- Email: [email protected]
Mutation screening of HOXA7 and HOXA9 genes in Chinese women with Müllerian duct abnormalities
Reproductive BioMedicine Online (2014) 29, 595–599
w w w. s c i e n c e d i r e c t . c o m w w w. r b m o n l i n e . c o m
ARTICLE
Mutation screening of HOXA7 and HOXA9 genes in Chinese women with Müllerian duct abnormalities Xinxia Chen a,b, Yulan Mu a, Chunyan Li a, Guangyu Li a, Hui Zhao c,d, Yingying Qin a, Zi-Jiang Chen a,e,* a
Center for Reproductive Medicine, Provincial Hospital Affiliated to Shandong University, National Research Center for Assisted Reproductive Technology and Reproductive Genetics, The Key Laboratory for Reproductive Endocrinology of Ministry of Education, Shandong Provincial Key Laboratory of Reproductive Medicine, 324 Jingwu Road, Jinan 250021, China; b School of Nursing, Shandong University, 44 Wenhua Road, Jinan 250012, China; c School of Biomedical Sciences, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong Special Administrative Region, China; d School of Biomedical Sciences Core Laboratory, The Chinese University of Hong Kong Shenzhen Research Institute, 10 Yuexing Erdao, Nanshan District, Shenzhen 518000, China; e Center for Reproductive Medicine, Renji Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai Key Laboratory for Assisted Reproduction and Reproductive Genetics, 145 Middle Shandong Rd, Shanghai 200001, China * Corresponding author.
E-mail address: [email protected] (Z-J Chen). Dr Xinxia Chen received her MD from Shandong University, Shandong, China, in 2007. She is now pursuing her PhD at the center for Reproductive medicine of Shandong University, one of the largest IVF centers in China and is a pioneer in IVF, oocyte cryopreservation and reproductive endocrinology and genetic diseases. Xinxia Chen has received both clinical and laboratory training.
Abstract HOXA genes in groups 7–13 have been proven to play a role in determining positional identity along the genitalia axis. The aim of the present study was to explore the relationship between HOXA7 and HOXA9 mutations and Müllerian duct abnormalities (MDA). One hundred and ninety-two Chinese patients with MDA abnormalities and 192 healthy controls were recruited. All coding regions of HOXA7 and HOXA9 were amplified and sequenced directly. Rs2301721 and rs2301720 in HOXA7, rs35355140 and rs7810502 in HOXA9 were identified in patients with MDA and controls. One rare single nucleotide polymorphism rs189587233 in 3′ UTR of HOXA9 gene was detected in one patient with didelphic uterus and absent in the 192 controls. This polymorphism, however, is known to exist in the normal Chinese population. Our results indicated that variants in the HOXA7 and HOXA9 genes were not common in Chinese women with Müllerian duct abnormalities. © 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.rbmo.2014.07.012 1472-6483/© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
596
X Chen et al.
KEYWORDS: HOXA7, HOXA9, Müllerian duct abnormalities, single nucleotide polymorphisms
Introduction Müllerian ducts, also named paramesonephric ducts, are the primordial origin of the female internal reproductive system. With the absence of anti-Müllerian hormone, Müllerian ducts develop into the upper part of the vagina, cervix, uterus and oviducts (MacLaughlin et al., 2001). Normal development of the embryonic female reproductive system includes three stages: formation of Müllerian ducts, fusion of both ducts and absorption of septum. In response, Müllerian-duct abnormalities (MDA) mainly consist of three types: failure of organogenesis, resulting in Mayer–Rokitansky–Kuster–Hauser (MRKH) syndrome or unicornuate uterus; failure of fusion, leading to didelphic or bicornuate uterus; and failure of septal absorption, causing uterine or vaginal septum (Grimbizis et al., 2013). The prevalence of MDA is estimated to be 5.5% in the general population and 25% in infertile women with a history of spontaneous abortion (Chan et al., 2011; Saravelos et al., 2008). They are often accompanied by renal defects (25%), musculoskeletal (10–12%) and, rarely cardiac or auditory anomalies (Mueller et al., 2007). Several factors have been suggested to contribute to the cause of MDA, such as environmental factors, intrauterine exposure to radiation or drugs and chromosomal abnormalities (Block et al., 2000; Taylor, 2008). Despite the fact that the MDA are sporadic and multifactorial, genetic factors still play an important role in this disease. Some candidate genes have been screened to evaluate their roles in the malformation, such as LHX1, PAX2, PBX1 and the WNT family (Abecasis et al., 2012; Dang et al., 2012; Sultan et al., 2009; Wu et al., 2013), but few could be proven pathogenically. The homeobox (HOX) family includes 39 genes arranged in four clusters termed HOX A, B, C and D on different chromosomes. Highly conserved between species, homeodomain proteins direct the early morphogenesis and spatial identity along the anterior–posterior axis. HOXA7-13 genes play a role in the development of cells along the genitalia axis (Du and Taylor, 2004; Naora et al., 2001; Taylor et al., 1997). HOXA7 is expressed specifically in regions of the neuoectoderm and mesoderm in mouse embryos, and the epithelium of fallopian tubes and endometrium in humans (Mahon et al., 1988; Naora et al., 2001). Previous studies have revealed that patients carrying deletions located at chromosome 7p15 or 7p21.1-p14.3, covering the HOXA7 gene, have either features similar to the hand–foot–genital syndrome or severe developmental delay (Fryssira et al., 2011; Jun et al., 2011). HOXA9 is expressed in the primordia of fallopian tubes during embryogenesis and oviducts in adults. Aberrant expression and methylation of HOXA9 was found in patients with MRKH (Rall et al., 2011). HOXA genes have long been considered candidates for MDA, owing to the fundamental role played in embryological genitalia and reproduction (Burel et al., 2006; Cheng et al., 2011; Ekici et al., 2013; Lalwani et al., 2008; Liatsikos et al., 2010). Few studies had been conducted on HOXA7 and HOXA9 genes, except for mutational screening in six patients with MRKH (Burel et al., 2006). In this study, 192 Chinese patients with MDA were examined to elucidate
whether HOXA7 and HOXA9 mutation was causative for the malformation.
