Mutant PTR1 Proteins from Leishmania tarentolae: Comparative Kinetic Properties and Active-Site Labeling

Archives of Biochemistry and Biophysics Vol. 368, No. 1, August 1, pp. 161–171, 1999 Article ID abbi.1999.1290, available online at http://www.idealibrary.com on

Mutant PTR1 Proteins from Leishmania tarentolae: Comparative Kinetic Properties and Active-Site Labeling 1,2 Chi-Feng Chang, Tom Bray, and John M. Whiteley 3 The Scripps Research Institute, La Jolla, California 92037

Received March 18, 1999, and in revised form May 5, 1999

PTR1, the gene promoting MTX resistance following gene amplification or DNA transfection in Leishmania tarentolae and selected mutants, has been cloned and heavily overexpressed (>100 mg/liter) in Escherichia coli strain BL21 (DE3). Protein has been purified, essentially to homogeneity, in two steps, via ammonium sulfate precipitation and chromatography on DEAE– Trisacryl. The active proteins are tetramers and display optimal pteridine reductase activity at pH 6.0 using biopterin as substrate and NADPH as the reduced dinucleotide cofactor. 2,4-Diaminopteridine substrate analogues are strong competitive inhibitors (K i ' 38 3 3 nM) against the pterin substrate and both NADP 1 and folate are inhibitors although somewhat weaker. Dihydropteridines are poor substrates compared to the fully oxidized pteridine. Kinetic analysis affords the usual Michaelis constants and in addition shows that inhibition by NADP 1 allows the formation of ternary nonproductive complexes with folate. The kinetic results are consistent with a sequential ordered bi– bi kinetic mechanism in which first NADPH and then pteridine bind to the free enzyme. Sequence comparisons suggest that PTR1 belongs to the shortchain dehydrogenase/reductase (SDR) family containing an amino-terminal glycine-rich dinucleotide binding site plus a catalytic Y(Xaa) 3K motif. In accord with this observation, the mutants K16A, Y37D, and R39A and the double mutants K17A:R39A and Y37D:R39A all show a two- to threefold lower binding affinity for NADPH and exhibit low or zero activity. Two Y(Xaa) 3K regions are present in wild-type PTR1 at 152 and 194. 1 This investigation was supported in part by Grants GM 52699 and CA 11778 from the National Institutes of Health and the Sam and Rose Stein Charitable Trust. 2 This is Publication 10458-MEM from the Department of Molecular and Experimental Medicine at Scripps Research Institute. 3 To whom correspondence should be addressed at Department of Molecular and Experimental Medicine, NX-2, The Scripps Research Institute, 10550 North Torrey Pines Rd., La Jolla, CA 92037. Fax: (619) 784-7981. E-mail: [email protected].

0003-9861/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.

Only Y194F gives protein with zero activity. This observation coupled with affinity labeling of PTR1 by oNADP 1 (2*,3*-dialdehyde derivative of NADP 1 ) followed by NaBH 4 reduction, V8 protease digestion, and mass spectral analysis suggests that the motif participating in catalysis is that at 194. The mutation K198Q eliminates inactivation by oNADP 1 supporting the hypothesis that K198 is associated with nucleotide orientation, as has been demonstrated for similar lysine residues in other members of the SDR family. © 1999 Academic Press

Key Words: pteridine reductase (PTR1); Leishmania; short-chain dehydrogenase/reductase (SDR); quinonoid dihydropteridine reductase (DHPR).

Methotrexate (MTX), 4 an antifolate, has been used widely in chemotherapy and several analogues have also proven useful as anti-infectives (1, 2). In addition, some parasitic infections such as malaria and toxoplasmosis have proven susceptible to antifolates (3, 4); however, MTX has not been effective in the treatment of the tropical diseases known collectively as leishmaniasis. The trypanosomatid Leishmania, a principle cause of this disease, responds in a peculiar way to MTX exposure, which could relate to its somewhat unusual pteridine or folate metabolism (5, 6). Leishmania contains a bifunctional dihydrofolate reductase–thymidylate synthase (DHFR–TS) enzyme complex, displays a requirement for exogenous pterins, can carry out de novo synthesis of folates, 4

Abbreviations used: MTX, methotrexate; SDR, short-chain dehydrogenase/reductase; PTR1, pteridine reductase 1 (identified as the gene within the Leishmania 11 region for mediating MTX resistance following overexpression by gene amplification or DNA transfection); DHFR, dihydrofolate reductase; DHPR, dihydropteridine reductase; IPTG, isopropyl-1-thio-b-D-galactopyranoside; DAP, 2,4-diamino-6hydroxymethylpteridine; BH 2, 7,8-dihydrobiopterin; oNADP 1, 29,39dialdehyde derivatives of NADP 1; DAB, 2,4-diaminobiopterin. 161

162

CHANG, BRAY, AND WHITELEY

and can even use low levels of MTX as a growth factor (7–9). The usual cellular resistance mechanisms occur after exposure to MTX (10 –13). These include amplification of the DHFR–TS gene, decrease in cellular uptake of the antifolate, presumably by transport defects, and in addition amplification of expression of proteins coded for by the genetic H region. This leads to increased levels of the pteridine reducing enzyme, PTR1, initially identified as HMTXR or LTDH (11, 14, 15). Biological studies have shown that cells overproducing PTR1 are insensitive to MTX, contrasting with the PTR1 2 null mutant, which is hypersensitive to this agent (12). These combined observations suggested that an alternate pathway for folate biosynthesis was present in the Leishmania cell lines (11) and this was recently confirmed (16, 17). PTR1 exhibits NADPH-dependent reductase activities with biopterin and folate and lesser activities with their dihydro derivatives. Similar observations have been reported by Luba et al. for the protein derived from L. major and its reactions using primarily the folate substrate (17). These properties suggest that the role of PTR1 is to scavenge or salvage pterins and thus contribute to antifolate resistance. Sequence analysis of the gene coding for the PTR1 protein shows interesting correlations to the extensive family of shortchain dehydrogenase/reductase (SDR) enzymes. The family includes enzymes which catalyze the NAD(P) 1dependent oxidation/reduction of a variety of alcohols, steroids, and prostaglandins (18 –20) and also dihydropteridine reductase (DHPR), a further pterin reducing enzyme (21). All the enzymes contain a characteristic N-terminal dinucleotide binding region (22) and the Y(Xaa) 3K motif that appears essential for efficient active-site function (23, 24). PTR1 exhibits no ability to reduce quinonoid dihydropteridines as does DHPR and prefers oxidized pterins as substrates. This observation, coupled with its inhibition by MTX in a similar manner to DHFR, its requirement for the Y(Xaa) 3K motif for activity, and the desire for effective inhibitors of PTR1 to provide potential novel therapeutic agents to control leishmaniasis, provided impetus for this investigation directed toward more specific characterization of PTR1 from Leishmania tarentolae. In this report the heavy overexpression of the wildtype enzyme and eight selected mutants in Escherichia coli is described. Each is purified to homogeneity and kinetic properties are identified. The mutant properties suggest cofactor and substrate binding regions by exhibiting significant changes in measured dissociation constants and enzymatic activity. The probable Y(Xaa) 3K motif is identified by both mutation experiments and affinity labeling with oNADP 1 (25, 26).

