- Email: [email protected]
Mutation of calcineurin subunit B M118 influences the activities of NF-AT and p53, but not calcineurin expression level
Biochemical and Biophysical Research Communications 413 (2011) 481–486
Contents lists available at SciVerse ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Mutation of calcineurin subunit B M118 influences the activities of NF-AT and p53, but not calcineurin expression level Jinbo Cheng, Wei Tang, Zhenyi Su, Qun Wei ⇑ Department of Biochemistry and Molecular Biology, Beijing Normal University, Beijing Key Laboratory, Beijing 100875, PR China
a r t i c l e
i n f o
Article history: Received 25 August 2011 Available online 2 September 2011 Keywords: Calcineurin subunit B Mutation NF-AT p53 Calcineurin level
a b s t r a c t Calcineurin (CN) is a Ca2+/calmodulin-dependent phosphatase, which consists of a catalytic A-subunit (CnA) and a regulatory B-subunit (CnB). Endogenous CnA and CnB have a strong corelationship in cancer cell lines. Through the introduction of CnB and its mutants in cells, we show that CnB does not increase the expression of CnA but protects it from degradation. CnB M118 is necessary for tight binding to CnA. Point mutations of CnB M118 also do not increase the expression of CnA but protect it from degradation. Furthermore, CnB M118K fails to enhance the activities of NF-AT and p53 induced by CnA in HeLa-s cells. Mutations in CnB M118 may prove to be a valuable marker in the diagnostics of some important illnesses such as Alzheimer’s disease. Crown Copyright Ó 2011 Published by Elsevier Inc. All rights reserved.
1. Introduction Calcineurin (CN), also known as proteins phosphatase 2B, is a Ca2+/calmodulin-dependent phosphatase and a principal mediator of cellular response triggered by intracellular Ca2+ signal [1–5]. The best studied function of CN is the activation and nuclear translocation of the transcriptional regulator, nuclear factor of activated T cells (NF-AT) [6–9]. The immunosuppressive drugs cyclosporin A (CsA) and FK506 can associate with CN and inhibit its dephosphorylation activity. CN consists of two subunits: a catalytic A-subunit (CnA) of 59KDa, and a regulatory B-subunit (CnB) of 19KDa. CnA has three regulatory domains at its C-terminus, consisting of a CnB-binding domain (BBH), a CaM-binding domain (CBD), and an autoinhibitory domain (AID) [3]. CnB has four Ca2+-binding sites: two high-affinity sites and two low-affinity sites. The two high-affinity sites are saturated by Ca2+ at all times, while binding to the two low-affinity sites is dependent on the Ca2+ concentration. When Ca2+ is bound to all four sites the conformation of CnB changes and the CaM-binding motif becomes exposed. This conformational change is necessary for enzyme activation [10,11]. The CN heterodimer is stabilized by a large, hydrophobic interface between CnB and the CnB-binding domain of CnA [12]. A loop of CnB that contains residues 118–125 is an important part of the primary interface in the CyP/CsA/CN complex and a critical element in the corresponding ternary complex with FKBP12 and FK506 [13]. Substitutions in this loop confer varying degrees of
⇑ Corresponding author. Fax: +86 010 58807365. E-mail address: [email protected] (Q. Wei).
resistance to CsA and FK506 [14]. Furthermore, this region is hypothesized to function in the CnB-mediated activation of CnA catalysis [14]. However, the details of how this region regulates CnA are not well defined. Our previous work shows that point mutation of CnB M118 is closely linked to CN activity in vitro, but the mechanism is not clear [15]. It is unknown how the mutant CnB M118 affects the CN activity in vivo but it may involve a change in the interaction of CnA and CnB or to the stability of CnA. Lowering of CN activity may play a role in the paired-helical filament formation and/or stabilization, but it is not accompanied by the decreases in the expression level of CN and CN regulatory proteins (including cyclophilin A and FKBP12) [16]. As CnB is the only regulatory subunit of CnA, it is unknown whether this mutation affects the expression level and stability of CnA in cells. CN activates NF-AT activity, which is important for p53 activity in skin squamous cancer development [17]. Whether the point mutation in CnB M118 will affect the activities of NF-AT and p53 in HeLa-s cells remains unknown. In this work, through the introduction of CnB and its mutants in cells, we investigated the impact of point mutations M118K and M118H on the expression, stability, and interaction of CnA as well as the activities of NF-AT and p53.
2. Materials and methods 2.1. Materials Anti-Myc and anti-Flag antibodies were purchased from Sigma (USA). Antibody against HA was from Roche Applied Science (USA). Antibody against Calcineurin was purchased from BD
0006-291X/$ - see front matter Crown Copyright Ó 2011 Published by Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.08.126
482
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
Pharmingen (USA). Anti-Calcineurin B was purchased from R&D Systems (USA), and anti-b-actin was from Santa Cruz Biotechnology (USA).
2.2. Construction of vectors The expression vectors PcDNA3-CnB, HA-dCnA (N-terminal residues: ATGTAC CCTTACGATGTACCGGATTACGCACTCGACGCCGCCC CGGAGCCGGCCCGGGCTGCACCGCCCCCACCCCCGCCC; C-terminal residues: GAAGACCAGTTT GATGTAGGTTCAGCTGCAGCCCGGAAAG AAATCATAAGAAACTGA), NF-AT-luc, p53-luc and pRL-null-Renilla-luc were in our collection and we constructed the Myc-CnB, Flag-CnB, Myc-CnB M118K and Myc-CnB M118H vectors. We used the two-round PCR method to construct the amino acid substitution mutation for M118K and M118H, and BamHI and XhoI restriction sites were introduced at the 50 - and 30 – ends of the primers, respectively. The PCR products were sub-cloned into Myc-tagged PcDNA3 vectors using these restriction sites. DNA was sequenced by the dideoxynucleotide method.
2.3. Cell culture and conditions HEK293T cells and HeLa-s cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum, 5 lM L-glutamine, and penicillin streptomycin. All cells were grown at 37 °C with 5% CO2.