Materials and methods A total of 192 patients with MDA and 192 controls were recruited among patients attending the Center for Reproductive Medicine, Provincial Hospital affiliated to Shandong University between January 2009 and December 2012 because of infertility. All 384 participants were Han Chinese, with 46, XX karyotype and normal secondary sexual characteristics. Previous screening in HOXA11 and HOXA13 genes was carried out, and no causative mutations were found in all participants (Chen et al., 2014; Zhu et al., 2012). The diagnosis of MDA was confirmed through transvaginal ultrasonography, hysteroscopy and hysterosalpingogram. The category of cases included formation defect: uterine agenesis (n = 15) and unicornuate uterus (n = 53); fusion defect: didelphic uterus (n = 41) and bicornuate uterus (n = 39); and absorption defect: septate uterus (n = 44). Clinical characteristics of the patients are shown in Table 1. One hundred and ninety-two controls were women from couples who were infertile due to male or tubal factors. Ultrasonography, hysteroscopy and hysterosalpingogram were used to exclude reproductive tract defects. The study was approved by the Institutional Review board of Reproductive medicine of Shandong University on 10 February, 2013 (IRB reference no. 19). Informed consent was obtained from each participant. Genomic DNA was extracted from peripheral blood samples, and all exons of HOXA7 and HOXA9 were amplified by polymerase chain reaction (PCR). Four pairs of primers were designed, and the PCR conditions are shown as Table 2. The PCR products were first analysed by agarose gel electrophoresis and then automatically sequenced (ABI PRISM 310; Applied Biosystems). For any novel variants, PCR was repeated independently three times and the products were sequenced both forwards and reverse. Chi-squared test was used for statistical analysis, and P < 0.05 was considered statistically significant. Table 1 Clinical characteristics of 192 patients with Müllerianduct abnormalities. Characteristic Total number of patients Primary infertility Spontaneous abortion One spontaneous abortion Recurrent spontaneous abortion Formation defect Fusion defect Absorption defect Kidney deformities Unilateral kidney agenesis Ectopic kidney
n (%) 192 109 41 8 33 68 80 44 4 3 1
(56.77) (21.35) (4.17) (17.19) (35.42) (41.67) (22.92) (2.08) (1.56) (0.52)
HOXA7 and HOXA9 mutations in Chinese women with Müllerian duct abnormalities
597
Table 2 Primers and polymerse chain reaction conditions for exons of HOXA7 and HOXA9. Gene HOXA7
Exon
Primer
Temperature (°C)
Length (bp)
Exon 1
CACCTGTGAGGACTGCTGAGAT GCTACCGGCTCGCAACAG TCTGGGACAGCAGCCTAACG GGGTGGGTAGAGTGCAGGTTG CCACCAAGTTGTTACATGAAATCTG CGAAGGCAGGCTCGAGAGA TGCCAGGGTTCCATTGTGT GGTTTGCCTTGGAAAAGATGT
57
689
60
550
56
750
58
555
Exon 2 HOXA9
Exon 1 Exon 2
Table 3 Gene
HOXA7
HOXA9
Variants of the HOXA7 and HOXA9 genes in Chinese patients with Müllerian duct abnormalities and controls.a Location
Variant
Exon 1
rs2301721
Exon 1
rs2301720
Exon 1
rs35355140
3′ UTR
rs7810502
3′ UTR
rs189587233
Genotype frequency
Allele frequency
Genotype
MDA n (%)
Control n (%)
Allele
MDA (%)
Control (%)
AA AG GG CC AC AA GG TG TT TT CT CC CC CG
151 38 3 151 38 3 133 54 5 38 136 18 191 1
151 35 6 151 35 6 121 62 9 49 126 17 192 0
A G
88.5 11.5
87.8 12.2
A C
88.5 11.5
87.8 12.2
G T
83.3 16.7
79.2 20.8
T C
55.2 44.8
58.3 41.7
C G
99.7 0.3
100.0 0.0
(78.6) (19.8) (1.6) (78.6) (19.8) (1.6) (69.3) (28.1) (2.6) (19.8) (70.8) (9.4) (99.5) (0.5)
(78.6) (18.2) (3.1) (78.6) (18.2) (3.1) (63.0) (32.3) (4.7) (25.5) (65.6) (8.9) (100.0) (0.0)
MDA = Müllerian duct abnormalities. a No statistically significant differences were found.