EXPERIMENTAL PROCEDURES Oligonucleotide primer syntheses were carried out with an automated Applied Biosystems synthesizer at this institute. PCR kits (Repli-pack) and pET systems [including pET16b, pET 20b, and the BL21(DE3) strain of E. coli] were purchased from Boehringer-Mannheim Corp. and Novagen, respectively. All restriction enzymes were obtained from New England Biolabs. The following reagents were obtained from the indicated commercial sources: isopropyl-1-thio-bD-galactopyranoside (IPTG) (Diagnostic Chemicals Ltd.); Sephacryl S-100 (Pharmacia); DEAE–Trisacryl (Sepracor); ammonium sulfate, NADPH, NADP 1, oNADP 1, and 2,4-diamino-6-hydroxymethylpteridine (Sigma); and biopterin, 7,8-dihydrobiopterin, and 2,4-diaminobiopterin (Schircks Laboratories, Jona, Switzerland). Cloning and mutation of PTR1. The L. tarentolae PTR1 gene was amplified from a recombinant plasmid (14) by PCR using primers 59-ATTGGGTCTCTCATGACGACTTCTCCGACTGCGCCCGTG-39 and 59-GTTAGGGTCTCCGATCAGGCCGTAAGGCTGTAGCC-39. The amplified 0.9-kb product was digested with BsaI and then ligated into the pET16b vector, which was digested with NcoI and BamHI. Standard ligations were performed and the constructed plasmid (ptr1/pET16b) was transformed into E. coli BL21 (DE3)competent cells. The positive clones were selected against ampicillin and DNA sequence verification was achieved by dideoxy DNA sequencing methods using the Sequenase kit from U.S. Biochemical Corp. For mutant production the ptr1/pET16b gene was digested with HindIII and BglII and ligated into the pET20b vector, which was used as the template for site-directed mutagenesis experiments carried out in the manner described by Kunkel (27, 28). The following primers were used to construct mutant sequences: K16A, GCTACCAAGTCGAGCCGCGGCGCCGGTTAC; R39A, GTCTGCTGCAGAAGCGTGATAGTGCAAGCA; Y37D, R39A, GTCTGCTGCAGAAGCGT GGTCGTGCAAGCA; Y152F, AATCAAGAAGAAGGGCGCAAT; Y194F, CTCTTTGGCCAT GGTGAACATGGTGTATCC; Y194H, GGCCATGGTGTGCATGGTGTATCC; and K198Q, CAACGCCTCCTGGGCCATGGT. The double-mutant K16A:R39A contained the appropriate triplets used in the single-mutant examples. The numbering of the protein excludes the initial methionine, and mutant triplets are indicated by underlining. Expression and purification. The overexpression of PTR1 and its mutants was confirmed by growing the cells in LB medium containing ampicillin (100 mg/ml) at 37°C. Upon reaching an OD 600 of 0.4 to 0.6 the cultures were induced by adding IPTG to a final concentration of 2 mM. The cells were grown continuously for 3–7 h prior to harvesting. The total protein expression was determined by SDS– PAGE and Coomassie blue staining. After protein expression was optimized, cells were grown and induced on the 4-liter scale. Cells were pelleted by centrifugation (10,000g 3 10 min, 4°C). Protein purification followed a previously published procedure (11) in which the cells were resuspended in 50 mM Tris–Cl 2 buffer, pH 6.8, containing 1 mM phenylmethylsulfonyl fluoride and then were lysed by sonication. After centrifugation (15,000g 3 30 min) and decantation of the supernatant, protein was precipitated with 32% (v/v) ammonium sulfate. The precipitate was collected by further centrifugation (15,000g 3 30 min), resuspended in 15 ml of 20 mM Tris–Cl 2, pH 6.8, and then dialyzed repeatedly against the same buffer solution. After dialysis, the protein solution was loaded directly onto a DEAE– Trisacryl column (3 3 10 cm) preequilibrated with Tris buffer solution. After eluting with a further 1 liter of 20 mM Tris–Cl 2, pH 6.8, PTR1 wild-type or mutant proteins were obtained by the addition of a gradient of 0 – 0.3 M NaCl in the same buffer solution. Protein characterization. M rs for the wild-type active protein and selected mutants were determined by nondenaturing PAGE as described by Hedrick and Smith (29) and Chrambach and Rodbard (30) employing a-lactalbumin (14 kDa), carbonic anhydrase (29 kDa), chicken egg albumin (45 kDa), and bovine serum albumin (66 and

MUTANT PTR1 PROTEINS: PURIFICATION AND COMPARATIVE PROPERTIES 132 kDa) (Sigma) as molecular weight standards. The purified PTR1 and standards were electrophoresed on a series of gels of varying polyacrylamide concentration (from 5 to 9%) and the electrophoretic mobilities (R f ) of the proteins in each gel were determined. Log R f 3 100 was plotted against the percentage gel concentration for each protein and the slope afforded the retardation coefficient (K R ). Log K R was plotted against M r to produce a linear plot from which the molecular weights were determined. Chromatographic fractions were checked for homogeneity by SDS–PAGE according to the method of Laemmli (31) using 10% (w/v) gels at pH 8.8. Gels were stained overnight in 0.3% Coomassie brilliant blue R contained in aqueous 10% methanol/10% acetic acid and then were destained in the same solution without dye. To determine the monomer M r the above standards were again used. The protein isoelectric point was determined to be 5.1 with the Pharmacia Phast Gel system (IEF 5– 8) on 5 3 5-cm 5% gels containing pharmalyte carrier ampholytes. pI standards were glucose oxidase (4.2), b-lactoglobulin B (5.1), bovine carbonic anhydrase (6.0), and equine myoglobin (6.8 and 7.2). Protein concentration was determined using the monomeric extinction coefficient e 278 5 28 3 10 3 M 21 cm 21 derived from amino acid analysis. This figure was confirmed by absorbance measurements of a solution with known protein concentration. Protein concentrations of highly purified samples of PTR1 were determined by Bradford and BCA assays (32, 33) and e 278 was determined using a monomer molecular weight of 30,436 derived by matrix-assisted laser desorption ionization–time-of-flight techniques. It was assumed that subunit interactions were minimal and that e 278 for the tetramer was four times that of the monomer. Spectrophotometric assay. Enzyme samples were assayed spectrophotometrically (Cary 219 spectrophotometer) by observing the absorbance change at 340 nm that accompanied the NADPH-dependent reduction of the pteridine substrate. Millimolar extinction coefficients of 6.22 for dinucleotide oxidation (34) and 0.17 for the biopterin to dihydrobiopterin conversion (35) were used in the assay at pH 6. Values of 0.03 and 5.64 were used for the conversion of folate to dihydrofolate and of dihydrobiopterin to tetrahydrobiopterin, respectively. For assays conducted at pH values other than at the 6.0 optimum, corrections to the observed absorbance changes were made if required. One unit of enzyme activity is that amount which will catalyze the oxidation of 1 mmol of NADPH/min at 25°C. Specific activity is expressed in units per milligram of protein. Specific activity measurements of purified mutant enzymes were taken initially using 160 mM NADPH and 200 mM biopterin. For those mutants showing diminished activity relative to the wild-type protein, assays were repeated using the highest spectrophotometrically readable substrate concentrations. At 160 mM NADPH and 200 mM biopterin the initial absorbance is approximately 1.3 AUFS. To permit data collection at higher substrate and cofactor concentrations, further assays were carried out in short pathlength cuvettes (0.1 cm); however, gains in usable reactant concentrations were partially offset by increases in baseline noise. For mutant enzymes specific activity measurements were taken using 400 mM biopterin and 300 mm NADPH, giving initial absorbance values of 0.4 AUFS (with the short pathlength cuvettes). At these levels, the background noise levels introduce an uncertainty of at least 33% in the activity calculation. To counter this, assays were repeated three times and the activities averaged. Substrate specificity and pH optimum. Unless stated otherwise, all assays contained 160 mM reduced dinucleotide and 200 mM pteridine and the reaction was initiated by addition of enzyme at 25°C. Substrate specificity was determined by comparing biopterin, folate, 7,8-dihydrobiopterin, NADPH, and NADH. The optimal pH of 6.0 was derived from experiments conducted in constant ionic strength buffers (50 mM Mes, 25 mM Tris, 25 mM ethanolamine, and 100 mM NaCl) in the pH range 4 –10 according to published procedures (36). The pH was adjusted with HCl or NaOH.