2.4. Co-immunoprecipitation and Western analysis HEK293T cells were co-transfected with the indicated plasmid DNAs using Lipofectamine™ 2000. The cell was collected after 24 h and lysed in IP buffer containing 0.5% NP-40, 150 mM NaCl, 50 mM Tris, PH 8, 50 mM NaF, 2 mM EDTA, plus a protease inhibitor mixture (Roche Applied Science). Equal amounts of cell extract were mixed with anti-Myc or anti-Flag protein G Sepharose (GE Healthcare Life, 1ug antibody and 25 ll protein G Sepharose) and incubated overnight. The immunoprecipitates were washed four times in lysis buffer and eluted by boiling in Laemmli sample buffer (Bio-Rad, USA). Samples were fraction-
Fig. 1. The expression levels of CnA and CnB in different cancer cell lines. (A) The expression levels of CnA (61KD) and CnB (19KD) were detected in 13 different cancer cell lines (1. 293T, 2. HeLa, 3. HeLa-s, 4. PPC1, 5. MCF-7, 6. THP-1, 7. U937, 8. P3, 9. RS11846, 10. RS4,11, 11. HCT116, 12. HT29, 13. Jurkat). 13 kinds cancer cell lines listed above were cultured in DMEM, RPMI 1640, or Mccoy’s 5A Medium (Modified). Cells were collected and lysed in RIPA buffer, then analyzed by SDS–PAGE/immunoblotting (WB) using anti-CnA, anti-CnB and anti-b-actin antibodies as indicated. (B) The expression levels of CnA and CnB were quantized using Image J software and normalized by b-actin levels. Values represent mean ± SD. The relationship between CnA and CnB was analyzed by SAS software. ‘‘P < 0.05’’ means significant relationship between those two groups.
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
483
Fig. 2. Amino acid CnB M118 is necessary for CnB tight interacting with subunit A. (A) For co-immunoprecipitation experiments, HEK293T cells were transfected with 1ug HA-dCnA together with 1ug Flag vector or 1ug each of Flag-tagged PcDNA3 plasmids encoding CnB, PP2ABa and PP2ABd using 4 ll Lipofectamine™ 2000 (Ratio: DNA/ Lipofectamine™ 2000 = 1/2). Cells were collected and lysed in IP buffer after 24 h, and lysates were immunoprecipitated with anti-Flag antibody. The precipitates were collected, fractionated on SDS–PAGE and immunoblotted (WB) with anti-Flag and anti-HA antibodies as indicated. The bands with same Mr. as PP2ABa and PP2ABd are heavy chain of IgG. (B) HEK293T cells plated in 6-well plate were transfected various amount of HA-dCnA Flag-tagged CnB, PP2ABa or PP2ABd, as indicated. PcDNA3 empty vector was added so that there was the same amount of total DNA in each transfection mixture. CnA protein levels were quantized using Image J software. (C) HEK293T cells were transfected with various amount of HA-dCnA and PcDNA3-CnB as indicated. Cells were collected and lysed in RIPA buffer after 24 h, and lysates were immunoprecipitated with anti-HA and anti-CnB antibodies. The protein levels of CnB were quantized using Image J software. (D) HEK293T cells were transfected with 1ug HA-dCnA together with 1ug each of Myc-tagged plasmids encoding CnB, CnB M118K and CnB M118H. The details of Co-IP were same as described above.
ated by SDS–PAGE and transferred to nitrocellulose. Immunoblots were probed with the indicated primary antibodies and visualized by ECL (Invitrogen). 2.5. Luciferase reporter gene assay HeLa-s cells plated in 96-well were transfected with various plasmids encoding dCnA, CnB, CnB M118K, NF-AT-luc, p53-luc, or pRL-null-Renilla-luc. PcDNA3 empty vector was added so that there was the same amount of total DNA in each transfection
mixture. After 24 h luciferase activity was measured using a Dual-Luciferase Reporter Kit (Promega). Transfection efficiency was normalized by the expression of Renilla luciferase. Luciferase units are presented as relative luciferase activity, which represents the ‘fold induction’ of luciferase activity. 2.6. Quantitative real-time PCR analysis Total RNA was isolated from cells with a purified RNA extracted kit (BioTeke, China). Quantitative real-time PCR was performed to
484
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
Fig. 3. The effects of CnB and CnB M118K on the expression level and the stability of CnA. (A) HEK293T cells were transfected with various amounts of plasmids encoding HAdCnA, PcDNA3-CnB, Myc-tagged CnB M118K or CnB M118H as indicated. Cells were collected and lysed in RIPA buffer after 24 h. SDS–PAGE/immunoblotting (WB) was followed using anti-HA and anti-CnB antibodies as showing. (B) HEK293T cells were transfected with 1ug HA-dCnA together with 1ug each of Myc-tagged plasmids encoding CnB or CnB M118K. Cells were collected after 24 h, and total RNA was isolated. The mRNA levels of CnA in different groups were detected by real-time PCR using b-actin as an endogenous control gene. (C) CnA stability was measured by cycoheximide (CHX)-based protein chase experiment. To measure CnA stability, plasmid HA-dCnA, Myc-CnB or Myc-CnB M118K was transfected into HEK293T cells as showing. 50 lg/ml CHX was added into the medium 24 h after transfection. Cells were harvested at various time points (0, 0.5, 1, 3, 6, 24 h) after the addition of CHX and lysed in RIPA buffer. SDS–PAGE/immunoblotting (WB) was followed using anti-HA and anti-Myc, and anti-b-actin as showing. (D) CnA protein levels were quantized using Image J software and normalized by b-actin levels.
detect transcription level of CnA using b-actin as an endogenous control gene. Threshold cycle (Ct) values from triplicate PCRs were normalized against the average Ct values for b-actin using the formula: 2DDCt.
