- Email: [email protected]
Mutation of von Hippel–Lindau tumor suppressor gene in a sporadic endolymphatic sac tumor
HUMAN PATHOLOGY
Volume 32, No. 11 (November 2001)
MUTATION OF VON HIPPEL–LINDAU TUMOR SUPPRESSOR GENE IN A SPORADIC ENDOLYMPHATIC SAC TUMOR SHUJI HAMAZAKI, MD, MINORU YOSHIDA, MD, MASAHIRO YAO, MD, YOJI NAGASHIMA, MD, KOHJI TAGUCHI, MD, HIROYUKI NAKASHIMA, MD, AND SHIGERU OKADA, MD Endolymphatic sac tumor (ELST) is a low-grade adenocarcinoma of the temporal bone that is presumed to originate from the endolymphatic system. Although ELSTs are extremely rare in the general population, a significant number of studies have documented the occurrence of ELST among patients with von Hippel-Lindau (VHL) disease. Because of the rarity of the tumor, however, few cases of ELST have been analyzed for mutations of the VHL tumor suppressor gene. In this study, we reported a Japanese male patient with sporadic ELST, along with a molecular genetic analysis of the VHL gene. The light microscopic and immunohistochemical features and clinical presentations were typical of ELST. Sequencing studies of the tumor DNA disclosed a G to T substitution of nucleotide 564, which
resulted in an amino acid substitution (Trp to Cys). This is the first report of the VHL gene mutation in a sporadic Japanese case of ELST. HUM PATHOL 32:1272-1276. Copyright © 2001 by W.B. Saunders Company Key words: endolymphatic sac tumor, temporal bone, von HippelLindau disease, VHL tumor suppressor gene. Abbreviations: ELST, endolymphatic sac tumor; VHL, von Hippel-Lindau; HE, hematoxytin and eosin; EMA, epithelial membrane antigen; GFAP, glial fibrillary acidic protein; PCR, polymerase chain reaction; CT, computed tomography; PB-WBC, peripheral bloodwhite blood cells; MRI, magnetic resonance imaging; PAS, periodic acid-Schiff; NSE, neuron specific enolase.
Endolymphatic sac tumor (ELST) is a primary low-grade adenocarcinoma of the temporal bone that is presumed to originate from the vestibular endolymphatic system.1-4 Histologicaly, ELST is characterized by the proliferation of cuboidal cells forming a papillotubular pattern and occasional colloid-filled cysts, reminiscent of thyroid papillary carcinoma. Although ELST is extremely rare in the general population, a significant number of ELSTs have been reported in the setting of von Hippel-Lindau (VHL) disease.2,5-8 VHL disease is a genetic abnormality inherited as an
autosomal dominant trait and predisposes the patients to multiple hemangioblastomas of the central nervous system, along with tumors and cysts of various organs such as clear cell renal carcinoma, pheochromocytoma, and pancreatic cystadenoma.9 A gene responsible for VHL disease had been mapped on the short arm of chromosome 310 and has subsequently been identified.11 Genetic analysis of the tumors derived from VHL patients supported the tumor suppressor gene theory of Knudson that an inherited mutation in one allele, followed by somatic loss of the opposite allele is essential for the tumor development.12 In the case of sporadic tumors, tumorigenesis is associated with somatic alteration of both alleles of the tumor suppressor genes. Although somatic mutations of the VHL gene have been identified in sporadic renal cell carcinoma,13,14 hemangioblastoma15,16 and pancreatic tumor,17 other sporadic malignancies rarely showed mutations of VHL gene. Thus, somatic alteration of the VHL tumor suppressor gene is considered to be highly specific for the sporadic counterparts of tumors found in VHL disease. Association of ELSTs and VHL disease was first confirmed by a large epidemiologic study showing an increased prevalence of ELST among patients with VHL disease.18 Subsequently, a germline mutation of the VHL gene and somatic
From the Department of Pathology, Okayama University Hospital, Okayama; the Department of Urology and Pathology, Yokohama City University School of Medicine, Yokohama; the Department of Pathology, Okayama Rosai Hospital, Okayama; and the Department of Neurosurgery and First Department of Pathology, Okayama University Medical School, Okayama, Japan. Address correspondence and reprint requests to Shuji Hamazaki, MD, Department of Pathology, Okayama University Hospital, 2-5-1 Shikata, Okayama 700-8558, Japan. Copyright © 2001 by W.B. Saunders Company 0046-8177/01/3211-0020$35.00/0 doi:10.1053/hupa.2001.28961
1272
CASE STUDIES
TABLE 1. The Immunohistochemical Antibodies Used Antibody Cytokeratin (AE1/AE3) EMA (E29) Vimentin (V9) GFAP (polyclonal, rabbit) Chromogranin A (DAK-A3) Synaptophysin (polyclonal, rabbit) NSE (BBS/NC/VI-H14) S-100 (polyclonal, rabbit) Thyroglobulin (polyclonal, rabbit)
Source
Concentration
Lipshaw/Immunon (Pittsburgh, PA) DAKO (Carpinteria, CA) DAKO DAKO DAKO DAKO
1:50
DAKO DAKO DAKO
1:50 1:50 1:500 1:50 1:500 1:50 1:500 1:500
Polymerase Chain Reaction and DNA Sequencing Analysis of the VHL Gene The procedures for polymerase chain reaction (PCR) amplification and direct sequencing of the VHL coding region were similar to those of our previous study.22 The primer pairs used for amplification were previously described (Table 2).14,22 All nucleotides are numbered according to the human VHL complementary DNA (cDNA) sequence originally described by Latif et al,11 in which codon 1 is located at nucleotide 214, the location of the first methionine.23 RESULTS Clinical Presentation
loss of the wild-type allele were shown in ELSTs from VHL patients,19,20 and somatic VHL gene mutations were shown in the sporadic ELSTs.21 Because of the rarity of ELSTs, however, only a small number of ELSTs have been subjected to molecular genetic analysis. We recently encountered a case of ELST in a Japanese man, who previously showed no other symptoms of VHL disease. Herein, we describe the clinical and pathologic features of the patient, along with the findings of molecular genetic analysis on the VHL gene. MATERIALS AND METHODS Light Microscopy Tissues for light microscopy were fixed in 10% formalin and paraffin-embedded in a standard manner. Routine sections were stained with hematoxylin and eosin (HE) and periodic acid-Schiff (PAS) stains. Sections were immunostained with antibodies against cytokeratin, epithelial membrane antigen (EMA), vimentin, glial fibrillary acidic protein (GFAP), neuron specific enolase (NSE), S-100, synaptophysin, chromogranin A, and thyroglobulin (Table 1). Antigen retrieval was performed by boiling in citrate buffer (10 mmol/L, pH 6.0), and sections were visualized with a streptavidin-biotin immunoperoxidase reagent kit (DAKO, Carpinteria, CA). DNA Extraction Genomic DNAs were extracted from the white blood cells in the peripheral blood (PB-WBC) of the patient by a standard procedure. For DNA extraction from the formalinfixed, paraffin-embedded tissue samples, tumor and nonneoplastic tissues were dissected from HE-stained sections under light microscopic visualization,16 and DNAs were extracted with a DNA extraction kit (DEXPAT, Takara Biomedicals, Osaka, Japan).