163

Fluorescence titration. Protein fluorescence was measured in quartz cuvettes (3 ml, 1-cm light path) at 10°C with a Perkin–Elmer 650-40 spectrophotometer equipped with a 150-W xenon lamp. Excitation and emission slit widths were set at 5 and 10 nm, respectively. The excitation wavelength was 280 nm and the emission wavelength was 340 nm. Titrations were carried out by serial addition of concentrated ligand solution to the cuvette containing PTR1 in 100 mM Bis–Tris buffer, pH 6.0. Titration of a standard glycyltryptophan solution under identical conditions was used to correct for inner filter effects. Dissociation constants (K d) were derived from the observed decrease in protein fluorescence according to the relationship outlined by Stinson and Holbrook (Eq. [1]), L t / f 5 K d~1 2 f ! 21 1 pE t,

[1]

where L t and E t are the total concentrations of ligand and enzyme, respectively, p is the number of independent and equivalent binding sites on E, and f is the ratio of the observed fluorescence change to the maximum fluorescence change ( f 5 DF/DF max) (37). Graphical analysis according to the procedure outlined by Ward (38) affords the dissociation constant from a plot of 1/(1 2 f) against (L t / f ). Kinetic measurements. Kinetic constants were obtained from duplicate or triplicate measurements of initial rates as a function of varied pterin and NADPH concentrations. A blank was included for each assay to eliminate effects from the spontaneous nonenzymatic reduction of cofactor. Reactions were carried out in 0.1 M Bis–Tris buffer, pH 6.0, at 25°C. Inhibition studies were carried out using concentrations of inhibitors that would give up to 80% inhibition for a fixed substrate concentration. Inhibitors included NADP 1, folate, and 2,4-diamino-6-hydroxymethylpteridine (DAP). For tight binding inhibition, such as that observed with MTX and 2,4-diaminobiopterin (DAB), both enzyme and inhibitor concentrations were varied and results were analyzed according to procedures reported by Blanchard and Cleland (39), Williams and Morrison (40), and Grimshaw et al. (41). A double-inhibition experiment was also conducted by varying both NADP 1 and folate at a fixed concentration of biopterin and NADPH according to published procedures (42). Kinetic data processing. Reciprocal initial velocities were plotted versus reciprocal substrate concentrations, and the experimental data were fitted to Eqs. [2]–[6] by the least-squares method, assuming equal variance (constant absolute error) for the v values (43) using the Fortran programs of Cleland (44). The points in the figures are the experimentally determined values, while the curves are calculated from fitting data to the appropriate equation: v 5 VA/~K a 1 A!

[2]

v 5 VA/~K a 1 A 1 A 2/K i !

[3]

v 5 VAB/(AB 1 K aB 1 K b A 1 K iaK b)

[4]

v 5 VA/[K a~1 1 I/K is! 1 A]

[5]

v 5 VA/@K a 1 A~1 1 I/K ii!#

[6]

V 5 VA/[K a(1 1 I/K is) 1 A(1 1 I/K ii)]

[7]

V 5 V/@1 1 I/K i 1 J/K j 1 ~IJ/bK iK j!#

[8]

v 5 ~V/ 2!@ pE t 2 I t 2 K i 1 @~ pE t 2 I t 1 K i ! 2 1 4K iI t # 1/2#.

[9]

Linear double-reciprocal plots were fitted to Eq. [2]. Equation [3] was used when substrate inhibition was observed. Equation [4] describes

164

CHANG, BRAY, AND WHITELEY

an intersecting initial velocity pattern, where K a and K b are the Michaelis constants for substrates A and B, respectively; K ia is the apparent dissociation constant for A; and V is the maximum velocity. Data conforming to linear competitive, uncompetitive, and noncompetitive inhibition were fitted to Eqs. [5], [6], and [7], respectively, where K is and K ii are the apparent slope and intercept inhibition constants, respectively. Experimental results for the double inhibition were fitted to Eq. [8], where K i and K j are the apparent inhibition constants for inhibitors I and J, respectively, and b is the factor which describes the interaction between the two inhibitors (45). Data conforming to tight-binding inhibition were fitted to Eq. [9], where p is the number of active sites, E t is the concentration of enzyme, I t is the inhibitor concentration, and K i is the apparent inhibition constant (39). The nomenclature used is that of Cleland (46). Interaction of wild-type and mutant PTR1 proteins with oNADP 1. Enzyme aliquots (0.32 mg/ml) were incubated with various concentrations of oNADP 1 (0 3 '0.8 mM) at 25°C in a 50-ml total volume of 50 mM potassium phosphate buffer, pH 7.5. Two-milliliter aliquots were withdrawn and assayed at 5- to 10-min intervals to determine the rate of inactivation. Control experiments were carried out containing all reagents except the dialdehyde to correct for minor changes in enzyme activity, and experiments were carried out using NADP 1 as a control for enzyme inactivation. To assess the stoichiometry of the reaction, the enzyme was incubated in 50 ml of 50 mM phosphate buffer, pH 7.5, at 21°C in the presence or absence of 1 mM oNADP 1 for 2 h. The excess oNADP 1 was removed by centrifugation (1100g 3 4 min) using a Bio-Spin desalting column. The UV spectrum of the resulting enzyme solution was taken and the ratio of A 260 /A 278 was used to calculate the stoichiometry of bound oNADP 1. Parallel experiments without enzyme or oNADP 1 were also performed. Reduction and proteolytic analysis of derivatized PTR1 samples. Inactivated PTR1 (30 mg in 20 ml) was chilled on ice and reduced with three aliquots of 200 mM NaBH 4 in 0.02 N NaOH followed by a 5-min incubation after each addition. Final borohydride concentration was 25 mM. The reaction mixture was further incubated for 1 h and then diluted to a volume of 50 ml with H 2O. The borohydridereduced enzyme was subsequently purified by using a Bio-Spin column (1100g 3 4 min) and the UV spectrum was taken. The reduced enzyme complex was then incubated with 0.5 mg of Staphyloccocal aureus V8 protease in 50 mM phosphate buffer, pH 7.5, for 4 h at 25°C. One-third of the cleaved peptide was analyzed by a Tris–tricine gel and two-thirds of the cleaved protein was subjected to spectral analysis.

