- Email: [email protected]
Mutation analyses of patients with dyschromatosis symmetrica hereditaria: Ten novel mutations of the ADAR1 gene
Letters to the Editor / Journal of Dermatological Science 79 (2015) 84–90
88
In conclusion, we reported a Japanese sporadic case of SEI harboring a novel KRT2 mutation, p.N186S. This report will enrich the database of mutational analysis and contribute to the correct diagnosis of SEI.
family with ichthyosis bullosa of Siemens. J Invest Dermatol 2000;114: 193–5. [6] Suga Y, Arin MJ, Scott G, Goldsmith LA, Magro CM, Baden LA, et al. Hot spot mutations in keratin 2e suggest a correlation between genotype and phenotype in patients with ichthyosis bullosa of Siemens. Exp Dermatol 2000;9:11–5.
Funding None. References [1] Akiyama M, Tsuji-Abe Y, Yanagihara M, Nakajima K, Kodama H, Yaosaka M, et al. Ichthyosis bullosa of Siemens: its correct diagnosis facilitated by molecular genetic testing. Br J Dermatol 2005;152:1353–6. [2] Sung JY, Oh SW, Kim SE, Kim SC. Mild phenotype of epidermolytic hyperkeratosis mimicking ichthyosis bullosa of Siemens is related to specific mutation in 2B domain of KRT1. J Dermatol Sci 2013;70:220–2. [3] Whittock NV, Ashton GH, Griffiths WA, Eady RA, McGrath JA. New mutations in keratin 1 that cause bullous congenital ichthyosiform erythroderma and keratin 2e that cause ichthyosis bullosa of Siemens. Br J Dermatol 2001;145:330–5. [4] Smith FJ, Maingi C, Covello SP, Higgins C, Schmidt M, Lane EB, et al. Genomic organization and fine mapping of the keratin 2e gene (KRT2E) V1 domain polymorphism and novel mutations in ichthyosis bullosa of Siemens. J Invest Dermatol 1998;111:817–21. [5] Takizawa Y, Akiyama M, Nagashima M, Shimizu H. A novel asparagine– >aspartic acid mutation in the rod 1A domain in keratin 2e in a Japanese
Eijiro Akasaka, Satoko Minakawa, Daiki Rokunohe, Yuka Toyomaki, Yasushi Matsuzaki, Daisuke Sawamura, Hajime Nakano* Department of Dermatology, Hirosaki University Graduate School of Medicine, Hirosaki, Japan *Corresponding
author at: Department of Dermatology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki 036-8562, Japan. Tel.: +81 172 39 5087; fax: +81 172 37 6060 E-mail address: [email protected] (H. Nakano). 17 February 2015 http://dx.doi.org/10.1016/j.jdermsci.2015.04.006
Letter to the Editor Mutation analyses of patients with dyschromatosis symmetrica hereditaria: Ten novel mutations of the ADAR1 gene Dyschromatosis symmetrica hereditaria (DSH: MIM 127400) is a rare autosomal dominant disease characterized by freckle-like macules on the face and a mixture of hyperpigmented and hypopigmented macules on dorsal aspects of the extremities. The phenotypes appear in infancy or early childhood and commonly stop spreading before adolescence, and last for life [1,2]. In Asia, the condition occurs predominantly among Japanese and Chinese individuals. Miyamura et al. have clarified that a heterozygous mutation of the adenosine deaminase acting on RNA 1 gene (ADAR1, formerly DSRAD) causes DSH in Japanese families [3]. To date, more than 120 of various mutations have been reported mainly from East Asian countries [4], which confirmed that the ADAR1 is responsible for DSH not only in Japanese but also in other ethnic groups. The human ADAR1 spans up to 40 kb and contains 15 exons. It produces interferon-inducible or long-form (p150) and constitutively expressed or short-form (p110) ADAR1 protein, due to alternative splicing. The p150 protein has two series of
Z-DNA-binding domains, three series of dsRNA-binding domains and a deaminase domain, while the p110 protein lacks the Za domain [5]. ADAR1 protein catalyzes the deamination of adenosine to inosine in double-stranded RNA substrates [6], which results in the creation of alternative splicing sites or alternations of the codon and thus leads to functional changes in the protein. The ADAR1 is expressed ubiquitously, but the target RNA(s) in the skin as well as the mechanisms by which mutations in ADAR1 cause DSH still remain unknown. Recently, an epidermis-specific Adar1 knockout mouse model was generated [7]. Histologically, this gene knockout resulted in massive necrosis of the epidermis in FVB background mice and thickening of keratinocytes and stratum corneum in B6 background mice. Therefore, Adar1 was thought to be an essential molecule for skin integrity. In this study, we describe mutation analyses of Japanese patients with DSH. The mutational analysis of the ADAR1 was performed as previously described [8]. Informed consent and blood samples of patients were obtained under protocols approved by the Ethics Committee of Yamagata University School of Medicine. We detected ten novel mutations as shown in Table 1. These mutations included two missense mutations (p.L1067W;