A 34-year-old Japanese man presented with a 3-year history of a progressive, right-sided hearing impairment, tinnitus, and vertigo. His past history and family history were uneventful. Computed tomography (CT) showed a mass lesion in the right cerebellopontine angle with destruction of the petrous bone (Fig 1). The tumor contained areas of high attenuation that corresponded to calcification. On a magnetic resonance imaging (MRI) scan, the tumor showed heterogeneous signal intensity on T1-weighted images and homogenous high signal intensity on T2-weighted images. Arteriography showed a hypervascular tumor supplied by branches of the ascending pharyngeal artery. No radiographic abnormality was noted in the middle ear, mastoid air cells, or auditory canal. After endoarterial embolization, the patient underwent craniotomy for a complete removal of the tumor. The tumor was destructive of the posterior part of the petrous bone and extended to the posterior cranial fossa. The tumor was attached to the overlying dura, and showed focal hemorrhage and cystic degeneration. Recovery after the operation was uneventful. To date, the patient remains well, with no evidence of recurrent tumor. Histopathology and Immunohistochemistry The tumor consisted of fragments of gray-red soft tissue and white firm tissue. Microscopically, the tumor showed proliferation of cuboidal tumor cells forming papillotubular structures and occasional cystic spaces (Fig 2A, B). Neoplastic cells with flattened or tall columnar appearance were also seen. Cystic spaces contained pale eosinophilic material, reminiscent of thyroid colloid. The neoplastic cells had fairly uniform round nuclei and abundant clear to eosinophilic cytoplasm (Fig 2B). Only rare mitotic figures were observed. Although the stroma was generally composed of thin fibrovascular tissue, focal fibrotic areas with hemorrhage, hemosiderin deposits, and mononuclear cell infiltration were also observed. Cytoplasm of the neoplastic cells showed positive staining for PAS, and the staining was eliminated by diastase digestion. The content of cystic spaces showed positive reactions for PAS staining.
TABLE 2. Primer Pairs Used for PCR Amplification Set
Exon
Position
Sequence of Primers
Reference
1
1 2
3
3
5⬘TGGTCTGGATCGCGGAGGGAA3⬘ 5⬘GACCGTGCTATCGTCCCTGC3⬘ 5⬘GTGGCTCTTTAACAACTTTGC3⬘ 5⬘CCTGTACTTACCACAACAACCTTATC3⬘ 5⬘TTCCTTGTACTGAGACCCTAG3⬘ 5⬘AGCTGAGATGAACAGTGTAAGT3⬘
22
2
Upstream Downstream Upstream Downstream Upstream Downstream
1273
14 14
HUMAN PATHOLOGY
Volume 32, No. 11 (November 2001)
FIGURE 1. (A) An axial CT scan showing a tumor of the left cerebellopontine angle with destruction of the posterior part of the petrous bone. (B) The axial CT scan obtained after administration of the contrast material.
Immunohistochemically, most of the tumor cells showed strong positive staining for cytokeratin (Fig 2C), EMA, and vimentin. Some of the tumor cells showed positive immunostaining for GFAP (Fig 2D), NSE, synaptophysin, and S-100. Stains for chromogranin A and thyroglobulin were negative. VHL Gene Analysis We examined ELST for the somatic VHL mutation by direct sequencing of the coding region. Sequencing studies showed that ELST had a G to T transversion at nucleotide 564, and it made an amino acid change (Trp to Cys) at codon 117 (Figs 3 and 4). The genomic DNA of PB-WBC and that of non-neoplastic tissue showed no mutation. We also attempted to determine any allelic imbalance of the gene by using 2 microsatellite markers (D3S1038 and D3S1317) flanking the
VHL gene.24 However, the DNAs failed to be well amplified probably because of degradation during formalin fixation. DISCUSSION Primary adenomatous tumors of the temporal bone are rare and had not been well defined until the end of the 1980s. Although the majority of adenomatous temporal bone tumors are benign resectable lesions and arise from the mucosa of the middle ear, the infrequent occurrence of a locally destructive tumor has been reported.25-28 In 1988, Gaffey et al noted the association of a biologically aggressive growth with papillary histology, and proposed the term aggressive papillary middle ear tumor for this invasive subtype of the adenomatous temporal bone tumor.29 Benecke et al subsequently confirmed that the middle ear tumors with a non-papillary growth pat-
FIGURE 2. (A) Cuboidal tumor cells form papillotubular and cystic structures. (Hematoxylin and eosin, original magnification ⫻80.) (B) The tumor cells have a uniform round nuclei and abundant clear cytoplasm. Microcysts contain eosinophilic colloid. (Hematoxylin and eosin, original magnification ⫻160.) (C) Tumor cells show a positive immunohistochemical reaction for cytokeratin. (Original magnification ⫻160.) (D) Most tumor cells show positive immunohistochemical reaction for GFAP (Original magnification ⫻160.)