RESULTS

E. coli expression and purification of PTR1. To provide ample supplies of wild-type and mutant PTR1 samples, the various PTR1 genes were subcloned into a pET16b vector. Expression of the complementary proteins after IPTG induction followed by SDS gel analysis showed that the PTR1 samples were the major soluble protein components present in the cell supernatants (.50%). Large-scale purification by ammonium sulfate precipitation and DEAE–Trisacryl chromatography showed that protein contained in the middle fractions of the major eluted peak was essentially homogeneous (.99%) according to SDS gels and Coomassie blue staining. Usually, the central peak fractions yielded 15–20 mg of pure protein per liter of culture. Protein of this purity was used in all kinetic and inhibitory studies. Molecular weight measurements of wild-type and mutant PTR1 samples by

Sephacryl S-100 filtration chromatography indicated a M r greater than 90 kDa, which suggested that at least a trimer was the natural form. Further examination using 5–9% nondenaturing gel electrophoresis showed the proteins to be tetramers with molecular weights of '120 kDa. Similar results have been reported earlier for PTR1 pMALc-2 fusion vector expression in E. coli (6). An experimental pI value of 5.1 was obtained for wild-type PTR1, which was consistent with the observation that this protein could be eluted at low salt concentrations ('0.12 M NaCl) from DEAE–Trisacryl resin. pH profile and substrate specificity. Compared with NADPH, NADH was a poor substrate for wild-type PTR1 with essentially no measurable activity; therefore, NADPH was used as the dinucleotide for all subsequent assays. For biopterin the enzymatic activity increased when the pH of the assay buffer was decreased. Moreover, it was observed that the protein was stable for more than 3 h when incubated at 4°C in buffer solutions from pH 3 to 12. Therefore, the lower activity observed at higher pH values could not be caused by enzyme denaturation, but more probably by the occurrence of less favorable conformational forms of the protein or possibly by altered ionic forms of the substrates. Since auto-oxidation of NADPH increased significantly when the assay pH dropped below 5.5, pH 6 was chosen as optimal for measuring enzymatic activity. For folic acid and dihydrobiopterin, the activity was low and did not vary much over a pH range of 8 –5.5. The specific activity for folic acid at pH 6.0 (0.45 units/mg) was comparable to that of to 7,8-dihydrobiopterin (0.33 units/mg), but 8 –10 times lower than that of biopterin (3.2 units/mg). Changes in ionic strength also affected enzyme activity; for example, increasing the salt concentration from 0.1 to 0.5 M NaCl caused biopterin activity to fall from 3.0 to 0.5 units/mg. Determination of kinetic parameters. Double-reciprocal plots for reduced dinucleotide and biopterin showed an intersecting pattern (Fig. 1). This observation coupled with product inhibition exhibited by NADP 1 (see below) indicated that the reaction for PTR1 followed a sequential bi– bi mechanism. The data were fitted to Eq. [3] and the results are shown in Table I. The K m values for NADPH and biopterin are 19 and 3.5 mM, respectively, and the k cat for biopterin is 2.3 s 21. For the low specific activity substrates, such as dihydrobiopterin and folate, the initial velocities were measured at 200 mM NADPH with varied pterin concentrations and the data were fitted into Eqs. [1] and [2], respectively (Table I). The results show that dihydrobiopterin has a similar K m value (3.3 mM) with low catalytic activity (k cat ; 0.25 s 21). Folate showed a similar k cat value of ;0.22 s 21 but a higher value of K m ('12 mM).

165

MUTANT PTR1 PROTEINS: PURIFICATION AND COMPARATIVE PROPERTIES

FIG. 1. Double-reciprocal plot for the reduction of biopterin by NADPH at pH 6 and 25°C. Biopterin concentrations were 24 (l), 48 (3), 72 (E), 96 (F), 120 (1), and 144 (L) mM, respectively.

Using optimal conditions, with biopterin and NADPH as substrates, inhibition constants were determined for NADP 1; the 2,4-diaminopteridine analogues such as MTX, DAB, and DAP; and the substrate inhibitor folate. Differing types of inhibition were observed and an example of DAP inhibition is shown in Fig. 2. The K i values derived for inhibition versus pterin from the theoretical fitting of the data into the standard equations are shown in Table II. NADP 1 shows competitive inhibition against NADPH but is mixed versus pterin whereas DAP is uncompetitive against NADPH and competitive against biopterin. The possibility that the uncompetitive nature of this interaction might reflect high NADPH concentrations is unlikely as the inclusion of ,K m concentrations gave similar results; however, the error was enhanced. MTX and DAB had very similar inhibition characteristics, which required the use of tight-binding kinetic analytical methods to deduce the inhibition constant. A representative plot for MTX is shown in Fig. 3. The stoichiometries (expressed as moles of inhibitor per mole of enzyme active site) determined from fits to Eq. [9] were 1.10 6 0.02 for MTX and 0.9 6 0.2 for DAB. Furthermore, the apparent K i values were altered by changes in biopterin concentration suggesting that both biopterin and the inhibitors compete for the same site. Surprisingly folate was an uncompetitive inhibitor to both NADPH and biopterin. The Dixon plot derived from the doubleinhibition experiments with NADP 1 showed an intersecting pattern (Fig. 4) suggesting that each inhibitor had separate and distinct sites. Moreover, a b value (0.59 6 0.1) derived from Eq. [8] suggested that their inhibitory activity was complementary (47). Binding studies. The dissociation constants for dinucleotides and pterins with PTR1 were derived us-