2.7. Statistical analysis The results of all quantitative experiments are reported as Mean ± SD of three independent experiments. Statistical differ-
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
485
ences between groups were determined using SAS software. P < 0.05 was considered significant. 3. Results 3.1. The expression levels of CnA and CnB in different cancer cell lines To assess protein expression level, endogenous CnA and CnB in various cancer cell lines were detected by immunoblotting. Lysates were normalized for total protein concentration before analysis, and b-actin was used as the control. The relative expression levels of CnA and CnB vary widely among tumor lines tested, with higher levels in PPC1, MCF-7, HCT116 and HT29 cell lines (Fig. 1A). The relative expression levels of CnA and CnB have a statistically significant relationship (R2 = 0.891, P < 0.01) (Fig. 1B). 3.2. Mutants M118K and M118H influence the binding of CnB to CnA To test the specific role of CnB for CnA, another two regulatory subunits of PP2A, PP2ABa and PP2ABd, were used as the control. Co-immunoprecipitation experiments reveal that CnB binds to dCnA, a constitutively active form of CN that lacks the AID domain [7,18]. PP2ABa and PP2ABd fail to bind to dCnA (Fig. 2A). Furthermore, coexpression of CnB increases the expression level of dCnA in a dose dependent manner. In contrast, PP2ABa and PP2ABd do not affect the expression level of dCnA (Fig. 2B). Overexpression of HA-dCnA results in higher levels of CnB (Fig. 2C), suggesting that CnB and CnA bind to and stabilize each other in cells. Mutants M118K and M118H bind to dCnA weakly compared with wild type-CnB (Fig. 2D), suggesting that the residue M118 is necessary for the tight binding of CnB to CnA. 3.3. Mutant M118K does not change the mRNA level and the stability of CnA Overexpression of mutants M118K and M118H do enhance the expression level of dCnA (Fig. 3A). We still do not know the increased expression level of CnA is the result of increased transcription at the mRNA level or protection against proteolysis. To check the mRNA levels of CnA, HEK293T cells were transfected with HAdCnA together with Myc-CnB, or Myc-CnB M118K. Cells were collected and total RNA was isolated after 24 h. From real-time PCR assay, we found coexpression of Myc-CnB or Myc-CnB M118K did not change the mRNA level of CnA (Fig. 3B). To determine if the mutant of CnB M118K affects the stability of CnA, HEK293T cells were transfected with HA-dCnA together with Myc-CnB, or Myc-CnB M118K. The protein expression was allowed for 24 h and then blocked by the addition of 50 lg/ml CHX. The protein levels of dCnA, Myc-CnB and Myc-CnB M118K were measured by Western blot analysis and quantized using Image J software. Protein dCnA alone shows a low stability, with a half-life less than 3 h. Coexpression of wild type and the mutant M118K significantly increases protein dCnA level and inhibits its degradation (Fig. 3C and D), suggesting that this single point mutation does not prevent the stabilizing of dCnA. 3.4. Mutant CnB M118K impairs the activities of NF-AT and p53 induced by dCnA in HeLa-s cells CN has been found to increase the activity of NF-AT, which is important for the activity of p53 in skin squamous cancer development [17]. We have measured the impact of this mutant on the activities of NF-AT and p53. CnB significantly increase the activities of NF-AT and p53 induced by dCnA. However, this effect is abolished in CnB M118K mutant (Fig. 4).
Fig. 4. The effects of CnB and CnB M118K on the activities of NF-AT and p53. (A, B) HeLa-s cells were transfected with reporter plasmid including NF-AT-luc, p53-luc, or Renilla-luc, together with various amount of plasmids encoding HA-dCnA, MycCnB or Myc-CnB M118K as indicated. Empty vector was used to balance the total amount plasmid in each treatment. Cells were collected after 24 h, and Firefly and Renilla signals were detected.
4. Discussion The essential role of CnB in the CN enzyme activity has been well established [1,3,19,20]. In this study, the protein levels of CnA and CnB in various cancer cell lines are correlated, and this is consistent with the close relationship in their functions. Coexpression of CnB does not increase the mRNA level of CnA but protects it from degradation (Fig. 3), which may explain why CnB can increase the phosphatase activity of CnA as well as why CnB can protect CnA against denaturation by urea published before [21,22]. Point mutation M118K and M118H are less able to bind to CnA, but still maintain the stability of CnA, suggesting that the
486
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
M118 of CnB is necessary for tight binding to CnA. Moreover, the weak binding of CnB M118K to CnA is responsible for stabilization of CnA. CnB M118K fails to increase NF-AT and p53 activities as wide-type CnB does, suggesting that the M118 of CnB is important for regulating the activity of CnA. To get high enzyme activity of CN, some authors transfected dCnA alone [9], while others transfected dCnA and CnB together or separately in their researches [18,23]. In this work, dCnA has a half-life less than 3 h. CnB increases both stability and enzyme activity of CnA, however, mutant M118K only increases its stability. Therefore, the expression level of dCnA is not equal to its enzyme activity, which mainly depends on the regulation of CnB. CN has been implicated in both transcription-dependent and independent apoptosis, with the former attributed to the dephosphorylation of NF-AT and subsequent trans-activation of apoptosis genes such as Fas ligand and p53 [17,24]. Dephosphorylation of BAD is involved in the latter case [18]. Until now, there have been uncertain and conflicting findings regarding the role of CN in apoptosis. Overexpression of activated CnA in cultured cardiomyocytes or in the hearts of transgenic mice shows profound protection from apoptotic stimuli [25], but high level CN activity predisposes neuronal cells to apoptosis [26]. Overexpression of dCnA alone provides protection through NF-AT activation, but overexpression of both dCnA and CnB can dephosphorylate ASK1 and enhance cardiomyocyte apoptosis. CnB is considered to be a feedback regulatory recruiting factor in this process [23]. According to our results above, we suggest the exact activity and stability of CN enzyme should also be considered. Decreased CN activity is associated with diseases such as Alzheimer’s disease (AD), and the decrease of activity is not accompanied by a decrease of CN protein expression [16]. Same phenomenon is displayed in this study. Mutant M118K does not change the expression level of CnA, but decreases the activities of NF-AT and p53 in HeLa-s cells, point mutation of CnB M118 may also occur in the diseases related with deduction of CN activity, which is useful for diagnosing and curing those diseases. In summary, this study not only explains how these CnB M118 mutants impair the activity of CN in cells, but also finds that the expression level of CnA is not equal to its activity, which mainly depends on the regulation of CnB. In addition, the mutation of CnB M118 may act as a marker in diagnosing and curing some diseases related to the reduced CN activity. Acknowledgments This work was partly supported by the National Natural Science Foundation of China, the International Cooperation Project and the National Important Novel Medicine Research Project. The authors thank Dr. Paulo Godoi (postdoctor in Sanford-Burnham Medical Research Institute) for his help in editing the language. References [1] C.B. Klee, H. Ren, X. Wang, Regulation of the calmodulin-stimulated protein phosphatase, calcineurin, Journal of Biological Chemistry 273 (1998) 13367– 13370. [2] J. Aramburu, A. Rao, C.B. Klee, Calcineurin: from structure to function, Current Topics in Cellular Regulation 36 (2000) 237–295.