1274
CASE STUDIES
FIGURE 3. Sequencing studies of the VHL gene showed that the tumor genomic DNA had a G to T transversion at nucleotide 564 (right, arrow) that led to an amino acid change (Trp to Cys) at codon 117, whereas the genomic DNA of the corresponding non-neoplastic tissue showed no mutation (left).
tern were confined to the middle ear and mastoid, whereas those tumors with a papillary pattern were more aggressive and associated with significant bone and dural involvement.30 In 1989, Heffner proposed that the papillary tumors of the temporal bone originated from the epithelium of the endolymphatic sac rather than the middle ear mucosa.1 He showed histologic, ultrastructural, and immunohistochemical similarities between the papillary temporal bone tumor and normal endolymphatic sac epithelium.1 Radiographic analysis of the tumors also disclosed that the tumors were often centered at the posterior-medial face of the petrous bone, ie, the region of endolymphatic sac and aquaduct.1,2,3 Furthermore, few papillary tumors arising within the confines of the endolymphatic system were identified.2,32 Heffner’s view has been increasingly accepted in recent studies, and ELST is considered a distinct clinicopathologic entity.2-4,33 Typical early manifestations of the ELST are sensorineural hearing loss, tinnitus, and vertigo.1-4,18 The tumor has a slight female predominance, and the age at the clinical presentation ranges from the first to the eighth decade, with a median age in the fourth decade. Smaller lesions of ELST are centered at the posterior part of the petrous bone and grow into the dura of the cerebellopontine angle.1-4,18,30 ELST is locally invasive and destructive of bony structures, but the development of metastasis has not been reported. Microscopically, ELST is characterized by papillotubular and cystic structures composed of cuboidal to low-columnar cells.1-4,28 The tumor cells have relatively uniform round nuclei with clear to pale eosinophilic cytoplasm. Pleomorphism of the tumor cells is minimal, and mitosis and necrosis are rarely encountered. ELSTs consistently show positive immu-
nohistochemical reactions for cytokeratin, EMA, and vimentin.1,3-8,19,29,32,33 The tumor cells may exhibit variable staining for GFAP, NSE, and S-100, whereas expression of chromogranin A, synaptophysin, or neurofilament has never been observed. The light microscopic and immunohistochemical features of the current case (in addition to the clinical presentations) were typical of ELST, and the patient was diagnosed as having a sporadic tumor because of the lack of other manifestations of VHL disease and family history. Recently, an increasing number of studies has documented the occurrence of ELST in patients with VHL disease.2,5-8 Studies among the VHL population confirmed that 10.6% of patients with VHL show radiographic evidence of ELST, and 65% of patients with VHL or suspected relatives disclose the abnormalities of auditory function.18 Development of the bilateral neoplasm in VHL disease also provides supporting evidence that the genetic defect of VHL has relevance to ELST.5,8,18 Because of the rarity of ELST, however, few cases of ELST have been investigated for alterations in the VHL gene.19-21,34 Herein, we presented the first report of a VHL gene mutation in a sporadic Japanese case of ELST. The tumor showed a G to T substitution at nucleotide 564, which resulted in an amino acid substitution (Trp to Cys, codon 117). Our previous study on a germline VHL mutation showed an identical mutation in one Japanese VHL family,22 and at least 4 Western VHL families carry this mutation.35 In addition, a missense mutation located at codon 117 has been identified in a case of sporadic renal cell carcinoma.13,35 It thus seems that the observed mutation is related to ELST tumorigenesis in the present case, although we could not confirm the loss of heterozygosity of the VHL gene. There are 2 studies on the VHL gene mutation of ELST with VHL disease19,20 and 1 study on sporadic cases of ELST.21 Vortmeyer et al showed 3 nucleotide insertions at the splicing site of exon 2,19 and Kawahara et al reported 1 base pair deletion at nucleotide 502 that resulted in termination at codon 87.20 In the analysis of 4 sporadic ELSTs, 2 of the cases showed point mutation.21 In one, G-to-A transversion (Gly to Asp) was shown in exon 2, codon 114, whereas in the other, one nucleotide (G) deletion of exon 1, codon 4 was identified, resulting in a frameshift mutation.21 The mutation found in the present case was different from these previously reported mutations. The findings of the present study and previous studies warrant that the VHL gene is associated with ELST tumorigenesis with or without VHL disease, and suggest that ELST is one of the VHL-associated tumors similar to hemangioblastoma, renal cell carcinoma, and pheochromocytoma. Because of the low incidence of ELST, however, the number of tumors analyzed for VHL gene mutation has been limited, and alteration of other tumor-related genes has never been investigated. To clarify the significance of VHL mutation in the tumorigenesis of ELST, additional cases should be analyzed in future studies. REFERENCES
FIGURE 4. Schematic representation of the VHL gene structure and site of mutation in the endolymphatic tumor. The 3 exons are indicated by boxes and their coding regions are shaded. The 3⬘-untransrated region (3⬘-UTR) of exon 3 is unshaded. Nucleotides are numbered according to the VHL cDNA sequence.11 The arrow indicates the site of the mutation found in the present study.