Table 1 Novel Mutations of the ADAR1 gene with DSH patients. Patient
Incidence
Mutation
Phenotype
Mutation location
Nucleotide changea
Amino-acid change
Onset
Complication
1
Familial
Exon7
c.2398dupG
p.E800fsX842
5 years
2 3 4 5 6 7 8 9
Familial Familial Sporadic Familial Familial Familial Familial Sporadic
Exon11 Exon6 Exon8 Exon3 Exon12 Exon14 Exon11 IVS13
c.2915_2916delTT c.2108_2115delATAACTTG c.2545dupC c.1729_1733delGACAG c.3200T>G c.3363dupT c.2977G>T IVS13+1G>A
At birth 12 years 1 year 6 years 2 years 2 years 10 months 3 years
10
Sporadic
Exon13
c.3241TC
p.F972fsX972 p.D703fsX740 p.H849fsX857 p.D577fsX620 p.L1067W p.K1122fsX1122 p.E993X p.G1068fsX1075 (ex13 skipping) p.C1081R
Intracranial hemangioma, Parry–Romberg syndrome None None None None None None None None
3 years
None
a
GenBank Accession no. NM_001111.4. Position 1 is A of the translation initiation codon.
Letters to the Editor / Journal of Dermatological Science 79 (2015) 84–90
89
Fig. 1. RT-PCR analysis of ADAR1 exon-skipping event in a patient with IVS13+1G>A. RT-PCR analysis confirms that the IVS13+1G>A mutation of ADAR1 causes aberrant exon13 skipping in a DSH patient. Splicing patterns are compared between a normal allele and the mutant allele of the patient by cDNA sequencing. An expected ADAR1 product of 497 bp consisting of exons11–15 is observed in the control (lane 2) and normal allele of the patient (lane 3), whereas an abnormal product of 384 bp skipping exon13 (113 bp) is observed in a mutant allele of the patient (lane 4). The aberrant exclusion of exon13 (113 bp) in a patient with IVS13+1G>A is predicted to introduce a frameshift and a truncated protein with an additional 6-amino-acid peptide.
p.C1081R), one splice site mutation (IVS13+1G>A), 6 frameshift mutations (p.E800fsX842; p.F972fsX972; p.D703fsX740; p.H849fsX857; p.D577fsX620; p.K1122fsX1122), and one nonsense mutation (p.E993X) in 7 families and 3 sporadic patients. The novel missense mutations that altered amino acids conserved among all known species, including zebrafish, frog, chicken, mouse, cow, and human. The newly identified mutations were not found in 100 unrelated, normally pigmented Japanese adults, and were not identified in the databases of 1000 Genomes Project and dbSNP (build 141). Furthermore, in the case of a splice site mutation, IVS13+1G>A, we investigated how the nucleotide change from G to A at the splice site might change the pre-mRNA splice pattern using RT-PCR with RNA extracted from mononuclear cells in the peripheral blood. The primers for RT-PCR were EX11cf (50 TCCCAAACAAGGAAAGCTCC 30 ) and EX15cr (50 TCTTTTTGGAGACCCGGGAC 30 ). The RT-PCR product from the patient was electrophoresed with 1.5% agarose gel and revealed two cDNA bands (one was the same with control (497 bp) and the other was aberrant (384 bp)). Then, we separated the gels with each bands and extracted the cDNA from each gels. We confirmed the separation of the two bands of the patient (Fig. 1, lane 3, 4). Sequencing of the aberrant cDNA from the patient revealed a skipping of exon13 of ADAR1 (Fig. 1, right). This skipping is predicted to result in a frameshift and a truncated protein with an additional 6-amino-acid peptide. Therefore, we consider all of these newly identified mutations pathologic without functional activity. Six mutations identified in this study were located within the deaminase domain which encompasses amino acids 886– 1221. Also, the other four mutations were frame-shift mutations which would lead to premature termination (without the deaminase domain), suggesting that this domain is critical for enzyme function as previously reported [9,10].