[3] R. Sikkink, A. Haddy, S. MacKelvie, P. Mertz, R. Litwiller, F. Rusnak, Calcineurin subunit interactions: mapping the calcineurin B binding domain on calcineurin A, Biochemistry 34 (1995) 8348–8356. [4] C.S. Hemenway, J. Heitman, Calcineurin. Structure, function, and inhibition, Cell Biochemistry and Biophysics 30 (1999) 115–151. [5] M.T. Kennedy, H. Brockman, F. Rusnak, Contributions of myristoylation to calcineurin structure/function, Journal of Biological Chemistry 271 (1996) 26517–26521. [6] T. Muramatsu, R.L. Kincaid, Inhibition of NF-AT signal transduction events by a dominant-negative form of calcineurin, Biochemical and Biophysical Research Communications 218 (1996) 466–472. [7] F. Shibasaki, E. Kondo, T. Akagi, F. McKeon, Suppression of signaling through transcription factor NF-AT by interactions between calcineurin and Bcl-2, Nature 386 (1997) 728–731. [8] K. Stankunas, I.A. Graef, J.R. Neilson, S.H. Park, G.R. Crabtree, Signaling through calcium, calcineurin, and NF-AT in lymphocyte activation and development, Cold Spring Harbor Symposia on Quantitative Biology 64 (1999) 505–516. [9] J. Zhu, F. McKeon, NF-AT activation requires suppression of Crm1-dependent export by calcineurin, Nature 398 (1999) 256–260. [10] B. Feng, P.M. Stemmer, Interactions of calcineurin A, calcineurin B, and Ca2+, Biochemistry 38 (1999) 12481–12489. [11] S.A. Yang, C.B. Klee, Low-affinity Ca2+-binding sites of calcineurin B mediate conformational changes in calcineurin A, Biochemistry 39 (2000) 16147– 16154. [12] C.R. Kissinger, H.E. Parge, D.R. Knighton, C.T. Lewis, L.A. Pelletier, A. Tempczyk, V.J. Kalish, K.D. Tucker, R.E. Showalter, E.W. Moomaw, et al., Crystal structures of human calcineurin and the human FKBP12-FK506-calcineurin complex, Nature 378 (1995) 641–644. [13] L. Jin, S.C. Harrison, Crystal structure of human calcineurin complexed with cyclosporin A and human cyclophilin, Proceedings of the National Academy of Sciences of the United States of America 99 (2002) 13522–13526. [14] D. Milan, J. Griffith, M. Su, E.R. Price, F. McKeon, The latch region of calcineurin B is involved in both immunosuppressant-immunophilin complex docking and phosphatase activation, Cell 79 (1994) 437–447. [15] Q. Chen, W. Wu, J. Li, Q. Wei, The polarity of the amino acid residue 118 of calcineurin B is closely linked to calcineurin enzyme activity, IUBMB Life 62 (2010) 561–567. [16] Q. Lian, C.J. Ladner, D. Magnuson, J.M. Lee, Selective changes of calcineurin (protein phosphatase 2B) activity in Alzheimer’s disease cerebral cortex, Experimental Neurology 167 (2001) 158–165. [17] X. Wu, B.C. Nguyen, P. Dziunycz, S. Chang, Y. Brooks, K. Lefort, G.F. Hofbauer, G.P. Dotto, Opposing roles for calcineurin and ATF3 in squamous skin cancer, Nature 465 368-372. [18] H.G. Wang, N. Pathan, I.M. Ethell, S. Krajewski, Y. Yamaguchi, F. Shibasaki, F. McKeon, T. Bobo, T.F. Franke, J.C. Reed, Ca2+ induced apoptosis through calcineurin dephosphorylation of BAD, Science 284 (1999) 339–343. [19] C.B. Klee, G.F. Draetta, M.J. Hubbard, Calcineurin, Advances in Enzymology and Related Areas of Molecular Biology 61 (1988) 149–200. [20] R. Sugiura, S.O. Sio, H. Shuntoh, T. Kuno, Molecular genetic analysis of the calcineurin signaling pathways, Cellular and Molecular Life Sciences 58 (2001) 278–288. [21] A. Kita, R. Sugiura, H. Shoji, Y. He, L. Deng, Y. Lu, S.O. Sio, K. Takegawa, M. Sakaue, H. Shuntoh, T. Kuno, Loss of Apm1, the micro1 subunit of the clathrinassociated adaptor-protein-1 complex, causes distinct phenotypes and synthetic lethality with calcineurin deletion in fission yeast, Molecular Biology of the Cell 15 (2004) 2920–2931. [22] G. Jiang, Q. Wei, Function and structure of N-terminal and C-terminal domains of calcineurin B subunit, Biological Chemistry 384 (2003) 1299–1303. [23] Q. Liu, B.J. Wilkins, Y.J. Lee, H. Ichijo, J.D. Molkentin, Direct interaction and reciprocal regulation between ASK1 and calcineurin-NF-AT control cardiomyocyte death and growth, Molecular and Cellular Biology 26 (2006) 3785–3797. [24] S. Jayanthi, X. Deng, B. Ladenheim, M.T. McCoy, A. Cluster, N.S. Cai, J.L. Cadet, Calcineurin/NF-AT-induced up-regulation of the Fas ligand/Fas death pathway is involved in methamphetamine-induced neuronal apoptosis, Proceedings of the National Academy of Sciences of the United States of America 102 (2005) 868–873. [25] L.J. De Windt, H.W. Lim, T. Taigen, D. Wencker, G. Condorelli, G.W. Dorn 2nd, R.N. Kitsis, J.D. Molkentin, Calcineurin-mediated hypertrophy protects cardiomyocytes from apoptosis in vitro and in vivo: An apoptosisindependent model of dilated heart failure, Circulation Research 86 (2000) 255–263. [26] A. Asai, J. Qiu, Y. Narita, S. Chi, N. Saito, N. Shinoura, H. Hamada, Y. Kuchino, T. Kirino, High level calcineurin activity predisposes neuronal cells to apoptosis, Journal of Biological Chemistry 274 (1999) 34450–34458.