1. Heffner DK: Low-grade adenocarcinoma of probable endolymphatic sac origin. A clinicopathologic study of 20 cases. Cancer 64:2292-2302, 1989 2. Megerian CA, McKenna MJ, Nuss RC, et al: Endolymphatic sac tumors: Histopathologic confirmation, clinical characterization, and implication in von Hippel-Lindau disease. Laryngoscope 105:801-808, 1995 3. Wenig BM, Heffner DK: Endolymphatic sac tumors: Fact or fiction? Adv Anat Pathol 3:378-387, 1996 4. Kempermann G, Neumann HPH, Volk B: Endolymphatic sac tumours. Histopathology 33:2-10, 1998
1275
HUMAN PATHOLOGY
Volume 32, No. 11 (November 2001)
5. Poe DS, Tarlov EC, Thomas CB, et al: Aggressive papillary tumors of temporal bone. Otolaryngol Head Neck Surg 108:80-86, 1993 6. Delisle MB, Uro E, Rouquette I, et al: Papillary neoplasm of the endolymphatic sac in a patient with von Hippel-Lindau disease. J Clin Pathol 47:959-961, 1994 7. Gaffey MJ, Mills SE, Boyd JC: Aggressive papillary tumor of middle ear/temporal bond and adnexal papillary cystadenoma. Manifestations of von Hippel-Lindau disease. Am J Surg Pathol 18:1254-1260, 1994 8. Kempermann G, Neumann HPH, Scheremet R, et al: Deafness due to bilateral endolymphatic sac tumours in a case of von Hippel-Lindau syndrome. J Neurol Neurosurg Psychiatry 61:318-320, 1996 9. Choyke PL, Glenn GM, Walther MM, et al: Von Hipppel-Lindau disease. Genetic, clinical, and imaging features. Radiology 194:629-642, 1995 10. Seizinger BR, Rouleau GA, Ozelius LJ, et al: Von Hipppel-Lindau disease maps to the region of chromosome 3 associated with renal cell carcinoma. Nature 332:268-269, 1988 11. Latif F, Tory K, Gnarra J, et al: Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 260:1317-1320, 1993 12. Tory K, Brauch H, Linehan M, et al: Specific genetic change in tumors associated with von Hippel-Lindau disease. J Natl Cancer Inst 81:1097-1101, 1989 13. Gnarra JR, Tory K, Weng Y, et al: Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat Genet 7:85-90, 1994 14. Shuin T, Kondo K, Torigoe S, et al: Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau tumor suppressor gene in primary human renal cell carcinomas. Cancer Res 54:2852-2855, 1994 15. Kanno H, Kondo K, Ito S, et al: Somatic mutations of the von HippelLindau tumor suppressor gene in sporadic central nervous system hemangioblastomas. Cancer Res 54:4845-4847, 1994 16. Lee JY, Dong SM, Park WS, et al: Loss of heterozygosity and somatic mutations of the VHL tumor suppressor gene in sporadic cerebellar hemangioblastomas. Cancer Res 58:504-508, 1998 17. Vortmeyer AO, Lubensky IA, Linehan FF, et al: Allelic deletion and mutation of the von Hippel-Lindau (VHL) tumor suppressor gene in pancreatic microcystic adenomas. Am J Pathol 151:951-956, 1997 18. Manski TJ, Heffner DK, Glenn GM, et al: Endolymphatic sac tumors. A source of morbid hearing loss in von Hippel-Lindau disease. JAMA 277:14611466, 1997 19. Vortmeyer AO, Choo D, Pack SD, et al: Von Hippel-Lindau disease gene alterations associated with endolymphatic sac tumor. J Natl Cancer Inst 89:970-972, 1997 20. Kawahara N, Kume H, Ueki K, et al: VHL gene inactivation in an
endolymphatic sac tumor associated with von Hippel-Lindau disease. Neurology 53:208-210, 1999 21. Vortmeyer AO, Huang SC, Koch CA, et al: Somatic von Hippel-Lindau gene mutations detected in sporadic endolymphatic sac tumor. Cancer Res 60:5963-5965, 2000 22. Yoshida M, Ashida S, Kondo K, et al: Germ-line mutation analysis in patients with von Hippel-Lindau disease in Japan: An extended study of 77 families. Jpn J Cancer Res 91:204-212, 2000 23. Iliopoulos O, Kibel A, Gray S, et al: Tumour suppression by the human von Hippel-Lindau gene product. Nat Med 1:822-826, 1995 24. Crossey PA, Maher ER, Jones MH, et al: Genetic linkage between von Hippel-Lindau disease and three microsatellite polymorphisms refines the localization of the VHL locus. Hum Mol Genet 2:279-282, 1993 25. Siedentop KH, Jeantet C: Primary adenocarcinoma of the middle ear. Ann Otol Rhinol Laryngol 70:719-733, 1961 26. Pallanch JF, McDonald TJ, Weiland LH, et al: Adenocarcinoma and adenoma of the middle ear. Laryngoscope 92:47-53, 1982 27. Schuller DE, Conley JJ, Goodman JH, et al: Primary adenocarcinoma of the middle ear. Otolaryngol Head Neck Surg 91:280-283, 1983 28. Gulya AJ, Glasscock ME, Pensak ML: Primary adenocarcinoma of the temporal bone with posterior fossa extension: Case report. Laryngoscope 96: 675-677, 1986 29. Gaffey MJ, Mills SE, Fechner RE, et al: Aggressive papillary middle ear tumor. A clinicopathologic entity distinct from middle ear adenoma. Am J Surg Pathol 12:790-797, 1988 30. Benecke JE, Noel FL, Carberry JN, et al: Adenomatous tumors of the middle ear and mastoid. Am J Otol 11:20-26, 1990 31. Lo WWM, Applegate LJ, Carberry JN, et al: Endolymphatic sac tumors: Radiologic appearance. Radiology 189:199-204, 1993 32. Hassard AD, Boudreau SF, Cron CC: Adenoma of the endolymphatic sac. J Otolaryngol 13:213-216, 1984 33. Li JC, Brackmann DE, Lo WW, et al: Reclassification of aggressive adenomatous mastoid neoplasms as endolymphatic sac tumors. Laryngoscope 103:1342-1348, 1993 34. Tibbs RE, Bowles AP, Raila FA, et al: Should endolymphatic sac tumors be considered part of the von Hippel-Lindau complex? Pathology case report. Neurosurgery 40:848-855, 1997 35. Beroud C, Joly D, Gallou C, et al: Software and database for the analysis of mutations in the VHL gene. Nucleic Acids Res 26:256-258, 1998 Available at http://www.umd.necker.fr/UMDsoft.html. Accessed January 16, 2001
1276
Volume 32, No. 11 (November 2001)
MUTATION OF VON HIPPEL–LINDAU TUMOR SUPPRESSOR GENE IN A SPORADIC ENDOLYMPHATIC SAC TUMOR SHUJI HAMAZAKI, MD, MINORU YOSHIDA, MD, MASAHIRO YAO, MD, YOJI NAGASHIMA, MD, KOHJI TAGUCHI, MD, HIROYUKI NAKASHIMA, MD, AND SHIGERU OKADA, MD Endolymphatic sac tumor (ELST) is a low-grade adenocarcinoma of the temporal bone that is presumed to originate from the endolymphatic system. Although ELSTs are extremely rare in the general population, a significant number of studies have documented the occurrence of ELST among patients with von Hippel-Lindau (VHL) disease. Because of the rarity of the tumor, however, few cases of ELST have been analyzed for mutations of the VHL tumor suppressor gene. In this study, we reported a Japanese male patient with sporadic ELST, along with a molecular genetic analysis of the VHL gene. The light microscopic and immunohistochemical features and clinical presentations were typical of ELST. Sequencing studies of the tumor DNA disclosed a G to T substitution of nucleotide 564, which