All patients phenotypically presented typical macules on the dorsal aspects of the hands, feet, lower arms and lower legs, and freckle-like macules on the face. The onset age of patient 3 was later than other patients despite the frame-shift mutation which would lead to lack of the deaminase domain, suggesting that some sort of environmental factors might be involved. Complications were found in patient 1. She was a 5-year-old girl and revealed skin manifestations described above, localized scleroderma on her right nasal dorsum, light depression on her right forehead and had some episodes of seizures. Brain MRI showed atrophy of the right forehead bone and right hemisphere. In addition, various intracranial hemangiomas were detected. She was clinically diagnosed with Parry–Romberg syndrome and intracranial hemangioma. Her mother also revealed typical skin manifestations as DSH and was detected the same mutation in the ADAR1. However, she had no complications observed in a case of patient 1. To date, although various complications, such as mental deterioration, dystonia and seizure have been reported in DSH patients, the relationship between the mutations of ADAR1 and neurological symptoms is still unknown [4]. To the best of our knowledge, there has been no report of a patient with DSH who occurred in conjunction with Parry–Romberg syndrome or intracranial hemangioma. In conclusion, we have found ten novel mutations in the ADAR1 of 7 DSH pedigrees and 3 sporadic individuals. These results may provide new insight into the pathogenesis of DSH. Acknowledgements We are grateful to the patients, their families and volunteers for providing blood samples. This work was supported by a grant from the Ministry of Health, Labor, and Welfare of Japan (Health
90
Letters to the Editor / Journal of Dermatological Science 79 (2015) 84–90
and Labor Sciences Research Grants; research on intractable diseases; H24-039) and a grant (22591236) from the Ministry of Education, Sports, Culture, Science, and Technology of Japan to T.S. References [1] Tomita Y, Suzuki T. Genetics of pigmentary disorders. Am J Med Genet 2004;131C:75–81. [2] Oyama M, Shimizu H, Ohata Y, Tajima S, Nishikawa T. Dyschromatosis symmetrica hereditaria (reticulate acropigmentation of Dohi): report of a Japanese family with the condition and a literature review of 185 cases. Br J Dermatol 1999;140:491–6. [3] Miyamura Y, Suzuki T, Kono M, Inagaki K, Ito S, Suzuki N, et al. Mutations of the RNA-specific adenosine deaminase gene (DSRAD) are involved in dyschromatosis symmetrica hereditaria. Am J Hum Genet 2003;73:693–9. [4] Hayashi M, Suzuki T. Dyschromatosis symmetrica hereditaria. J Dermatol 2013;40:336–43. [5] George CX, Gan Z, Liu Y, Samuel CE. Adenosine deaminases acting on RNA, RNA editing, and interferon action. J Interferon Cytokine Res 2011;31: 99–117. [6] Bass BL, Weintraub H. An unwinding activity that covalently modifies its double-stranded RNA substrate. Cell 1988;55:1089–98. [7] Sharma R, Wang Y, Zhou P, Steinman RA, Wang Q. An essential role of RNA editing enzyme ADAR1 in mouse skin. J Dermatol Sci 2011;64:70–2. [8] Suzuki N, Suzuki T, Inagaki K, Ito S, Kono M, Fukai K, et al. Mutation analysis of the ADAR1 gene in dyschromatosis symmetrica hereditaria and genetic differentiation from both dyschromatosis universalis hereditaria and acropigmentatio reticularis. J Invest Dermatol 2005;124:1186–92. [9] Murata I, HozumiY, Kawaguchi M, Katagiri Y, Yasumoto S, Kubo Y, et al. Four Novel Mutations of the ADAR1 Gene in dyschromatosis symmetrica hereditaria. J Dermatol Sci 2009;53:76–7. [10] Kawaguchi M, Hayashi M, Murata I, Hozumi Y, Suzuki N, Ishii Y, et al. Eleven novel mutations of the ADAR1 gene in dyschromatosis symmetrica hereditaria. J Dermatol Sci 2012;66:244–5.