Contents lists available at SciVerse ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Mutation of calcineurin subunit B M118 influences the activities of NF-AT and p53, but not calcineurin expression level Jinbo Cheng, Wei Tang, Zhenyi Su, Qun Wei ⇑ Department of Biochemistry and Molecular Biology, Beijing Normal University, Beijing Key Laboratory, Beijing 100875, PR China
a r t i c l e
i n f o
Article history: Received 25 August 2011 Available online 2 September 2011 Keywords: Calcineurin subunit B Mutation NF-AT p53 Calcineurin level
a b s t r a c t Calcineurin (CN) is a Ca2+/calmodulin-dependent phosphatase, which consists of a catalytic A-subunit (CnA) and a regulatory B-subunit (CnB). Endogenous CnA and CnB have a strong corelationship in cancer cell lines. Through the introduction of CnB and its mutants in cells, we show that CnB does not increase the expression of CnA but protects it from degradation. CnB M118 is necessary for tight binding to CnA. Point mutations of CnB M118 also do not increase the expression of CnA but protect it from degradation. Furthermore, CnB M118K fails to enhance the activities of NF-AT and p53 induced by CnA in HeLa-s cells. Mutations in CnB M118 may prove to be a valuable marker in the diagnostics of some important illnesses such as Alzheimer’s disease. Crown Copyright Ó 2011 Published by Elsevier Inc. All rights reserved.
1. Introduction Calcineurin (CN), also known as proteins phosphatase 2B, is a Ca2+/calmodulin-dependent phosphatase and a principal mediator of cellular response triggered by intracellular Ca2+ signal [1–5]. The best studied function of CN is the activation and nuclear translocation of the transcriptional regulator, nuclear factor of activated T cells (NF-AT) [6–9]. The immunosuppressive drugs cyclosporin A (CsA) and FK506 can associate with CN and inhibit its dephosphorylation activity. CN consists of two subunits: a catalytic A-subunit (CnA) of 59KDa, and a regulatory B-subunit (CnB) of 19KDa. CnA has three regulatory domains at its C-terminus, consisting of a CnB-binding domain (BBH), a CaM-binding domain (CBD), and an autoinhibitory domain (AID) [3]. CnB has four Ca2+-binding sites: two high-affinity sites and two low-affinity sites. The two high-affinity sites are saturated by Ca2+ at all times, while binding to the two low-affinity sites is dependent on the Ca2+ concentration. When Ca2+ is bound to all four sites the conformation of CnB changes and the CaM-binding motif becomes exposed. This conformational change is necessary for enzyme activation [10,11]. The CN heterodimer is stabilized by a large, hydrophobic interface between CnB and the CnB-binding domain of CnA [12]. A loop of CnB that contains residues 118–125 is an important part of the primary interface in the CyP/CsA/CN complex and a critical element in the corresponding ternary complex with FKBP12 and FK506 [13]. Substitutions in this loop confer varying degrees of
⇑ Corresponding author. Fax: +86 010 58807365. E-mail address: [email protected] (Q. Wei).
resistance to CsA and FK506 [14]. Furthermore, this region is hypothesized to function in the CnB-mediated activation of CnA catalysis [14]. However, the details of how this region regulates CnA are not well defined. Our previous work shows that point mutation of CnB M118 is closely linked to CN activity in vitro, but the mechanism is not clear [15]. It is unknown how the mutant CnB M118 affects the CN activity in vivo but it may involve a change in the interaction of CnA and CnB or to the stability of CnA. Lowering of CN activity may play a role in the paired-helical filament formation and/or stabilization, but it is not accompanied by the decreases in the expression level of CN and CN regulatory proteins (including cyclophilin A and FKBP12) [16]. As CnB is the only regulatory subunit of CnA, it is unknown whether this mutation affects the expression level and stability of CnA in cells. CN activates NF-AT activity, which is important for p53 activity in skin squamous cancer development [17]. Whether the point mutation in CnB M118 will affect the activities of NF-AT and p53 in HeLa-s cells remains unknown. In this work, through the introduction of CnB and its mutants in cells, we investigated the impact of point mutations M118K and M118H on the expression, stability, and interaction of CnA as well as the activities of NF-AT and p53.
2. Materials and methods 2.1. Materials Anti-Myc and anti-Flag antibodies were purchased from Sigma (USA). Antibody against HA was from Roche Applied Science (USA). Antibody against Calcineurin was purchased from BD
0006-291X/$ - see front matter Crown Copyright Ó 2011 Published by Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.08.126
482
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
Pharmingen (USA). Anti-Calcineurin B was purchased from R&D Systems (USA), and anti-b-actin was from Santa Cruz Biotechnology (USA).
2.2. Construction of vectors The expression vectors PcDNA3-CnB, HA-dCnA (N-terminal residues: ATGTAC CCTTACGATGTACCGGATTACGCACTCGACGCCGCCC CGGAGCCGGCCCGGGCTGCACCGCCCCCACCCCCGCCC; C-terminal residues: GAAGACCAGTTT GATGTAGGTTCAGCTGCAGCCCGGAAAG AAATCATAAGAAACTGA), NF-AT-luc, p53-luc and pRL-null-Renilla-luc were in our collection and we constructed the Myc-CnB, Flag-CnB, Myc-CnB M118K and Myc-CnB M118H vectors. We used the two-round PCR method to construct the amino acid substitution mutation for M118K and M118H, and BamHI and XhoI restriction sites were introduced at the 50 - and 30 – ends of the primers, respectively. The PCR products were sub-cloned into Myc-tagged PcDNA3 vectors using these restriction sites. DNA was sequenced by the dideoxynucleotide method.
2.3. Cell culture and conditions HEK293T cells and HeLa-s cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum, 5 lM L-glutamine, and penicillin streptomycin. All cells were grown at 37 °C with 5% CO2.