resulted in an amino acid substitution (Trp to Cys). This is the first report of the VHL gene mutation in a sporadic Japanese case of ELST. HUM PATHOL 32:1272-1276. Copyright © 2001 by W.B. Saunders Company Key words: endolymphatic sac tumor, temporal bone, von HippelLindau disease, VHL tumor suppressor gene. Abbreviations: ELST, endolymphatic sac tumor; VHL, von Hippel-Lindau; HE, hematoxytin and eosin; EMA, epithelial membrane antigen; GFAP, glial fibrillary acidic protein; PCR, polymerase chain reaction; CT, computed tomography; PB-WBC, peripheral bloodwhite blood cells; MRI, magnetic resonance imaging; PAS, periodic acid-Schiff; NSE, neuron specific enolase.
Endolymphatic sac tumor (ELST) is a primary low-grade adenocarcinoma of the temporal bone that is presumed to originate from the vestibular endolymphatic system.1-4 Histologicaly, ELST is characterized by the proliferation of cuboidal cells forming a papillotubular pattern and occasional colloid-filled cysts, reminiscent of thyroid papillary carcinoma. Although ELST is extremely rare in the general population, a significant number of ELSTs have been reported in the setting of von Hippel-Lindau (VHL) disease.2,5-8 VHL disease is a genetic abnormality inherited as an
autosomal dominant trait and predisposes the patients to multiple hemangioblastomas of the central nervous system, along with tumors and cysts of various organs such as clear cell renal carcinoma, pheochromocytoma, and pancreatic cystadenoma.9 A gene responsible for VHL disease had been mapped on the short arm of chromosome 310 and has subsequently been identified.11 Genetic analysis of the tumors derived from VHL patients supported the tumor suppressor gene theory of Knudson that an inherited mutation in one allele, followed by somatic loss of the opposite allele is essential for the tumor development.12 In the case of sporadic tumors, tumorigenesis is associated with somatic alteration of both alleles of the tumor suppressor genes. Although somatic mutations of the VHL gene have been identified in sporadic renal cell carcinoma,13,14 hemangioblastoma15,16 and pancreatic tumor,17 other sporadic malignancies rarely showed mutations of VHL gene. Thus, somatic alteration of the VHL tumor suppressor gene is considered to be highly specific for the sporadic counterparts of tumors found in VHL disease. Association of ELSTs and VHL disease was first confirmed by a large epidemiologic study showing an increased prevalence of ELST among patients with VHL disease.18 Subsequently, a germline mutation of the VHL gene and somatic
From the Department of Pathology, Okayama University Hospital, Okayama; the Department of Urology and Pathology, Yokohama City University School of Medicine, Yokohama; the Department of Pathology, Okayama Rosai Hospital, Okayama; and the Department of Neurosurgery and First Department of Pathology, Okayama University Medical School, Okayama, Japan. Address correspondence and reprint requests to Shuji Hamazaki, MD, Department of Pathology, Okayama University Hospital, 2-5-1 Shikata, Okayama 700-8558, Japan. Copyright © 2001 by W.B. Saunders Company 0046-8177/01/3211-0020$35.00/0 doi:10.1053/hupa.2001.28961
1272
CASE STUDIES
TABLE 1. The Immunohistochemical Antibodies Used Antibody Cytokeratin (AE1/AE3) EMA (E29) Vimentin (V9) GFAP (polyclonal, rabbit) Chromogranin A (DAK-A3) Synaptophysin (polyclonal, rabbit) NSE (BBS/NC/VI-H14) S-100 (polyclonal, rabbit) Thyroglobulin (polyclonal, rabbit)
Source
Concentration
Lipshaw/Immunon (Pittsburgh, PA) DAKO (Carpinteria, CA) DAKO DAKO DAKO DAKO
1:50
DAKO DAKO DAKO
1:50 1:50 1:500 1:50 1:500 1:50 1:500 1:500
Polymerase Chain Reaction and DNA Sequencing Analysis of the VHL Gene The procedures for polymerase chain reaction (PCR) amplification and direct sequencing of the VHL coding region were similar to those of our previous study.22 The primer pairs used for amplification were previously described (Table 2).14,22 All nucleotides are numbered according to the human VHL complementary DNA (cDNA) sequence originally described by Latif et al,11 in which codon 1 is located at nucleotide 214, the location of the first methionine.23 RESULTS Clinical Presentation
loss of the wild-type allele were shown in ELSTs from VHL patients,19,20 and somatic VHL gene mutations were shown in the sporadic ELSTs.21 Because of the rarity of ELSTs, however, only a small number of ELSTs have been subjected to molecular genetic analysis. We recently encountered a case of ELST in a Japanese man, who previously showed no other symptoms of VHL disease. Herein, we describe the clinical and pathologic features of the patient, along with the findings of molecular genetic analysis on the VHL gene. MATERIALS AND METHODS Light Microscopy Tissues for light microscopy were fixed in 10% formalin and paraffin-embedded in a standard manner. Routine sections were stained with hematoxylin and eosin (HE) and periodic acid-Schiff (PAS) stains. Sections were immunostained with antibodies against cytokeratin, epithelial membrane antigen (EMA), vimentin, glial fibrillary acidic protein (GFAP), neuron specific enolase (NSE), S-100, synaptophysin, chromogranin A, and thyroglobulin (Table 1). Antigen retrieval was performed by boiling in citrate buffer (10 mmol/L, pH 6.0), and sections were visualized with a streptavidin-biotin immunoperoxidase reagent kit (DAKO, Carpinteria, CA). DNA Extraction Genomic DNAs were extracted from the white blood cells in the peripheral blood (PB-WBC) of the patient by a standard procedure. For DNA extraction from the formalinfixed, paraffin-embedded tissue samples, tumor and nonneoplastic tissues were dissected from HE-stained sections under light microscopic visualization,16 and DNAs were extracted with a DNA extraction kit (DEXPAT, Takara Biomedicals, Osaka, Japan).
