procedures Adult rats (weighing 200-230 g) and C57BL/6 mice (weighing 20-25 g) were anesthetized by intraperitoneal injections of ketamine (60-80 mg/kg) and xylazine (10-15 mg/kg). A 1-1.5 cm incision was made in the skin above the left orbit. The optic nerve was surgically exposed under an operating microscope and its dural sheath longitudinally opened. The nerve was crushed 1 mm behind the eye for 10 s using a jeweler’s forceps, avoiding injury to the retinal artery. The vascular integrity of the retina was verified by fundoscopic examination after surgery. Lens injury was induced by retrolentally puncturing the lens capsule with the tip of a microcapillary tube. Rats and mice received AAV2 injections 3 weeks before further experiments. Two days prior to tissue isolation, regenerating axons in mouse optic nerves were labeled by intravitreal injection of 2 ml Alexa Flour 555-conjugated cholera toxin b subunit (0.5% CTB, in PBS; Molecular Probes, Carlsbad, Eugene, USA).

Cell Reports 26, 1021–1032.e1–e6, January 22, 2019 e3

RNA Isolation and quantitative real-time PCR Total RNA was isolated from retinae or DRG of rats and mice using the RNeasy kit (QIAGEN) according to the manufacturer’s protocol. The RNA (40 ng) was reversely transcribed using the superscript II kit (Invitrogen). Expression analysis of rat or mouse Mlp, glyceraldehyde 3-phosphate dehydrogenase (Gapdh), growth associated protein 43 (Gap43), small proline rich protein 1A (Sprr1a) and Galanin was performed using SYBR Green PCR Master Mix (Applied Biosystems) and QuantiTect primers (Rn_Csrp3_1_SG, Rn_Gapdh_1_SG, Mm_Csrp3_1_SG and Mm_Gapdh_3_SG; Mm_Gap43_1_SG, Mm_Sprr1a_2_SG, Mm_Gal_1_SG; QIAGEN) on the Applied Biosystems 7500 real-time PCR system. Retina- or DRG-derived cDNA was amplified during 45 cycles according to the manufacturer’s protocol. All reactions were performed in duplicate and at least three independent samples were analyzed per experimental group. Quantitative analysis was performed using Applied Biosystems 7500 software, calculating the expression of Mlp, Gap43, Sprr1a and Galanin relative to the endogenous housekeeping gene Gapdh. Relative quantification was calculated using the comparative threshold cycle method (DDCT). The specificity of the PCR products from each run was verified with the dissociation curve analysis feature of the Applied Biosystems 7500 software. Western Blot For lysate preparation, retinae or DRG were dissected and collected in lysis buffer (20 mM Tris/HCl (Sigma), pH 7.5, 10 mM KCl (AppliChem), 250 mM sucrose (Sigma), 10 mM NaF (Sigma), 1 mM DTT (Sigma), 0.1 mM Na3VO4 (Sigma), 1% Triton X-100 (Sigma), 0.1% SDS (Sigma) with protease inhibitors (Calbiochem) and phosphatase inhibitors (Roche). Lysates were homogenized by sonification and centrifuged at 5,000 rpm for 10 min. Separation of proteins was performed by 10% SDS polyacrylamide gel electrophoresis according to standard protocols (Bio-Rad). Afterward, proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad) using the transblot turbo system (Bio-Rad). Blots were blocked in 5% dried milk/1% bovine serum albumin (BSA) in phosphate-buffered saline with 0.05% Tween 20 (PBS-T) (Sigma) and processed for immunostaining with either a polyclonal antibody against MLP (1:500; C9001-23; United States Biological, RRID: AB_2087783), a monoclonal antibody against b-actin (1:5000; AC-15; Sigma, RRID: AB_476744), or a monoclonal antibody against bIII-tubulin (1:1,000; clone TUJ1; MMS-435P; Biolegend, RRID: AB_2313773). Bound anti-MLP-antibody was visualized with anti-goat immunoglobulin G (IgG) secondary antibody conjugated to horseradish peroxidase (1:80,000; Sigma) and the antigen-antibody complexes were detected by enhanced chemiluminescence (Biozyme) on a FluoChemE detection system (ProteinSimple). Bound anti-actin and anti-bIII-tubulin antibodies were visualized with anti-mouse infrared dye secondary antibody (1:20,000; IRDey 800 CW; LI-COR) using the Odyssey Infrared Imaging System (LI-COR). ImageJ software was used for densitometric quantification. Band intensities were normalized to actin or bIII-tubulin loading controls and respective control groups as indicated. Immunohistochemistry Eyes with optic nerve segments were isolated from perfused animals, freed from connective tissue, post-fixed for several hours in 4% PFA, incubated in 30% sucrose overnight (4 C) and embedded in KP-cryo compound (Klinipath). Longitudinal sections (14 mm) were prepared using the CM3050 S cryostat (Leica Biosystems), thaw-mounted onto coated glass slides (Superfrost plus, VWR) and stored at 20 C until further use. Flat-mounted retinae were prepared without prior perfusion, fixed in 4% PFA for 30 min, treated with 2% Triton X-100 (Sigma) for 1 h and blocked in 2% BSA, 10% donkey serum in PBS-T for 1 h.. Antibodies against MLP €ck (1:400; C9001-23; United States Biological; RRID: AB_2087783 or a monoclonal antibody [a kind gift from Dr. Geier, Max Delbru Center for Molecular Medicine, Berlin, Germany]), bIII-tubulin (1:1,000; clone TUJ1; MMS-435P; Biolegend, RRID: AB_2313773), eGFP (1:1,000; A6455;ThermoFisher, RRID: AB_221570), hr-GFP (1:1,000; Vitality rabbit anti-hrGFP; Agilent Technologies, RRID:AB_10644103), GAP-43 (1:1,000; custom-made antibody), and pS6 (1:500, cell signaling, RRID:AB_2181035) were used. Secondary antibodies included anti-mouse, anti-rabbit, anti-goat and anti-sheep IgG antibodies conjugated to Alexa Fluor 488 or Alexa Fluor 594 (1:1,000; ThermoFisher). Sections and whole mounts were coverslipped with Mowiol and analyzed using either fluorescent (Observer.D1, Zeiss) or confocal laser scanning (SP8, Leica; LSM 510, Zeiss) microscopes. Dissociated retinal cell cultures Dissociated low-density retinal cell cultures were prepared as described previously (Grozdanov et al., 2010) from retinae of uninjured mice and rats with or without prior AAV2-injection or from mice and rats, which received ONC + IS 5 or 7 days prior to tissue isolation. In brief, tissue culture plates (4well-plates; ThermoFisher) were coated with poly-D-lysine (0.1 mg/ml, molecular weight 70,000150,000 Da, Sigma), rinsed with distilled water and air-dried. For some experiments with animals that had not received prior optic nerve injury, the plates were additionally coated with 20 mg/ml laminin (Sigma) as indicated. For some experiments, plates were coated with CNS myelin extract as described previously (Ahmed et al., 2006; Sengottuvel et al., 2011). Retinas were rapidly dissected from the eyecups and incubated at 37 C for 30 min in a digestion solution containing papain (16.4 U/ml for rat and 10 U/ml for mouse retinae, respectively; Worthington) and L-cysteine (0.3 mg/ml for rat and 0.2 mg/ml for mouse retinae, respectively; Sigma) in Dulbecco’s Modified Eagle medium (DMEM) (ThermoFisher). Retinae were triturated and washed by centrifugation in 50 mL DMEM (7 min at 900 g for rat retinae and 7 min at 500 g for mouse retinae). Retinal pellets were re-suspended in DMEM (6.5 ml/rat retina, 1.5 ml/mouse retina) containing B27-supplement (1:50, ThermoFisher) and 200 U/ml penicillin/streptomycin (Biochrom). Dissociated cells were passed through a cell strainer (40 mm, Falcon) and 300 mL cell suspension was added per well of tissue culture plates. Cultures were treated with 10 nM CNTF (Peprotech), 10 mM Y27632 (Sigma), 0.1 mM LatA (Cayman) 10 nM rapamycin e4 Cell Reports 26, 1021–1032.e1–e6, January 22, 2019