ing fluorescence titration methods. Each ligand showed similar titration curves and an example for the NADPH titration is shown in Fig. 5. A value of 5.3 mM was obtained for NADPH (Table III). A value of 1 for the slope derived from the Hill plot (data not shown) suggested that there was only one binding site per monomer for each ligand. Dissociation constants of the binary complex of PTR1 with pteridine substrates or inhibitors were also measured. It is interesting to note that preincubation of enzyme with one equivalent of NADPH followed by titration with DAB or MTX leads to a seven- to eightfold lowering of the dissociation constant in both cases (data not shown). This suggests that a change in protein conformation occurs after NADP(H) binding, leading to a much stronger affinity for the inhibitors, which is consistent with their showing competitive inhibition characteristics only against the substrate biopterin. For example, folate showed a K d value of 13 mM when forming the binary complex, but this value decreased to 3 mM for the ternary complex [FA*PTR1*NADP 1] which is close to its measured K i value of 1.3 mM. The comparative affinities of the wild-type and mutant proteins illustrated in Table III for dinucleotide and pteridine substrates and dinucleotide products suggest that NADPH is the better substrate for wildtype PTR1. Mutations introduced into the suspected nucleotide binding region, e.g., K16A, R39A, K16A: R39A, and Y37D:R39A, clearly lessen the affinity of the protein for NADPH with an associated loss of enzymatic activity from the optimal 3.2 (100%) to a low of 0.42 (13%). It is interesting to note that NADH, which shows a much lower affinity for the wild-type enzyme, displays enhanced activity after mutation as their design was to more readily accommodate this dinucleotide, e.g., the elimination of arginine 39 and the introduction of an aspartic acid at position 37. Tyrosine to phenylalanine mutations introduced into the two Y(Xaa) 3K motif regions at Y152 and Y194 show clearly that changes in the latter region have a more serious effect on the reaction course. This is not really TABLE I

Kinetic Properties of L. tarentolae PTR1 a

Substrate NADPH Biopterin 7,8-Dihydrobiopterin Folic acid

K m (mM) 19 6 6 3.51 6 0.26 b 3.3 6 2.9 12 6 7

k cat (s 21) 2.3 6 0.2 2.3 6 0.2 0.25 6 0.08 0.22 6 0.10

k cat /K m (s 21 mM 21) 0.12 0.65 0.07 0.02

a All assays were carried out in 0.1 M Bis–Tris buffer, pH 6.0, at 25°C. b Standard deviation errors are calculated according to the Fortran programs of Cleland (44).

166

CHANG, BRAY, AND WHITELEY

tained using Eqs. [10] and [11] according to procedures outlined earlier by Mas and Colman (26). KI

FIG. 2. Double-reciprocal plots for the inhibition of PTR1 by DAP against (a) NADPH and (b) biopterin. DAP concentrations were 0 (‚), 0.14 (l), 0.28 (1), 0.42 (ƒ), 0.56 (F), 0.70 (3), and 0.84 (L) mM, respectively.

surprising as a recent report describing a similar protein isolated from Trypanosoma cruzi (48) shows that after sequence alignment the earlier motif (Y152) is not present yet the protein exhibits full pteridine reductase activity. The diminished activity of the Y194 mutants (0% residual activity) and that of K198Q (3%) implicate this center to be a participant in the reductive mechanism as with other SDR family members. No major changes in binding affinity for the pteridine substrates were noted with any of the mutants. Active-site labeling. Incubation of PTR1 at pH 7.5 with increasing aliquots of oNADP 1 in the absence of NADP 1 leads to progressive enzymatic inactivation that is shown in the inverse relationship of Fig. 6b. The reaction follows pseudo-first-order kinetics over a concentration range of 0 3 0.78 mM oNADP 1 and when the observed inactivation rate constant (k obs), calculated from the slopes of the linear inactivation curves over the range of oNADP 1 indicated, was plotted against the concentration of oNADP 1 a hyperbolic saturation curve was obtained leading to the doublereciprocal relationship shown in Fig. 6a. From this K I and k max values of 0.78 mM and 0.15 min 21 were ob-

k max

E1I| L ; @EI# O ¡ @EI*#

[10]

1/k obs 5 K I/(k max[I]) 1 1/k max

[11]

oNADP 1 inactivates PTR1 irreversibly after reaction has occurred and the absorbance spectrum of the derivatized enzyme is shown in Fig. 7. PTR1 alone has l max 278 nm (e 5 28 3 10 3 M 21 cm 21) and oNADP 1 has l max 5 260 nm (e 5 18 3 10 3 M 21 cm 21) (26). Assuming that the peak absorbances of the two components are minimally altered by their covalent binding, the stoichiometry of the interaction can be derived from the A 260 /A 280 ratio and his indicated that 0.96 mol of oNADP 1 was bound per monomer of PTR1. As might be expected, prior incubation of PTR1 with excess NADP 1 protected the enzyme from inactivation. Dialdehyde nucleotide derivatives, such as oNADP 1, favor interaction with protein amino groups (25) to afford a Schiff base, which can subsequently be reduced by sodium borohydride to yield primarily a stable secondary amine. In some instances significant quantities of a less stable morpholino derivative may also occur (25). To evaluate the stability of the PTR1– oNADP 1 complex, samples of the inactivated enzyme were reduced with sodium borohydride and excess reagents were removed with a Bio-Spin desalting column. The absorbance spectrum of the derived product (Fig. 7) showed the emergence of the typical reduced dinucleotide peak at 340 nm. Absorbance ratio calculations corroborated the previous approximately 1:1 interaction between oNADP 1 and the PTR1 monomer. Extensive dialysis of the modified reduced enzyme against 50 mM potassium phosphate buffer solution, TABLE II

Inhibition Constants for Inhibitors of PTR1 a

Inhibitor

K i (mM)

Type of inhibition versus biopterin substrate

NADP 1 Folate DAP MTX DAB

60 6 6 b 1.3 6 0.1 0.038 6 0.005 0.003 6 0.001 0.005 6 0.001

Mixed-competitive Uncompetitive Competitive Competitive (tight-binding) c Competitive (tight-binding)

a All assays were carried out in 0.1 M Bis–Tris buffer, pH 6.0, at 25°C, with biopterin and NADPH as substrates. b Standard deviation errors are calculated according to the Fortran programs of Cleland (44). c The p value (number of active sites) for MTX is 1.10 6 0.02 and for DAB is 0.9 6 0.2.