A 34-year-old Japanese man presented with a 3-year history of a progressive, right-sided hearing impairment, tinnitus, and vertigo. His past history and family history were uneventful. Computed tomography (CT) showed a mass lesion in the right cerebellopontine angle with destruction of the petrous bone (Fig 1). The tumor contained areas of high attenuation that corresponded to calcification. On a magnetic resonance imaging (MRI) scan, the tumor showed heterogeneous signal intensity on T1-weighted images and homogenous high signal intensity on T2-weighted images. Arteriography showed a hypervascular tumor supplied by branches of the ascending pharyngeal artery. No radiographic abnormality was noted in the middle ear, mastoid air cells, or auditory canal. After endoarterial embolization, the patient underwent craniotomy for a complete removal of the tumor. The tumor was destructive of the posterior part of the petrous bone and extended to the posterior cranial fossa. The tumor was attached to the overlying dura, and showed focal hemorrhage and cystic degeneration. Recovery after the operation was uneventful. To date, the patient remains well, with no evidence of recurrent tumor. Histopathology and Immunohistochemistry The tumor consisted of fragments of gray-red soft tissue and white firm tissue. Microscopically, the tumor showed proliferation of cuboidal tumor cells forming papillotubular structures and occasional cystic spaces (Fig 2A, B). Neoplastic cells with flattened or tall columnar appearance were also seen. Cystic spaces contained pale eosinophilic material, reminiscent of thyroid colloid. The neoplastic cells had fairly uniform round nuclei and abundant clear to eosinophilic cytoplasm (Fig 2B). Only rare mitotic figures were observed. Although the stroma was generally composed of thin fibrovascular tissue, focal fibrotic areas with hemorrhage, hemosiderin deposits, and mononuclear cell infiltration were also observed. Cytoplasm of the neoplastic cells showed positive staining for PAS, and the staining was eliminated by diastase digestion. The content of cystic spaces showed positive reactions for PAS staining.
TABLE 2. Primer Pairs Used for PCR Amplification Set
Exon
Position
Sequence of Primers
Reference
1
1 2
3
3
5⬘TGGTCTGGATCGCGGAGGGAA3⬘ 5⬘GACCGTGCTATCGTCCCTGC3⬘ 5⬘GTGGCTCTTTAACAACTTTGC3⬘ 5⬘CCTGTACTTACCACAACAACCTTATC3⬘ 5⬘TTCCTTGTACTGAGACCCTAG3⬘ 5⬘AGCTGAGATGAACAGTGTAAGT3⬘
22
2
Upstream Downstream Upstream Downstream Upstream Downstream
1273
14 14
HUMAN PATHOLOGY
Volume 32, No. 11 (November 2001)
FIGURE 1. (A) An axial CT scan showing a tumor of the left cerebellopontine angle with destruction of the posterior part of the petrous bone. (B) The axial CT scan obtained after administration of the contrast material.
Immunohistochemically, most of the tumor cells showed strong positive staining for cytokeratin (Fig 2C), EMA, and vimentin. Some of the tumor cells showed positive immunostaining for GFAP (Fig 2D), NSE, synaptophysin, and S-100. Stains for chromogranin A and thyroglobulin were negative. VHL Gene Analysis We examined ELST for the somatic VHL mutation by direct sequencing of the coding region. Sequencing studies showed that ELST had a G to T transversion at nucleotide 564, and it made an amino acid change (Trp to Cys) at codon 117 (Figs 3 and 4). The genomic DNA of PB-WBC and that of non-neoplastic tissue showed no mutation. We also attempted to determine any allelic imbalance of the gene by using 2 microsatellite markers (D3S1038 and D3S1317) flanking the
VHL gene.24 However, the DNAs failed to be well amplified probably because of degradation during formalin fixation. DISCUSSION Primary adenomatous tumors of the temporal bone are rare and had not been well defined until the end of the 1980s. Although the majority of adenomatous temporal bone tumors are benign resectable lesions and arise from the mucosa of the middle ear, the infrequent occurrence of a locally destructive tumor has been reported.25-28 In 1988, Gaffey et al noted the association of a biologically aggressive growth with papillary histology, and proposed the term aggressive papillary middle ear tumor for this invasive subtype of the adenomatous temporal bone tumor.29 Benecke et al subsequently confirmed that the middle ear tumors with a non-papillary growth pat-
FIGURE 2. (A) Cuboidal tumor cells form papillotubular and cystic structures. (Hematoxylin and eosin, original magnification ⫻80.) (B) The tumor cells have a uniform round nuclei and abundant clear cytoplasm. Microcysts contain eosinophilic colloid. (Hematoxylin and eosin, original magnification ⫻160.) (C) Tumor cells show a positive immunohistochemical reaction for cytokeratin. (Original magnification ⫻160.) (D) Most tumor cells show positive immunohistochemical reaction for GFAP (Original magnification ⫻160.)