(LC-Laboratories), 20 mM LY 294002 (Sigma), 20 mM AG490 (Calbiochem), or 10 nM BPV(pic) (Sigma). Baculoviruses (105 pfu/well) were applied 4 h after culture preparation and two-thirds of the culture medium was replaced with fresh RGC medium 16 h thereafter (Levin et al., 2016, 2017)). Retinal cells were cultured for either 24 h (rats and mice pretreated with ONC + lens injury), for up to 72 h (rats without ONC) or up to 96 h (mice without optic nerve injury). Experimental conditions were pseudo-randomly arranged on the plates, so that the investigator would not be aware of their identity. Cells were fixed in 4% PFA/PBS for 25 min and permeabilized in 100% methanol (Sigma) for 10 min. RGCs were specifically stained with an antibody against bIII-tubulin (1:2,000; clone TUJ1; MMS435P; Biolegend, RRID: AB_2313773). A polyclonal antibody (1:800; C9001-23; United States Biological) was used to identify MLP expressing RGCs. MLP intensity in soma and growth cones of RGCs was quantified using ImageJ software. To visualize virally transduced RGCs, the cultures were stained with antibodies against eGFP (1:2,000; A6455; ThermoFisher), hr-GFP (Vitality rabbit antihrGFP; Agilent technologies, 1:1,000) or HA-tag (1:500; H6908; Sigma). Transduced and non-transduced RGCs with regenerated neurites were photographed under a fluorescent microscope ( 3 200, Observer.D1, Zeiss) and neurite length was determined using ImageJ software. For transduced and non-transduced RGCs, average neurite length per well was calculated by dividing the sum of neurite length by the respective total number of RGCs per well and normalized to non-transduced or control-virus treated cells as indicated. For the analysis of growth cones, RGCs were plated on glass coverslips (VWR) covered with poly-D-lysine (0.1 mg/ml, molecular weight between 70,000 and 150,000 Da, Sigma) and 20 mg/ml laminin (Sigma). Cells were incubated for 72 h, fixed with 4% PFA/PBS for 25 min and permeabilized by 0.1% Triton X-100 (Sigma) for 15 min. RGCs were stained for F-actin with Phalloidin-TRITC (200 ng/ml in PBS, Sigma) to visualize the complete growth cone area and co-stained with antibodies against bIII-tubulin (1:2,000; clone TUJ1; MMS-435P; Biolegend, RRID: AB_2313773) and hr-GFP (1:1,000; Vitality rabbit anti-hr-GFP; Agilent technologies, RRID:AB_10644103). Growth cones of RGCs were photographed under a fluorescent microscope ( 3 1,000, Observer.D1, Zeiss) and the size of the growth cone was determined using ImageJ software. For quantification of GAP43 immunofluorescence in RGCs, cells were cultured as described above. Cells were fixed and immunostained against bIII-tubulin (1:1,000; BioLegend, RRID:AB_2313773) and GAP43 (1:500; custom-made) after 2 h or 3 d in culture. Staining intensity of GAP43 in bIII-tubulin–positive RGCs was analyzed by using ImageJ software and calculated according to the following formula: Corrected total cell fluorescence = integrated density  (area of selected cell 3 mean fluorescence of background reading). DRG cultures DRG neurons were isolated from mice and transduced as described previously (Gobrecht et al., 2014, 2016; Levin et al., 2016). In brief, adult mouse DRG were incubated in Dulbecco’s modified Eagle medium (DMEM) supplemented with 0.25% trypsin/EDTA (ThermoFisher) and 0.3% collagenase type IA (Sigma) and mechanically dissociated. Subsequently, DRG cells were resuspended in DMEM supplemented with 10% fetal bovine serum (FBS, GE Healthcare) and 500 U/ml penicillin/streptomycin (Merck) and 200–300 DRG neurons per well were cultured in 96-well plates coated with 0.1 mg/ml poly-D-lysine (70,000-150,000 Da, Sigma) and 20 mg/ml laminin (Sigma). The cells were then cultured at 37  C and 5% CO2. Baculoviruses (3 ml in PBS,