Ken Okamuraa,*, Yuko Abea, Kazuyoshi Fukaib, Daisuke Tsurutab, Yasushi Sugac, Motonobu Nakamurad, Yoko Funasakae, Masahiro Okaf, Noriyuki Suzukig, Mari Wataya-Kanedah, Mariko Seishimai, Yutaka Hozumia, Masakazu Kawaguchia, Tamio Suzukia a Department of Dermatology, Yamagata University Faculty of Medicine, Yamagata, Japan; bDepartment of Dermatology, Osaka City University Graduate School of Medicine, Osaka, Japan; cDepartment of Dermatology, Juntendo University Urayasu Hospital, Urayasu, Japan; d Department of Dermatology, University of Occupational and Environmental Health, Kitakyushu, Japan; eDepartment of Dermatology, Nippon Medical School, Tokyo, Japan; fDivision of Dermatology, Kobe University Graduate School of Medicine, Kobe, Japan; gDepartment of Dermatology, Toyohashi Municipal Hospital, Toyohashi, Japan; hDepartment of Dermatology, Osaka University Graduate School of Medicine, Osaka, Japan; iDepartment of Dermatology, Gifu University Graduate School of Medicine, Gifu, Japan *Corresponding
author at: Department of Dermatology, Faculty of Medicine, Yamagata University, 2-2-2, Iida-Nishi, Yamagata 990-9585, Japan. Tel.: +81 236285361; fax: +81 236285364 E-mail address: [email protected] (K. Okamura). 28 January 2015 http://dx.doi.org/10.1016/j.jdermsci.2015.04.004
88
In conclusion, we reported a Japanese sporadic case of SEI harboring a novel KRT2 mutation, p.N186S. This report will enrich the database of mutational analysis and contribute to the correct diagnosis of SEI.
family with ichthyosis bullosa of Siemens. J Invest Dermatol 2000;114: 193–5. [6] Suga Y, Arin MJ, Scott G, Goldsmith LA, Magro CM, Baden LA, et al. Hot spot mutations in keratin 2e suggest a correlation between genotype and phenotype in patients with ichthyosis bullosa of Siemens. Exp Dermatol 2000;9:11–5.
Funding None. References [1] Akiyama M, Tsuji-Abe Y, Yanagihara M, Nakajima K, Kodama H, Yaosaka M, et al. Ichthyosis bullosa of Siemens: its correct diagnosis facilitated by molecular genetic testing. Br J Dermatol 2005;152:1353–6. [2] Sung JY, Oh SW, Kim SE, Kim SC. Mild phenotype of epidermolytic hyperkeratosis mimicking ichthyosis bullosa of Siemens is related to specific mutation in 2B domain of KRT1. J Dermatol Sci 2013;70:220–2. [3] Whittock NV, Ashton GH, Griffiths WA, Eady RA, McGrath JA. New mutations in keratin 1 that cause bullous congenital ichthyosiform erythroderma and keratin 2e that cause ichthyosis bullosa of Siemens. Br J Dermatol 2001;145:330–5. [4] Smith FJ, Maingi C, Covello SP, Higgins C, Schmidt M, Lane EB, et al. Genomic organization and fine mapping of the keratin 2e gene (KRT2E) V1 domain polymorphism and novel mutations in ichthyosis bullosa of Siemens. J Invest Dermatol 1998;111:817–21. [5] Takizawa Y, Akiyama M, Nagashima M, Shimizu H. A novel asparagine– >aspartic acid mutation in the rod 1A domain in keratin 2e in a Japanese
Eijiro Akasaka, Satoko Minakawa, Daiki Rokunohe, Yuka Toyomaki, Yasushi Matsuzaki, Daisuke Sawamura, Hajime Nakano* Department of Dermatology, Hirosaki University Graduate School of Medicine, Hirosaki, Japan *Corresponding
author at: Department of Dermatology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki 036-8562, Japan. Tel.: +81 172 39 5087; fax: +81 172 37 6060 E-mail address: [email protected] (H. Nakano). 17 February 2015 http://dx.doi.org/10.1016/j.jdermsci.2015.04.006