1274
CASE STUDIES
FIGURE 3. Sequencing studies of the VHL gene showed that the tumor genomic DNA had a G to T transversion at nucleotide 564 (right, arrow) that led to an amino acid change (Trp to Cys) at codon 117, whereas the genomic DNA of the corresponding non-neoplastic tissue showed no mutation (left).
tern were confined to the middle ear and mastoid, whereas those tumors with a papillary pattern were more aggressive and associated with significant bone and dural involvement.30 In 1989, Heffner proposed that the papillary tumors of the temporal bone originated from the epithelium of the endolymphatic sac rather than the middle ear mucosa.1 He showed histologic, ultrastructural, and immunohistochemical similarities between the papillary temporal bone tumor and normal endolymphatic sac epithelium.1 Radiographic analysis of the tumors also disclosed that the tumors were often centered at the posterior-medial face of the petrous bone, ie, the region of endolymphatic sac and aquaduct.1,2,3 Furthermore, few papillary tumors arising within the confines of the endolymphatic system were identified.2,32 Heffner’s view has been increasingly accepted in recent studies, and ELST is considered a distinct clinicopathologic entity.2-4,33 Typical early manifestations of the ELST are sensorineural hearing loss, tinnitus, and vertigo.1-4,18 The tumor has a slight female predominance, and the age at the clinical presentation ranges from the first to the eighth decade, with a median age in the fourth decade. Smaller lesions of ELST are centered at the posterior part of the petrous bone and grow into the dura of the cerebellopontine angle.1-4,18,30 ELST is locally invasive and destructive of bony structures, but the development of metastasis has not been reported. Microscopically, ELST is characterized by papillotubular and cystic structures composed of cuboidal to low-columnar cells.1-4,28 The tumor cells have relatively uniform round nuclei with clear to pale eosinophilic cytoplasm. Pleomorphism of the tumor cells is minimal, and mitosis and necrosis are rarely encountered. ELSTs consistently show positive immu-
nohistochemical reactions for cytokeratin, EMA, and vimentin.1,3-8,19,29,32,33 The tumor cells may exhibit variable staining for GFAP, NSE, and S-100, whereas expression of chromogranin A, synaptophysin, or neurofilament has never been observed. The light microscopic and immunohistochemical features of the current case (in addition to the clinical presentations) were typical of ELST, and the patient was diagnosed as having a sporadic tumor because of the lack of other manifestations of VHL disease and family history. Recently, an increasing number of studies has documented the occurrence of ELST in patients with VHL disease.2,5-8 Studies among the VHL population confirmed that 10.6% of patients with VHL show radiographic evidence of ELST, and 65% of patients with VHL or suspected relatives disclose the abnormalities of auditory function.18 Development of the bilateral neoplasm in VHL disease also provides supporting evidence that the genetic defect of VHL has relevance to ELST.5,8,18 Because of the rarity of ELST, however, few cases of ELST have been investigated for alterations in the VHL gene.19-21,34 Herein, we presented the first report of a VHL gene mutation in a sporadic Japanese case of ELST. The tumor showed a G to T substitution at nucleotide 564, which resulted in an amino acid substitution (Trp to Cys, codon 117). Our previous study on a germline VHL mutation showed an identical mutation in one Japanese VHL family,22 and at least 4 Western VHL families carry this mutation.35 In addition, a missense mutation located at codon 117 has been identified in a case of sporadic renal cell carcinoma.13,35 It thus seems that the observed mutation is related to ELST tumorigenesis in the present case, although we could not confirm the loss of heterozygosity of the VHL gene. There are 2 studies on the VHL gene mutation of ELST with VHL disease19,20 and 1 study on sporadic cases of ELST.21 Vortmeyer et al showed 3 nucleotide insertions at the splicing site of exon 2,19 and Kawahara et al reported 1 base pair deletion at nucleotide 502 that resulted in termination at codon 87.20 In the analysis of 4 sporadic ELSTs, 2 of the cases showed point mutation.21 In one, G-to-A transversion (Gly to Asp) was shown in exon 2, codon 114, whereas in the other, one nucleotide (G) deletion of exon 1, codon 4 was identified, resulting in a frameshift mutation.21 The mutation found in the present case was different from these previously reported mutations. The findings of the present study and previous studies warrant that the VHL gene is associated with ELST tumorigenesis with or without VHL disease, and suggest that ELST is one of the VHL-associated tumors similar to hemangioblastoma, renal cell carcinoma, and pheochromocytoma. Because of the low incidence of ELST, however, the number of tumors analyzed for VHL gene mutation has been limited, and alteration of other tumor-related genes has never been investigated. To clarify the significance of VHL mutation in the tumorigenesis of ELST, additional cases should be analyzed in future studies. REFERENCES
FIGURE 4. Schematic representation of the VHL gene structure and site of mutation in the endolymphatic tumor. The 3 exons are indicated by boxes and their coding regions are shaded. The 3⬘-untransrated region (3⬘-UTR) of exon 3 is unshaded. Nucleotides are numbered according to the VHL cDNA sequence.11 The arrow indicates the site of the mutation found in the present study.