MUTANT PTR1 PROTEINS: PURIFICATION AND COMPARATIVE PROPERTIES

167

Similar experiments were attempted with the mutant PTR1 protein K198Q, which normally shows 3% of wild-type activity (Table III). No loss of activity was observed and no derivatization of the enzyme occurred. This suggested that K198 in the wild-type enzyme was essential for derivatization and essential for full enzymatic activity and probably by analogy with DHPR strongly influences nicotinamide orientation at the active site. DISCUSSION

FIG. 3. Tight-binding inhibition characteristics of PTR1 exhibited by MTX. Initial rates were measured at 25°C in 0.1 M Bis–Tris buffer, pH 6, containing 160 mM NADPH and 64 mM biopterin with various concentrations of MTX (mM): 0 (F), 0.53 (‚), 0.80 (3), and 1.6 (l). Experimental points are fitted to theoretical curves (cf. Experimental Procedures).

pH 7.5, showed some release of bound ligand from the enzyme, which suggests that partial formation of the morpholino derivative must have also occurred in this instance. Nevertheless, the major part remained protein bound allowing additional analytical experiments to be carried out. The reduced derivatized protein was subjected to limited proteolysis with S. aureus V8 protease at room temperature. This approach was selected because analysis of the protein sequence indicated that a limited number of discrete peptides would be generated and because trypsin digestion after urea denaturation might create a further loss of bound nucleotide leading to ambiguous results. The digested protein was then characterized by gel electrophoresis and mass spectral analysis. Bands observed in the gel of the digested derivatized proteins were transferred to PVDF membranes by standard techniques and were analyzed by mass spectrometry. Comparison of the results with those observed when a similar M r band was characterized from the nonderivatized enzyme showed the emergence of two new peaks with m/e 11258 and 16732. Unfortunately, the resolution of the SDS gels could not completely separate the two derivatized peptides. Comparison with the expected peptide cleavage product molecular weights and derivation of their amino acid sequences indicated two overlapping fragments to be present in the band which corresponded to peptides 106 –203 and 144 –289. The anticipated active-site motif Y194(Xaa) 3K198 is contained in each fragment suggesting by analogy with DHPR (23) that lysine 198 is the target site for oNADP 1.

The PTR1 protein from Leishmania is an interesting protein insofar as it possesses properties that suggest similarities to both DHFR and the SDR family of enzymes that includes quinonoid DHPR. All three enzymes catalyze the reduction of a pterin irreversibly. The similarity to DHFR relates to the preference for NADPH as a reduced dinucleotide cofactor and the inhibitory behavior exhibited by the 2,4-diaminopteridine analogues. However, there is no correlation in sequence between these two reductases, whereas a significant sequence correlation occurs between PTR1 and DHPR. DHPR and the SDR family contain a characteristic bab nucleotide binding fold close to the Nterminal and a catalytic motif Y(Xaa) 3K near the Cterminal. Two of the latter motifs are discernable in the PTR1 sequence; however, only mutations in the Y194(Xaa) 3K198 region lead to severe loss of activity. Thus, Y194F leads to a protein with essentially no activity and K198Q affords minimal activity (Table III). When comparing the substrate specificity for the three enzymes (PTR1, DHPR, and DHFR), PTR1 fa-

FIG. 4. Double-inhibition studies of NADP 1 and folate at concentrations of biopterin and NADPH equal to 200 and 44 mM, respectively. The results are expressed as a Dixon plot with 1/v versus [folate] at different fixed concentrations of NADP 1: 0 (F), 10.3 (3), 13.9 (L), 20.5 (l), and 41.0 (E) mM, respectively.

168

CHANG, BRAY, AND WHITELEY

FIG. 5. Fluorescence titration of PTR1 with NADPH. The enzyme concentration was 5.4 mM and the temperature was controlled at 10°C. Other conditions are described under Experimental Procedures.

vors the fully oxidized simple pterin (k cat/K m 5 0.65 s 21 mM 21 for biopterin) in contrast to the 7,8-dihydropteridines (k cat/K m 5 0.07 s 21 mM 21 for BH 2) which contrasts with the substrates favored by DHFR and DHPR. Moreover, in the latter case, a quinonoid form of the dihydropteridine is required for activity. In general, 7,8-dihydropteridines and quinonoid dihydropteridines are very labile and are much more easily reduced (or oxidized) than the unhydrogenated species. PTR1 favors NADPH as the reduced dinucleotide cofactor (K d 5 5.3 mM versus 31 mM for NADH) and biopterin is the favored substrate (k cat 5 2.3 s 21) over folate (k cat 5 0.22 s 21). The optimal rate of reaction occurs at pH 6.0. Kinetic analyses under optimal conditions suggest that the reaction follows a sequential bi– bi mechanism. Unlike DHPR and more akin to DHFR, diaminopteridines are clearly competitive inhibitors against

biopterin and uncompetitive versus NADPH. These results suggest that the inhibitory event occurs after dinucleotide binding and that substrate and inhibitor compete for the same site. Fluorescence studies support this concept as a seven- to eightfold decrease of K d for 2,4-diaminopteridine analogues was observed if PTR1 was preincubated with one equivalent of NADPH. Two features could contribute to the inhibition of PTR1 by the diaminopteridines. Most probably, as with DHFR, the inhibitor can bind at the substrate active site with a slightly altered configuration giving tight binding (49). Or, alternatively, the binding orientation could be similar to that of the substrate, but the catalytic activity could be eliminated because the diaminopteridine is not a receptor for hydride transfer. With DHPR, the 4-keto substituent of the quinonoid structure is a known participant in the enzymatic reaction; however, 2,4-diaminopteridines do not readily form such quinonoid structures, and thus it is unlikely that these molecules would inhibit by competition with a quinonoid form of substrate either structurally or mechanistically. Moreover, PTR1 does not exhibit quinonoid dihydropteridine reductase behavior. Thus, the inhibition observed by diaminopteridines with PTR1 is probably similar to that occurring with DHFR. As was recently also observed with the L. major protein (17), folate shows an inhibition pattern for PTR1, with a lower binding constant than biopterin and a rate of reaction an order of magnitude lower (Table I). Unexpectedly, folate inhibition demonstrates uncompetitive kinetics with both substrate and cofactor. This observation may be explained by assuming that folate binds after biopterin turnover. Doubleinhibition studies with NADP 1 and folate show unequivocally that the binding site for the two inhibitors is separate and that the two inhibitory activities are complementary. These results suggest that after the

TABLE III

Specific Activities and Dissociation Constants for PTR1 Mutants K d (binary complex, mM) a

Specific activity b

Sample

NADPH

NADP 1

NADH

(mM/min/mg)

% of wild-type activity

Wild-type K16A R39A K16A, R39A Y37D, R39A Y152F Y194F Y194H K198Q

5.3 12 9 10 36 10 16 21 26

81 — — — — — — — —

31 28 15 16 13 — 32 — —

3.2 1.46 1.13 0.86 0.42 2.93 0.0 0.85 0.11

100 46 35 27 13 92 0 27 3

a b

The K d values were measured in 100 mM Bis–Tris buffer solutions, pH 6.0, at 10°C. The specific activities were measured using the standard assay conditions; see Experimental Procedures.