3 3 105 pfu) were added to the medium 2 h after seeding and 16 h later, the virus containing medium was replaced by fresh medium. The cultured cells were then fixed after 2 days in 4% PFA for 25 min and permeabilized in 100% methanol for 10 min. DRG neurons were identified with an antibody against bIII-tubulin (1:2,000; BioLegend, RRID: AB_2313773). Transduced DRG neurons were identified either by their GFP signal or with an antibody against MLP and imaged with a fluorescent microscope (Observer.D1, Zeiss). Average axon length per neuron and neuron counts per experimental group were determined and normalized to control groups. COS-7 cell assay COS-7 cells were plated on glass coverslips (VWR) coated with poly-D-lysine (0.1 mg/ml, molecular weight 70,000-150,000 Da, Sigma). Cells were either transfected using Lipofectamine 2,000 (ThermoFischer) or transduced with baculoviruses. Forty-eight hours thereafter, cells were fixed with 4% PFA/ PBS for 25 min, permeabilized by 0.1% Triton X-100/PBS (Sigma) for 15 min and filopodia were visualized by F-actin staining using Phalloidin-TRITC (200 ng/ml in PBS, Sigma). Pictures were taken under a fluorescent microscope (1000x, Axio Observer.D1, Zeiss) and the length of filopodia was quantified using ImageJ software. Optic nerve tissue clearing Rats were subjected to ONC + lens injury and received an intravitreal injection of 1 ml of Alexa Fluor 555-conjugated cholera toxin b subunit (0.5% CTB, in PBS, Invitrogen) 2 d before tissue isolation. Optic nerves were isolated 14 days after surgery and postfixed overnight at 4 C before further processing. Wholemount staining and tissue clearing were performed as described previously (Renier et al., 2014). In brief, optic nerves were dehydrated in ascending methanol concentrations, bleached with H2O2 and then rehydrated in descending methanol concentrations. Specimens were then permeabilized for one day at 37 C, blocked at 37 C for 1 d and incubated with a primary antibody agains MLP (1:200, United States Biological, RRID: AB_2087783) at 37 C for 2 d and with secondary antibody for another 2 d at 37 C (1:500 Alexa Fluor 488-conjugated donkey anti-goat, ThermoFisher, USA). Afterward, optic nerves were dehydrated in ascending concentrations of tetrahydrofuran, incubated in dichlormethane and subsequently transferred to a clearing solution (benzylalcohol: benzylbenzoate (1:2)). To visualize the trajectory of individual axons we imaged cleared optic nerves with a total thickness of 410 mm in 540 optical sections of 1.038 mm generating an overlap in optical sections Cell Reports 26, 1021–1032.e1–e6, January 22, 2019 e5

of 32%. The trajectories of single CTB-positive axons reaching at least 150 mm beyond the lesion site were tracked and their respective axon tips evaluated for MLP co-staining. The percentage of regenerating CTB-positive axons with MLP-positive axon tips was quantified and presented as means ± SEM for two optic nerves. QUANTIFICATION AND STATISTICAL ANALYSIS Statistics Significances of intergroup differences were evaluated using Student’s t test or analysis of variance (ANOVA) followed by Holm-Sidak or Tukey post hoc test using the Sigma STAT 3.1 software (Systat Software). Statistical significance of intergroup differences was defined as following: *p < 0.05; **p < 0.01; ***p < 0.001. Statistical details for individual experiments are presented in the corresponding figure legend. Quantification of regenerating axons in the optic nerve €ller et al., 2007). In brief, pictures of 6 lonAxon regeneration was quantified as described previously (Leibinger et al., 2009, 2017; Mu gitudinal sections per animal were taken under 200 3 magnification using a fluorescent microscope (Axio Observer.D1, Zeiss). Numbers of GAP43-positive axons extending 0.5, 0.75, 1.0, 1.25 and 1.5 mm beyond the injury site (rat optic nerves) or CTB-labeled axons extending 0.5, 1.0, 1.5 and 2 mm beyond the injury site (mouse optic nerves) were quantified and normalized to the width of the optic nerve at the respective measuring point. Quantification of RGCs in retinal whole-mounts Immunostained flat-mounted retinae were virtually divided into four quadrants and 4-5 discontinuous pictures were taken in each quadrant using a fluorescent microscope (400x, Axio Observer.D1, Zeiss), proceeding from the center to the periphery. The number of bIII-tubulin-positive RGCs was determined and normalized to an area of 1 mm2.

e6 Cell Reports 26, 1021–1032.e1–e6, January 22, 2019