Letter to the Editor Mutation analyses of patients with dyschromatosis symmetrica hereditaria: Ten novel mutations of the ADAR1 gene Dyschromatosis symmetrica hereditaria (DSH: MIM 127400) is a rare autosomal dominant disease characterized by freckle-like macules on the face and a mixture of hyperpigmented and hypopigmented macules on dorsal aspects of the extremities. The phenotypes appear in infancy or early childhood and commonly stop spreading before adolescence, and last for life [1,2]. In Asia, the condition occurs predominantly among Japanese and Chinese individuals. Miyamura et al. have clarified that a heterozygous mutation of the adenosine deaminase acting on RNA 1 gene (ADAR1, formerly DSRAD) causes DSH in Japanese families [3]. To date, more than 120 of various mutations have been reported mainly from East Asian countries [4], which confirmed that the ADAR1 is responsible for DSH not only in Japanese but also in other ethnic groups. The human ADAR1 spans up to 40 kb and contains 15 exons. It produces interferon-inducible or long-form (p150) and constitutively expressed or short-form (p110) ADAR1 protein, due to alternative splicing. The p150 protein has two series of
Z-DNA-binding domains, three series of dsRNA-binding domains and a deaminase domain, while the p110 protein lacks the Za domain [5]. ADAR1 protein catalyzes the deamination of adenosine to inosine in double-stranded RNA substrates [6], which results in the creation of alternative splicing sites or alternations of the codon and thus leads to functional changes in the protein. The ADAR1 is expressed ubiquitously, but the target RNA(s) in the skin as well as the mechanisms by which mutations in ADAR1 cause DSH still remain unknown. Recently, an epidermis-specific Adar1 knockout mouse model was generated [7]. Histologically, this gene knockout resulted in massive necrosis of the epidermis in FVB background mice and thickening of keratinocytes and stratum corneum in B6 background mice. Therefore, Adar1 was thought to be an essential molecule for skin integrity. In this study, we describe mutation analyses of Japanese patients with DSH. The mutational analysis of the ADAR1 was performed as previously described [8]. Informed consent and blood samples of patients were obtained under protocols approved by the Ethics Committee of Yamagata University School of Medicine. We detected ten novel mutations as shown in Table 1. These mutations included two missense mutations (p.L1067W;
Table 1 Novel Mutations of the ADAR1 gene with DSH patients. Patient
Incidence
Mutation
Phenotype
Mutation location
Nucleotide changea
Amino-acid change
Onset
Complication
1
Familial
Exon7
c.2398dupG
p.E800fsX842
5 years
2 3 4 5 6 7 8 9
Familial Familial Sporadic Familial Familial Familial Familial Sporadic
Exon11 Exon6 Exon8 Exon3 Exon12 Exon14 Exon11 IVS13
c.2915_2916delTT c.2108_2115delATAACTTG c.2545dupC c.1729_1733delGACAG c.3200T>G c.3363dupT c.2977G>T IVS13+1G>A
At birth 12 years 1 year 6 years 2 years 2 years 10 months 3 years
10
Sporadic
Exon13
c.3241TC
p.F972fsX972 p.D703fsX740 p.H849fsX857 p.D577fsX620 p.L1067W p.K1122fsX1122 p.E993X p.G1068fsX1075 (ex13 skipping) p.C1081R
Intracranial hemangioma, Parry–Romberg syndrome None None None None None None None None
3 years
None
a
GenBank Accession no. NM_001111.4. Position 1 is A of the translation initiation codon.