MUTANT PTR1 PROTEINS: PURIFICATION AND COMPARATIVE PROPERTIES

FIG. 6. Saturation kinetics of the inactivation of PTR1 by oNADP 1. (a) Dependence of the inactivation rates on oNADP 1 concentration. The enzyme was incubated with oNADP 1 under conditions described under Experimental Procedures. The pseudo-first-order rate constants were calculated from the slopes of linear inactivation curves over the range of oNADP 1 indicated. A K I of 0.78 mM was obtained from the slope and k max of 0.15 min 21 from the intercept of the double-reciprocal plot (inset), according to Eq. [11]. (b) Inverse relationship of the enzyme of inactivation rate (v) versus a range of oNADP 1 concentrations (0 3 0.78 mM) measured as described under Experimental Procedures.

turnover reaction, BH 2 is first released from the reaction complex allowing formation of an [E*NADP 1*FA] inhibitory complex. This concept is further supported by fluorescence studies which show a lower binding constant for folate in forming the ternary complex [E*NADP 1*FA] (3 mM) compared to the binary complex [E*FA] (13 mM) (data not shown). It is interesting that the folate analog MTX gives rise to clear competition with biopterin. It is probable that the very strong inhibition by MTX (K i ; 3 nM) creates this situation. As indicated above, sequence comparison suggests that PTR1 belongs to the SDR family, a group of proteins whose prominent common feature is a Y(Xaa) 3K motif at the catalytic site and a typical dinucleotide binding site in the amino-terminal region. Mutations in this latter sector, e.g., K16A, R39A (Table III), lead

169

to considerable loss in enzymatic activity suggesting that the typical bab dinucleotide Rossman fold (22) is optimal for the wild-type enzyme and NADPH. Mutations directed toward altering the affinity from NADPH to NADH (50), e.g., R39A, Y37D:R39A, gave the expected enhanced affinity shown as lower K d values for NADH. Both reduced nucleotides showed a much stronger affinity than their pyridinium oxidation products. PTR1 showed two Y(Xaa) 3K motifs at Y152 and Y194; however, only mutation of the latter afforded inactive enzyme suggesting that this latter motif was in the vicinity of the active site. Isolation of a similar enzyme from T. cruzi (48) showed no early motif, when sequence comparison was made with PTR1. The presence of a comparable later motif emphasized that this was probably required for activity. Similar conclusions were recently derived by Leblanc et al. using protein digestion techniques (51). Since the e-amino group of lysine 150 in DHPR, a part of the motif in this enzyme, was found to form a strong H bond with the cofactor at the adenine ribose 29- and 39-hydroxy groups (52), it was considered possible that the 29,39-dialdehyde derivative of NADP 1 might form an imino bond with the somewhat analogous lysine 198 residue of PTR1. The following experimental observations indicated that oNADP 1 was indeed a good affinity label for PTR1 and, in addition, suggested that a residue essential for activity was derivatized: (i) saturation kinetics of the PTR1 and oNADP 1 interaction indicated the formation of a [PTR1– oNADP 1] binary complex before inactivation took place; (ii) the inactivation of oNADP 1 could be prevented by NADP 1 suggesting that the modification was at the same binding site; (iii) totally inactivated PTR1 incorporated only 1 mol of oNADP 1 per enzyme monomer; (iv) mutant K198Q showed no inactivation of oNADP 1 indicating that lysine 198 was essential for the modification; and (v) the results of the mass spectral analysis of the derivatized and proteolytically cleaved enzyme supported the hypothesis that modification had taken place at the C-terminal region. With DHPR, the N-terminal amino acid of the motif, tyrosine 146, serves as the proton donor in the enzymatic reaction and its mutation to phenylalanine results in a two order of magnitude reduction in k cat (52). With PTR1, the mutation of Y194 to phenylanine results in a 100% loss of enzymatic activity. Since the dissociation constants for biopterin and NADPH do not change significantly, it is possible that the hydroxyl group of Y194 in PTR1 participates in the enzymatic reaction leading to pteridine reduction. It should be noted, however, that the reductive reaction occurring with DHPR is the conversion of a quinonoid dihydropteridine to its tetrahydro form, whereas the reduction occurring in this instance is probably a fully oxidized pteridine to 7,8-dihydro and then to a 5,6,7,8,-tetrahy-

170

CHANG, BRAY, AND WHITELEY

and in fact, mutants characterized with reduced dinucleotide binding properties lead to unstable proteins (52). Hence, it is probable that the initial binding of NADPH to PTR1 must also reorient the protein and cofactor to facilitate the ensuing hydride transfer. It is interesting to note that the reductive reaction mechanism favors the generation of a 7,8-dihydropteridine despite using the Y(Xaa) 3K motif common to the SDR proteins including DHPR. Experimental results in this report complement the recent description of a pro-S NADPH hydride transfer to the si face of dihydrofolate during the reduction of this substrate (17); however, final elucidation of the general mode of hydrogen transfer to the favored substrate at the active site will necessitate further mutational experiments and the structural characterization of a PTR1 ternary complex. ACKNOWLEDGMENTS

FIG. 7. UV spectra for oNADP 1 inactivation: (—) PTR1 only, (. . .) PTR1– oNADP 1 complex, (- - -) NaBH 4-reduced PTR1– oNADP complex.

The authors are indebted to Marc Ouellette, Centre de Recherche en Infectiologie du Centre Hospitalier de l’Universite´ Laval (Quebec, Canada), for supplying the cDNA for Leishmania tarentolae PTR1 and to Charles E. Grimshaw, Signal (San Diego, CA) for critical analysis of the reaction kinetics.

REFERENCES

dro derivative, akin to that observed with DHFR (49). Thus, the participation of the tyrosine phenolic proton of Y194 in the reductive mechanism of PTR1 is probably significantly different from that observed with DHPR. It has previously been reported that the hydride from NAD(P)H is transferred to C6 of the dihydropterin during enzyme reduction with DHFR (53) and to N5 of the quinonoid dihydropterin with DHPR (19, 23). For PTR1, it is possible that the preference for a fully oxidized substrate could be the result of a regioselectivity introduced at the active site such that the hydride from NADPH might move easily to the oxidized pterin substrate at C7. Restricted movement at the active site or the altered physical properties of the reduced pterin then result in less activity toward the 7,8-dihydropteridine product and no activity toward a quinonoid dihydropteridine substrate. Clearly the fact that DHFR has activity toward both the oxidized and reduced folate substrates suggests that the DHFR active site offers greater substrate tolerance than PTR1. The observations described in this report suggest that PTR1 has many superficial similarities to both DHFR and DHPR, particularly in the requirements that the reduced dinucleotides bind first to the free enzyme. Nevertheless, with DHFR and DHPR there are known distinct differences in the orientation of the dinucleotides at their respective binding sites (53, 54); at present, with PTR1 the exact orientation is unknown. Moreover, with DHPR the pteridine binding site is not created until NADH is bound to the enzyme,