1. Heffner DK: Low-grade adenocarcinoma of probable endolymphatic sac origin. A clinicopathologic study of 20 cases. Cancer 64:2292-2302, 1989 2. Megerian CA, McKenna MJ, Nuss RC, et al: Endolymphatic sac tumors: Histopathologic confirmation, clinical characterization, and implication in von Hippel-Lindau disease. Laryngoscope 105:801-808, 1995 3. Wenig BM, Heffner DK: Endolymphatic sac tumors: Fact or fiction? Adv Anat Pathol 3:378-387, 1996 4. Kempermann G, Neumann HPH, Volk B: Endolymphatic sac tumours. Histopathology 33:2-10, 1998
1275
HUMAN PATHOLOGY
Volume 32, No. 11 (November 2001)
5. Poe DS, Tarlov EC, Thomas CB, et al: Aggressive papillary tumors of temporal bone. Otolaryngol Head Neck Surg 108:80-86, 1993 6. Delisle MB, Uro E, Rouquette I, et al: Papillary neoplasm of the endolymphatic sac in a patient with von Hippel-Lindau disease. J Clin Pathol 47:959-961, 1994 7. Gaffey MJ, Mills SE, Boyd JC: Aggressive papillary tumor of middle ear/temporal bond and adnexal papillary cystadenoma. Manifestations of von Hippel-Lindau disease. Am J Surg Pathol 18:1254-1260, 1994 8. Kempermann G, Neumann HPH, Scheremet R, et al: Deafness due to bilateral endolymphatic sac tumours in a case of von Hippel-Lindau syndrome. J Neurol Neurosurg Psychiatry 61:318-320, 1996 9. Choyke PL, Glenn GM, Walther MM, et al: Von Hipppel-Lindau disease. Genetic, clinical, and imaging features. Radiology 194:629-642, 1995 10. Seizinger BR, Rouleau GA, Ozelius LJ, et al: Von Hipppel-Lindau disease maps to the region of chromosome 3 associated with renal cell carcinoma. Nature 332:268-269, 1988 11. Latif F, Tory K, Gnarra J, et al: Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 260:1317-1320, 1993 12. Tory K, Brauch H, Linehan M, et al: Specific genetic change in tumors associated with von Hippel-Lindau disease. J Natl Cancer Inst 81:1097-1101, 1989 13. Gnarra JR, Tory K, Weng Y, et al: Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat Genet 7:85-90, 1994 14. Shuin T, Kondo K, Torigoe S, et al: Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau tumor suppressor gene in primary human renal cell carcinomas. Cancer Res 54:2852-2855, 1994 15. Kanno H, Kondo K, Ito S, et al: Somatic mutations of the von HippelLindau tumor suppressor gene in sporadic central nervous system hemangioblastomas. Cancer Res 54:4845-4847, 1994 16. Lee JY, Dong SM, Park WS, et al: Loss of heterozygosity and somatic mutations of the VHL tumor suppressor gene in sporadic cerebellar hemangioblastomas. Cancer Res 58:504-508, 1998 17. Vortmeyer AO, Lubensky IA, Linehan FF, et al: Allelic deletion and mutation of the von Hippel-Lindau (VHL) tumor suppressor gene in pancreatic microcystic adenomas. Am J Pathol 151:951-956, 1997 18. Manski TJ, Heffner DK, Glenn GM, et al: Endolymphatic sac tumors. A source of morbid hearing loss in von Hippel-Lindau disease. JAMA 277:14611466, 1997 19. Vortmeyer AO, Choo D, Pack SD, et al: Von Hippel-Lindau disease gene alterations associated with endolymphatic sac tumor. J Natl Cancer Inst 89:970-972, 1997 20. Kawahara N, Kume H, Ueki K, et al: VHL gene inactivation in an
endolymphatic sac tumor associated with von Hippel-Lindau disease. Neurology 53:208-210, 1999 21. Vortmeyer AO, Huang SC, Koch CA, et al: Somatic von Hippel-Lindau gene mutations detected in sporadic endolymphatic sac tumor. Cancer Res 60:5963-5965, 2000 22. Yoshida M, Ashida S, Kondo K, et al: Germ-line mutation analysis in patients with von Hippel-Lindau disease in Japan: An extended study of 77 families. Jpn J Cancer Res 91:204-212, 2000 23. Iliopoulos O, Kibel A, Gray S, et al: Tumour suppression by the human von Hippel-Lindau gene product. Nat Med 1:822-826, 1995 24. Crossey PA, Maher ER, Jones MH, et al: Genetic linkage between von Hippel-Lindau disease and three microsatellite polymorphisms refines the localization of the VHL locus. Hum Mol Genet 2:279-282, 1993 25. Siedentop KH, Jeantet C: Primary adenocarcinoma of the middle ear. Ann Otol Rhinol Laryngol 70:719-733, 1961 26. Pallanch JF, McDonald TJ, Weiland LH, et al: Adenocarcinoma and adenoma of the middle ear. Laryngoscope 92:47-53, 1982 27. Schuller DE, Conley JJ, Goodman JH, et al: Primary adenocarcinoma of the middle ear. Otolaryngol Head Neck Surg 91:280-283, 1983 28. Gulya AJ, Glasscock ME, Pensak ML: Primary adenocarcinoma of the temporal bone with posterior fossa extension: Case report. Laryngoscope 96: 675-677, 1986 29. Gaffey MJ, Mills SE, Fechner RE, et al: Aggressive papillary middle ear tumor. A clinicopathologic entity distinct from middle ear adenoma. Am J Surg Pathol 12:790-797, 1988 30. Benecke JE, Noel FL, Carberry JN, et al: Adenomatous tumors of the middle ear and mastoid. Am J Otol 11:20-26, 1990 31. Lo WWM, Applegate LJ, Carberry JN, et al: Endolymphatic sac tumors: Radiologic appearance. Radiology 189:199-204, 1993 32. Hassard AD, Boudreau SF, Cron CC: Adenoma of the endolymphatic sac. J Otolaryngol 13:213-216, 1984 33. Li JC, Brackmann DE, Lo WW, et al: Reclassification of aggressive adenomatous mastoid neoplasms as endolymphatic sac tumors. Laryngoscope 103:1342-1348, 1993 34. Tibbs RE, Bowles AP, Raila FA, et al: Should endolymphatic sac tumors be considered part of the von Hippel-Lindau complex? Pathology case report. Neurosurgery 40:848-855, 1997 35. Beroud C, Joly D, Gallou C, et al: Software and database for the analysis of mutations in the VHL gene. Nucleic Acids Res 26:256-258, 1998 Available at http://www.umd.necker.fr/UMDsoft.html. Accessed January 16, 2001
1276