2.4. Co-immunoprecipitation and Western analysis HEK293T cells were co-transfected with the indicated plasmid DNAs using Lipofectamine™ 2000. The cell was collected after 24 h and lysed in IP buffer containing 0.5% NP-40, 150 mM NaCl, 50 mM Tris, PH 8, 50 mM NaF, 2 mM EDTA, plus a protease inhibitor mixture (Roche Applied Science). Equal amounts of cell extract were mixed with anti-Myc or anti-Flag protein G Sepharose (GE Healthcare Life, 1ug antibody and 25 ll protein G Sepharose) and incubated overnight. The immunoprecipitates were washed four times in lysis buffer and eluted by boiling in Laemmli sample buffer (Bio-Rad, USA). Samples were fraction-
Fig. 1. The expression levels of CnA and CnB in different cancer cell lines. (A) The expression levels of CnA (61KD) and CnB (19KD) were detected in 13 different cancer cell lines (1. 293T, 2. HeLa, 3. HeLa-s, 4. PPC1, 5. MCF-7, 6. THP-1, 7. U937, 8. P3, 9. RS11846, 10. RS4,11, 11. HCT116, 12. HT29, 13. Jurkat). 13 kinds cancer cell lines listed above were cultured in DMEM, RPMI 1640, or Mccoy’s 5A Medium (Modified). Cells were collected and lysed in RIPA buffer, then analyzed by SDS–PAGE/immunoblotting (WB) using anti-CnA, anti-CnB and anti-b-actin antibodies as indicated. (B) The expression levels of CnA and CnB were quantized using Image J software and normalized by b-actin levels. Values represent mean ± SD. The relationship between CnA and CnB was analyzed by SAS software. ‘‘P < 0.05’’ means significant relationship between those two groups.
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
483
Fig. 2. Amino acid CnB M118 is necessary for CnB tight interacting with subunit A. (A) For co-immunoprecipitation experiments, HEK293T cells were transfected with 1ug HA-dCnA together with 1ug Flag vector or 1ug each of Flag-tagged PcDNA3 plasmids encoding CnB, PP2ABa and PP2ABd using 4 ll Lipofectamine™ 2000 (Ratio: DNA/ Lipofectamine™ 2000 = 1/2). Cells were collected and lysed in IP buffer after 24 h, and lysates were immunoprecipitated with anti-Flag antibody. The precipitates were collected, fractionated on SDS–PAGE and immunoblotted (WB) with anti-Flag and anti-HA antibodies as indicated. The bands with same Mr. as PP2ABa and PP2ABd are heavy chain of IgG. (B) HEK293T cells plated in 6-well plate were transfected various amount of HA-dCnA Flag-tagged CnB, PP2ABa or PP2ABd, as indicated. PcDNA3 empty vector was added so that there was the same amount of total DNA in each transfection mixture. CnA protein levels were quantized using Image J software. (C) HEK293T cells were transfected with various amount of HA-dCnA and PcDNA3-CnB as indicated. Cells were collected and lysed in RIPA buffer after 24 h, and lysates were immunoprecipitated with anti-HA and anti-CnB antibodies. The protein levels of CnB were quantized using Image J software. (D) HEK293T cells were transfected with 1ug HA-dCnA together with 1ug each of Myc-tagged plasmids encoding CnB, CnB M118K and CnB M118H. The details of Co-IP were same as described above.
ated by SDS–PAGE and transferred to nitrocellulose. Immunoblots were probed with the indicated primary antibodies and visualized by ECL (Invitrogen). 2.5. Luciferase reporter gene assay HeLa-s cells plated in 96-well were transfected with various plasmids encoding dCnA, CnB, CnB M118K, NF-AT-luc, p53-luc, or pRL-null-Renilla-luc. PcDNA3 empty vector was added so that there was the same amount of total DNA in each transfection
mixture. After 24 h luciferase activity was measured using a Dual-Luciferase Reporter Kit (Promega). Transfection efficiency was normalized by the expression of Renilla luciferase. Luciferase units are presented as relative luciferase activity, which represents the ‘fold induction’ of luciferase activity. 2.6. Quantitative real-time PCR analysis Total RNA was isolated from cells with a purified RNA extracted kit (BioTeke, China). Quantitative real-time PCR was performed to
484
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
Fig. 3. The effects of CnB and CnB M118K on the expression level and the stability of CnA. (A) HEK293T cells were transfected with various amounts of plasmids encoding HAdCnA, PcDNA3-CnB, Myc-tagged CnB M118K or CnB M118H as indicated. Cells were collected and lysed in RIPA buffer after 24 h. SDS–PAGE/immunoblotting (WB) was followed using anti-HA and anti-CnB antibodies as showing. (B) HEK293T cells were transfected with 1ug HA-dCnA together with 1ug each of Myc-tagged plasmids encoding CnB or CnB M118K. Cells were collected after 24 h, and total RNA was isolated. The mRNA levels of CnA in different groups were detected by real-time PCR using b-actin as an endogenous control gene. (C) CnA stability was measured by cycoheximide (CHX)-based protein chase experiment. To measure CnA stability, plasmid HA-dCnA, Myc-CnB or Myc-CnB M118K was transfected into HEK293T cells as showing. 50 lg/ml CHX was added into the medium 24 h after transfection. Cells were harvested at various time points (0, 0.5, 1, 3, 6, 24 h) after the addition of CHX and lysed in RIPA buffer. SDS–PAGE/immunoblotting (WB) was followed using anti-HA and anti-Myc, and anti-b-actin as showing. (D) CnA protein levels were quantized using Image J software and normalized by b-actin levels.
detect transcription level of CnA using b-actin as an endogenous control gene. Threshold cycle (Ct) values from triplicate PCRs were normalized against the average Ct values for b-actin using the formula: 2DDCt.