1. Roth, B. (1986) Fed. Proc. 45, 2765–2772. 2. Morrison, J. F., and Walsh, C. T. (1988) Adv. Enzymol. 61, 201–301. 3. Wang, C. C. (1985) Trends Biochem. Sci. 7, 354 –356. 4. Peters, W. (1985) Parasitology 90, 705–715. 5. Nare, B., Hardy, L. W., and Beverley, S. M. (1997) J. Biol. Chem. 272, 13883–13891. 6. Wang, J., Leblanc, E., Chang, C. F., Papadopoulou, B., Bray, T., Whiteley, J. M., Lin, S. X., and Ouellette, M. (1997) Arch. Biochem. Biophys. 342, 197–202. 7. Beck, J. T., and Ullman, B. (1991) Mol. Biochem. Parasitol. 49, 21–28. 8. Coderre, J. A., Beverley, S. M., Schimke, R. T., and Santi, D. V. (1983) Proc. Natl. Acad. Sci. USA 80, 2132–2136. 9. Beck, J. T., and Ullman, B. (1990) Mol. Biochem. Parasitol. 43, 221–230. 10. Arrebola, R., Olmo, A., Reche, P., Garvey, E. P., Santi, D. V., Ruiz-Perez, L. M., and Gonzalez-Pacanowska, D. (1994) J. Biol. Chem. 269, 10590 –10596. 11. Bello, A. R., Nare, B., Freedman, D., Hardy, L., and Beverley, S. M. (1994) Proc. Natl. Acad. Sci. USA 91, 11442–11446. 12. Papadopoulou, B., Roy, G., Mourad, W., Leblanc, E., and Ouellette, M. (1994) J. Biol. Chem. 269, 7310 –7315. 13. Papadopoulou, B., and Ouellette, M. (1993) Adv. Exp. Med. Biol. 338, 559 –562. 14. Papadopoulou, B., Roy, G., and Ouellette, M. (1992) EMBO J. 11, 3601–3608. 15. Callahan, H. L., and Beverley, S. M. (1992) J. Biol. Chem. 267, 24165–24168. 16. Borst, P., and Ouellette, M. (1995) Annu. Rev. Microbiol. 49, 427– 460. 17. Luba, J., Nare, B., Liang, P.-H., Anderson, K. S., Beverley, S. M., and Hardy, L. (1998) Biochemistry 37, 4093– 4104.

MUTANT PTR1 PROTEINS: PURIFICATION AND COMPARATIVE PROPERTIES 18. Ensor, C. M., and Tai, H.-H. (1994) Biochim. Biophys. Acta 1208, 151–156. 19. Whiteley, J. M., Varughese, K. I., Xuong, N. H., Matthews, D. A., and Grimshaw, C. E. (1993) Pteridines 4, 159 –173. 20. Maser, E., and Oppermann, U. C. T. (1995) in Enzymology and Molecular Biology of Carbonyl Metabolism V (Weiner, H., Holmes, R., and Wermuth, B., Eds.), pp. 211–222, Plenum, New York. 21. Su, Y., Varughese, K. I., Xuong, N. H., Bray, T. L., Roche, D. J., and Whiteley, J. M. (1993) J. Biol. Chem. 268, 26836 –26841. 22. Wierenga, R. K., Terpstra, P., and Hol, W. G. J. (1986) J. Mol. Biol. 187, 101–107. 23. Varughese, K. I., Xuong, N. H., Kiefer, P. M., Matthews, D. A., and Whiteley, J. M. (1994) Proc. Natl. Acad. Sci. USA 91, 5582– 5586. 24. Persson, B., Krook, M., and Jo¨rnvall, H. (1991) Eur. J. Biochem. 200, 537–543. 25. Chang, G., Shiao, M., Liaw, J., and Lee, H. (1989) J. Biol. Chem. 264, 280 –287. 26. Mas, M. T., and Colman, R. F. (1983) J. Biol. Chem. 258, 9332– 9338. 27. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. USA 82, 488 – 492. 28. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Methods Enzymol. 154, 367–382. 29. Hedrick, J. L., and Smith, A. J. (1968) Arch. Biochem. Biophys. 126, 155–164. 30. Chrambach, A., and Rodbard, D. (1971) Science 172, 440 – 451. 31. Laemmli, U. K. (1970) Nature 227, 680 – 685. 32. Bradford, M. M. (1976) Anal. Biochem. 72, 248 –254. 33. Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Anal. Biochem. 150, 76 – 85. 34. Beutler, H. O., and Supp, M. (1983) in Methods of Enzymatic Analysis (Bergmeyer, H. U., Ed.), pp. 369 –372, VCH, Weinheim, Germany. 35. Pfleiderer, W. (1985) in Folates and Pterins, II: Chemistry and Biochemistry of Pterins (Blakley, R. L., and Benkovic, S. J., Eds.), pp. 43–115, Wiley, New York.

171

36. Ellis, K. J., and Morrison, J. F. (1982) Methods Enzymol. 87, 405– 426. 37. Stinson, R. A., and Holbrook, J. J. (1973) Biochem. J. 131, 719 –728. 38. Ward, L. D. (1985) Methods Enzymol. 117, 400 – 414. 39. Blanchard, R. A., and Cleland, W. W. (1980) Biochemistry 19, 3543–3550. 40. Williams, J. W., and Morrison, J. F. (1979) Methods Enzymol. 63, 437– 486. 41. Grimshaw, C. E., Shahbaz, M., Jahangiri, G., Putney, C. G., and Mathur, E. J. (1989) Biochemistry 28, 5343–5352. 42. Grimshaw, C. E., and Cleland, W. W. (1981) Biochemistry 20, 5650 –5655. 43. Wilkinson, G. N. (1961) Biochem. J. 80, 324 –332. 44. Cleland, W. W. (1979) in Methods in Enzymology (Purich, D. L., Ed.),Vol. 63, pp. 103–138, Academic Press, San Diego. 45. Northrop, D. B., and Cleland, W. W. (1974) J. Biol. Chem. 249, 2928 –2931. 46. Cleland, W. W. (1963) Biochim. Biophys. Acta 67, 104 –137. 47. Segel, I. H. (1975) in Enzyme Kinetics, pp. 465–504, Wiley, New York. 48. Robello, C., Navarro, P., Castanys, S., and Gamarro, F. (1997) Mol. Biochem. Parasitol. 90, 525–535. 49. Blakley, R. L. (1984) in Folates and Pterins 1: Chemistry and Biochemistry of Folates (Blakley, R. L., and Benkovic, S. J., Eds.), pp. 191–253, Wiley, New York. 50. Nakanishi, M., Matsuura, K., Kaibe, H., Tanaka, N., Nonaka, T., Mitsui, Y., and Hara, A. (1997) J. Biol. Chem. 272, 2218 –2222. 51. Leblanc, E., Papadopoulou, B., Bernatchez, C., and Ouellette, M. (1998) Eur. J. Biochem. 251, 768 –774. 52. Kiefer, P. M., Varughese, K. I., Su, Y., Xuong, N. H., Chang, C.-F., Gupta, P., Bray, T., and Whiteley, J. M. (1996) J. Biol. Chem. 271, 3437–3444. 53. Bystroff, C., Oatley, S. J., and Kraut, J. (1990) Biochemistry 29, 3263–3277. 54. Varughese, K. I., Skinner, M. M., Whiteley, J. M., Matthews, D. A., and Xuong, N. H. (1992) Proc. Natl. Acad. Sci. USA 89, 6080 – 6084.