Letters to the Editor / Journal of Dermatological Science 79 (2015) 84–90
89
Fig. 1. RT-PCR analysis of ADAR1 exon-skipping event in a patient with IVS13+1G>A. RT-PCR analysis confirms that the IVS13+1G>A mutation of ADAR1 causes aberrant exon13 skipping in a DSH patient. Splicing patterns are compared between a normal allele and the mutant allele of the patient by cDNA sequencing. An expected ADAR1 product of 497 bp consisting of exons11–15 is observed in the control (lane 2) and normal allele of the patient (lane 3), whereas an abnormal product of 384 bp skipping exon13 (113 bp) is observed in a mutant allele of the patient (lane 4). The aberrant exclusion of exon13 (113 bp) in a patient with IVS13+1G>A is predicted to introduce a frameshift and a truncated protein with an additional 6-amino-acid peptide.
p.C1081R), one splice site mutation (IVS13+1G>A), 6 frameshift mutations (p.E800fsX842; p.F972fsX972; p.D703fsX740; p.H849fsX857; p.D577fsX620; p.K1122fsX1122), and one nonsense mutation (p.E993X) in 7 families and 3 sporadic patients. The novel missense mutations that altered amino acids conserved among all known species, including zebrafish, frog, chicken, mouse, cow, and human. The newly identified mutations were not found in 100 unrelated, normally pigmented Japanese adults, and were not identified in the databases of 1000 Genomes Project and dbSNP (build 141). Furthermore, in the case of a splice site mutation, IVS13+1G>A, we investigated how the nucleotide change from G to A at the splice site might change the pre-mRNA splice pattern using RT-PCR with RNA extracted from mononuclear cells in the peripheral blood. The primers for RT-PCR were EX11cf (50 TCCCAAACAAGGAAAGCTCC 30 ) and EX15cr (50 TCTTTTTGGAGACCCGGGAC 30 ). The RT-PCR product from the patient was electrophoresed with 1.5% agarose gel and revealed two cDNA bands (one was the same with control (497 bp) and the other was aberrant (384 bp)). Then, we separated the gels with each bands and extracted the cDNA from each gels. We confirmed the separation of the two bands of the patient (Fig. 1, lane 3, 4). Sequencing of the aberrant cDNA from the patient revealed a skipping of exon13 of ADAR1 (Fig. 1, right). This skipping is predicted to result in a frameshift and a truncated protein with an additional 6-amino-acid peptide. Therefore, we consider all of these newly identified mutations pathologic without functional activity. Six mutations identified in this study were located within the deaminase domain which encompasses amino acids 886– 1221. Also, the other four mutations were frame-shift mutations which would lead to premature termination (without the deaminase domain), suggesting that this domain is critical for enzyme function as previously reported [9,10].
All patients phenotypically presented typical macules on the dorsal aspects of the hands, feet, lower arms and lower legs, and freckle-like macules on the face. The onset age of patient 3 was later than other patients despite the frame-shift mutation which would lead to lack of the deaminase domain, suggesting that some sort of environmental factors might be involved. Complications were found in patient 1. She was a 5-year-old girl and revealed skin manifestations described above, localized scleroderma on her right nasal dorsum, light depression on her right forehead and had some episodes of seizures. Brain MRI showed atrophy of the right forehead bone and right hemisphere. In addition, various intracranial hemangiomas were detected. She was clinically diagnosed with Parry–Romberg syndrome and intracranial hemangioma. Her mother also revealed typical skin manifestations as DSH and was detected the same mutation in the ADAR1. However, she had no complications observed in a case of patient 1. To date, although various complications, such as mental deterioration, dystonia and seizure have been reported in DSH patients, the relationship