2.7. Statistical analysis The results of all quantitative experiments are reported as Mean ± SD of three independent experiments. Statistical differ-
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
485
ences between groups were determined using SAS software. P < 0.05 was considered significant. 3. Results 3.1. The expression levels of CnA and CnB in different cancer cell lines To assess protein expression level, endogenous CnA and CnB in various cancer cell lines were detected by immunoblotting. Lysates were normalized for total protein concentration before analysis, and b-actin was used as the control. The relative expression levels of CnA and CnB vary widely among tumor lines tested, with higher levels in PPC1, MCF-7, HCT116 and HT29 cell lines (Fig. 1A). The relative expression levels of CnA and CnB have a statistically significant relationship (R2 = 0.891, P < 0.01) (Fig. 1B). 3.2. Mutants M118K and M118H influence the binding of CnB to CnA To test the specific role of CnB for CnA, another two regulatory subunits of PP2A, PP2ABa and PP2ABd, were used as the control. Co-immunoprecipitation experiments reveal that CnB binds to dCnA, a constitutively active form of CN that lacks the AID domain [7,18]. PP2ABa and PP2ABd fail to bind to dCnA (Fig. 2A). Furthermore, coexpression of CnB increases the expression level of dCnA in a dose dependent manner. In contrast, PP2ABa and PP2ABd do not affect the expression level of dCnA (Fig. 2B). Overexpression of HA-dCnA results in higher levels of CnB (Fig. 2C), suggesting that CnB and CnA bind to and stabilize each other in cells. Mutants M118K and M118H bind to dCnA weakly compared with wild type-CnB (Fig. 2D), suggesting that the residue M118 is necessary for the tight binding of CnB to CnA. 3.3. Mutant M118K does not change the mRNA level and the stability of CnA Overexpression of mutants M118K and M118H do enhance the expression level of dCnA (Fig. 3A). We still do not know the increased expression level of CnA is the result of increased transcription at the mRNA level or protection against proteolysis. To check the mRNA levels of CnA, HEK293T cells were transfected with HAdCnA together with Myc-CnB, or Myc-CnB M118K. Cells were collected and total RNA was isolated after 24 h. From real-time PCR assay, we found coexpression of Myc-CnB or Myc-CnB M118K did not change the mRNA level of CnA (Fig. 3B). To determine if the mutant of CnB M118K affects the stability of CnA, HEK293T cells were transfected with HA-dCnA together with Myc-CnB, or Myc-CnB M118K. The protein expression was allowed for 24 h and then blocked by the addition of 50 lg/ml CHX. The protein levels of dCnA, Myc-CnB and Myc-CnB M118K were measured by Western blot analysis and quantized using Image J software. Protein dCnA alone shows a low stability, with a half-life less than 3 h. Coexpression of wild type and the mutant M118K significantly increases protein dCnA level and inhibits its degradation (Fig. 3C and D), suggesting that this single point mutation does not prevent the stabilizing of dCnA. 3.4. Mutant CnB M118K impairs the activities of NF-AT and p53 induced by dCnA in HeLa-s cells CN has been found to increase the activity of NF-AT, which is important for the activity of p53 in skin squamous cancer development [17]. We have measured the impact of this mutant on the activities of NF-AT and p53. CnB significantly increase the activities of NF-AT and p53 induced by dCnA. However, this effect is abolished in CnB M118K mutant (Fig. 4).
Fig. 4. The effects of CnB and CnB M118K on the activities of NF-AT and p53. (A, B) HeLa-s cells were transfected with reporter plasmid including NF-AT-luc, p53-luc, or Renilla-luc, together with various amount of plasmids encoding HA-dCnA, MycCnB or Myc-CnB M118K as indicated. Empty vector was used to balance the total amount plasmid in each treatment. Cells were collected after 24 h, and Firefly and Renilla signals were detected.
4. Discussion The essential role of CnB in the CN enzyme activity has been well established [1,3,19,20]. In this study, the protein levels of CnA and CnB in various cancer cell lines are correlated, and this is consistent with the close relationship in their functions. Coexpression of CnB does not increase the mRNA level of CnA but protects it from degradation (Fig. 3), which may explain why CnB can increase the phosphatase activity of CnA as well as why CnB can protect CnA against denaturation by urea published before [21,22]. Point mutation M118K and M118H are less able to bind to CnA, but still maintain the stability of CnA, suggesting that the
486
J. Cheng et al. / Biochemical and Biophysical Research Communications 413 (2011) 481–486
M118 of CnB is necessary for tight binding to CnA. Moreover, the weak binding of CnB M118K to CnA is responsible for stabilization of CnA. CnB M118K fails to increase NF-AT and p53 activities as wide-type CnB does, suggesting that the M118 of CnB is important for regulating the activity of CnA. To get high enzyme activity of CN, some authors transfected dCnA alone [9], while others transfected dCnA and CnB together or separately in their researches [18,23]. In this work, dCnA has a half-life less than 3 h. CnB increases both stability and enzyme activity of CnA, however, mutant M118K only increases its stability. Therefore, the expression level of dCnA is not equal to its enzyme activity, which mainly depends on the regulation of CnB. CN has been implicated in both transcription-dependent and independent apoptosis, with the former attributed to the dephosphorylation of NF-AT and subsequent trans-activation of apoptosis genes such as Fas ligand and p53 [17,24]. Dephosphorylation of BAD is involved in the latter case [18]. Until now, there have been uncertain and conflicting findings regarding the role of CN in apoptosis. Overexpression of activated CnA in cultured cardiomyocytes or in the hearts of transgenic mice shows profound protection from apoptotic stimuli [25], but high level CN activity predisposes neuronal cells to apoptosis [26]. Overexpression of dCnA alone provides protection through NF-AT activation, but overexpression of both dCnA and CnB can dephosphorylate ASK1 and enhance cardiomyocyte apoptosis. CnB is considered to be a feedback regulatory recruiting factor in this process [23]. According to our results above, we suggest the exact activity and stability of CN enzyme should also be considered. Decreased CN activity is associated with diseases such as Alzheimer’s disease (AD), and the decrease of activity is not accompanied by a decrease of CN protein expression [16]. Same phenomenon is displayed in this study. Mutant M118K does not change the expression level of CnA, but decreases the activities of NF-AT and p53 in HeLa-s cells, point mutation of CnB M118 may also occur in the diseases related with deduction of CN activity, which is useful for diagnosing and curing those diseases. In summary, this study not only explains how these CnB M118 mutants impair the activity of CN in cells, but also finds that the expression level of CnA is not equal to its activity, which mainly depends on the regulation of CnB. In addition, the mutation of CnB M118 may act as a marker in diagnosing and curing some diseases related to the reduced CN activity. Acknowledgments This work was partly supported by the National Natural Science Foundation of China, the International Cooperation Project and the National Important Novel Medicine Research Project. The authors thank Dr. Paulo Godoi (postdoctor in Sanford-Burnham Medical Research Institute) for his help in editing the language. References [1] C.B. Klee, H. Ren, X. Wang, Regulation of the calmodulin-stimulated protein phosphatase, calcineurin, Journal of Biological Chemistry 273 (1998) 13367– 13370. [2] J. Aramburu, A. Rao, C.B. Klee, Calcineurin: from structure to function, Current Topics in Cellular Regulation 36 (2000) 237–295.
[3] R. Sikkink, A. Haddy, S. MacKelvie, P. Mertz, R. Litwiller, F. Rusnak, Calcineurin subunit interactions: mapping the calcineurin B binding domain on calcineurin A, Biochemistry 34 (1995) 8348–8356. [4] C.S. Hemenway, J. Heitman, Calcineurin. Structure, function, and inhibition, Cell Biochemistry and Biophysics 30 (1999) 115–151. [5] M.T. Kennedy, H. Brockman, F. Rusnak, Contributions of myristoylation to calcineurin structure/function, Journal of Biological Chemistry 271 (1996) 26517–26521. [6] T. Muramatsu, R.L. Kincaid, Inhibition of NF-AT signal transduction events by a dominant-negative form of calcineurin, Biochemical and Biophysical Research Communications 218 (1996) 466–472. [7] F. Shibasaki, E. Kondo, T. Akagi, F. McKeon, Suppression of signaling through transcription factor NF-AT by interactions between calcineurin and Bcl-2, Nature 386 (1997) 728–731. [8] K. Stankunas, I.A. Graef, J.R. Neilson, S.H. Park, G.R. Crabtree, Signaling through calcium, calcineurin, and NF-AT in lymphocyte activation and development, Cold Spring Harbor Symposia on Quantitative Biology 64 (1999) 505–516. [9] J. Zhu, F. McKeon, NF-AT activation requires suppression of Crm1-dependent export by calcineurin, Nature 398 (1999) 256–260. [10] B. Feng, P.M. Stemmer, Interactions of calcineurin A, calcineurin B, and Ca2+, Biochemistry 38 (1999) 12481–12489. [11] S.A. Yang, C.B. Klee, Low-affinity Ca2+-binding sites of calcineurin B mediate conformational changes in calcineurin A, Biochemistry 39 (2000) 16147– 16154. [12] C.R. Kissinger, H.E. Parge, D.R. Knighton, C.T. Lewis, L.A. Pelletier, A. Tempczyk, V.J. Kalish, K.D. Tucker, R.E. Showalter, E.W. Moomaw, et al., Crystal structures of human calcineurin and the human FKBP12-FK506-calcineurin complex, Nature 378 (1995) 641–644. [13] L. Jin, S.C. Harrison, Crystal structure of human calcineurin complexed with cyclosporin A and human cyclophilin, Proceedings of the National Academy of Sciences of the United States of America 99 (2002) 13522–13526. [14] D. Milan, J. Griffith, M. Su, E.R. Price, F. McKeon, The latch region of calcineurin B is involved in both immunosuppressant-immunophilin complex docking and phosphatase activation, Cell 79 (1994) 437–447. [15] Q. Chen, W. Wu, J. Li, Q. Wei, The polarity of the amino acid residue 118 of calcineurin B is closely linked to calcineurin enzyme activity, IUBMB Life 62 (2010) 561–567. [16] Q. Lian, C.J. Ladner, D. Magnuson, J.M. Lee, Selective changes of calcineurin (protein phosphatase 2B) activity in Alzheimer’s disease cerebral cortex, Experimental Neurology 167 (2001) 158–165. [17] X. Wu, B.C. Nguyen, P. Dziunycz, S. Chang, Y. Brooks, K. Lefort, G.F. Hofbauer, G.P. Dotto, Opposing roles for calcineurin and ATF3 in squamous skin cancer, Nature 465 368-372. [18] H.G. Wang, N. Pathan, I.M. Ethell, S. Krajewski, Y. Yamaguchi, F. Shibasaki, F. McKeon, T. Bobo, T.F. Franke, J.C. Reed, Ca2+ induced apoptosis through calcineurin dephosphorylation of BAD, Science 284 (1999) 339–343. [19] C.B. Klee, G.F. Draetta, M.J. Hubbard, Calcineurin, Advances in Enzymology and Related Areas of Molecular Biology 61 (1988) 149–200. [20] R. Sugiura, S.O. Sio, H. Shuntoh, T. Kuno, Molecular genetic analysis of the calcineurin signaling pathways, Cellular and Molecular Life Sciences 58 (2001) 278–288. [21] A. Kita, R. Sugiura, H. Shoji, Y. He, L. Deng, Y. Lu, S.O. Sio, K. Takegawa, M. Sakaue, H. Shuntoh, T. Kuno, Loss of Apm1, the micro1 subunit of the clathrinassociated adaptor-protein-1 complex, causes distinct phenotypes and synthetic lethality with calcineurin deletion in fission yeast, Molecular Biology of the Cell 15 (2004) 2920–2931. [22] G. Jiang, Q. Wei, Function and structure of N-terminal and C-terminal domains of calcineurin B subunit, Biological Chemistry 384 (2003) 1299–1303. [23] Q. Liu, B.J. Wilkins, Y.J. Lee, H. Ichijo, J.D. Molkentin, Direct interaction and reciprocal regulation between ASK1 and calcineurin-NF-AT control cardiomyocyte death and growth, Molecular and Cellular Biology 26 (2006) 3785–3797. [24] S. Jayanthi, X. Deng, B. Ladenheim, M.T. McCoy, A. Cluster, N.S. Cai, J.L. Cadet, Calcineurin/NF-AT-induced up-regulation of the Fas ligand/Fas death pathway is involved in methamphetamine-induced neuronal apoptosis, Proceedings of the National Academy of Sciences of the United States of America 102 (2005) 868–873. [25] L.J. De Windt, H.W. Lim, T. Taigen, D. Wencker, G. Condorelli, G.W. Dorn 2nd, R.N. Kitsis, J.D. Molkentin, Calcineurin-mediated hypertrophy protects cardiomyocytes from apoptosis in vitro and in vivo: An apoptosisindependent model of dilated heart failure, Circulation Research 86 (2000) 255–263. [26] A. Asai, J. Qiu, Y. Narita, S. Chi, N. Saito, N. Shinoura, H. Hamada, Y. Kuchino, T. Kirino, High level calcineurin activity predisposes neuronal cells to apoptosis, Journal of Biological Chemistry 274 (1999) 34450–34458.