between the mutations of ADAR1 and neurological symptoms is still unknown [4]. To the best of our knowledge, there has been no report of a patient with DSH who occurred in conjunction with Parry–Romberg syndrome or intracranial hemangioma. In conclusion, we have found ten novel mutations in the ADAR1 of 7 DSH pedigrees and 3 sporadic individuals. These results may provide new insight into the pathogenesis of DSH. Acknowledgements We are grateful to the patients, their families and volunteers for providing blood samples. This work was supported by a grant from the Ministry of Health, Labor, and Welfare of Japan (Health
90
Letters to the Editor / Journal of Dermatological Science 79 (2015) 84–90
and Labor Sciences Research Grants; research on intractable diseases; H24-039) and a grant (22591236) from the Ministry of Education, Sports, Culture, Science, and Technology of Japan to T.S. References [1] Tomita Y, Suzuki T. Genetics of pigmentary disorders. Am J Med Genet 2004;131C:75–81. [2] Oyama M, Shimizu H, Ohata Y, Tajima S, Nishikawa T. Dyschromatosis symmetrica hereditaria (reticulate acropigmentation of Dohi): report of a Japanese family with the condition and a literature review of 185 cases. Br J Dermatol 1999;140:491–6. [3] Miyamura Y, Suzuki T, Kono M, Inagaki K, Ito S, Suzuki N, et al. Mutations of the RNA-specific adenosine deaminase gene (DSRAD) are involved in dyschromatosis symmetrica hereditaria. Am J Hum Genet 2003;73:693–9. [4] Hayashi M, Suzuki T. Dyschromatosis symmetrica hereditaria. J Dermatol 2013;40:336–43. [5] George CX, Gan Z, Liu Y, Samuel CE. Adenosine deaminases acting on RNA, RNA editing, and interferon action. J Interferon Cytokine Res 2011;31: 99–117. [6] Bass BL, Weintraub H. An unwinding activity that covalently modifies its double-stranded RNA substrate. Cell 1988;55:1089–98. [7] Sharma R, Wang Y, Zhou P, Steinman RA, Wang Q. An essential role of RNA editing enzyme ADAR1 in mouse skin. J Dermatol Sci 2011;64:70–2. [8] Suzuki N, Suzuki T, Inagaki K, Ito S, Kono M, Fukai K, et al. Mutation analysis of the ADAR1 gene in dyschromatosis symmetrica hereditaria and genetic differentiation from both dyschromatosis universalis hereditaria and acropigmentatio reticularis. J Invest Dermatol 2005;124:1186–92. [9] Murata I, HozumiY, Kawaguchi M, Katagiri Y, Yasumoto S, Kubo Y, et al. Four Novel Mutations of the ADAR1 Gene in dyschromatosis symmetrica hereditaria. J Dermatol Sci 2009;53:76–7. [10] Kawaguchi M, Hayashi M, Murata I, Hozumi Y, Suzuki N, Ishii Y, et al. Eleven novel mutations of the ADAR1 gene in dyschromatosis symmetrica hereditaria. J Dermatol Sci 2012;66:244–5.
Ken Okamuraa,*, Yuko Abea, Kazuyoshi Fukaib, Daisuke Tsurutab, Yasushi Sugac, Motonobu Nakamurad, Yoko Funasakae, Masahiro Okaf, Noriyuki Suzukig, Mari Wataya-Kanedah, Mariko Seishimai, Yutaka Hozumia, Masakazu Kawaguchia, Tamio Suzukia a Department of Dermatology, Yamagata University Faculty of Medicine, Yamagata, Japan; bDepartment of Dermatology, Osaka City University Graduate School of Medicine, Osaka, Japan; cDepartment of Dermatology, Juntendo University Urayasu Hospital, Urayasu, Japan; d Department of Dermatology, University of Occupational and Environmental Health, Kitakyushu, Japan; eDepartment of Dermatology, Nippon Medical School, Tokyo, Japan; fDivision of Dermatology, Kobe University Graduate School of Medicine, Kobe, Japan; gDepartment of Dermatology, Toyohashi Municipal Hospital, Toyohashi, Japan; hDepartment of Dermatology, Osaka University Graduate School of Medicine, Osaka, Japan; iDepartment of Dermatology, Gifu University Graduate School of Medicine, Gifu, Japan *Corresponding
author at: Department of Dermatology, Faculty of Medicine, Yamagata University, 2-2-2, Iida-Nishi, Yamagata 990-9585, Japan. Tel.: +81 236285361; fax: +81 236285364 E-mail address: [email protected] (K. Okamura). 28 January 2015 http://dx.doi.org/10.1016/j.jdermsci.2015.04.004