Results All exons and exon-intron boundaries of HOXA7 and HOXA9 were sequenced. Five known single-nucleotide polymorphisms were found: rs2301721 and rs2301720 in exon 1 of HOXA7; rs35355140 in exon 1 of HOXA9, rs7810502 and rs189587233 in 3′ UTR of HOXA9. The former four singlenucleotide polymorphisms were identified in both cases and controls, whereas rs189587233 was only detected in one patient with didelphic uterus. Comparison of genotype and allelic frequencies between cases and controls showed no statistically significant difference. Results are shown in Table 3.
Discussion Different genes are involved in Müllerian-duct development in animal models. These include genes essential for the formation of reproductive ducts (e.g. EMX2V, WNT family, LHX1, DACH1/DACH2 and PAX2) (Davis et al., 2008; Pellegrini et al., 1997; Wu et al., 2013); genes responsible for the regression of Müllerian duct in males (e.g. AMH and its receptor AMHR2)
(Behringer et al., 1994); and genes participating in the continuing development of female Müllerian duct (e.g. the HOX family) (Du and Taylor, 2004). Expression of the HOXA genes during the formation of Müllerian duct was highly conserved. HOXA13 was the first gene to be identified as causative for human reproductive tract malformation (Mortlock and Innis, 1997). Later, investigations focused on HOXA10, HOXA11, HOXA13, HOXA7 and HOXA9 genes (Burel et al., 2006; Cheng et al., 2011; Ekici et al., 2013; Lalwani et al., 2008; Liatsikos et al., 2010). Novel missense and truncation variants were identified in HOXA10, which were preliminarily verified or predicted to be potentially causative (Cheng et al., 2011; Ekici et al., 2013). Mutations in HOXA13 were discovered to be responsible for hand–foot–genital syndrome and Guttmacher syndrome (Goodman et al., 2000; Jorgensen et al., 2010). No evidence, however, was found for an association between HOXA11 mutation and MDA (Burel et al., 2006; Chen et al., 2014; Liatsikos et al., 2010). The shift of HOXA9 expression from oviducts to the uterus was observed in the T-shaped uterus after diethylstilbestrol exposure (Block et al., 2000). It was presumed that ectopic expression of HOXA9 induced by internal or external disturbances might contribute to the pathogenesis of MDA. Rall et al. (2011), however, reported that
598 patients with MRKH exhibited distinct expression of HOXA5 and HOXA9 owing to decreased methylation level. It provides reasons to pursue other epigenetic mechanisms regulating the development of female reproductive tract. In the present study, the coding regions of HOXA7 and HOXA9 were sequenced, but no causative variants were identified. This is consistent with a previous study, in which no mutation or polymorphism was found in the coding sequence of HOXA7 and HOXA9 in six patients with MRKH (Burel et al., 2006). The only perturbation found in the MDA group but not in controls was rs189587233 in 3′ UTR of the HOXA9 gene. This polymorphism, however, was previously detected with 1% frequency in Southern Han Chinese from the 1000 Genomes Project (Abecasis et al., 2012), and 0.5% in the Northern Han population from which one sample carried G allele for rs189587233 in the present study. Therefore, it is unlikely to be causative for MDA. In summary, our results suggest that mutations in the HOXA7 and HOXA9 genes were not common in Chinese women with MDA. Future studies in larger cohorts from different ethnic populations are required to elucidate the role of HOX genes in the development of reproductive malformations.
Acknowledgements The authors thank Yuehong Bian, Shizhen Su, Changming Zhang, Yongzhi Cao from the center for Reproductive Medicine, Provincial Hospital Affiliated to Shandong University, and Tao Li from Shandong Provincial Hospital for technical support. The authors acknowledge receipt of the following financial support for the research, authorship, and/or publication of this article: grant from the National Basic Research Program of China [973 program-2012CB944700]; the National Natural Science Foundation of China [81270662, 81370687]; Foundation for the Author of National Excellent Doctoral Dissertation of PR China (201078); Independent Innovation Foundation of Shandong University (IIFSDU, 2012TS130).
References Abecasis, G.R., Auton, A., Brooks, L.D., Depristo, M.A., Durbin, R.M., Handsaker, R.E., Kang, H.M., Marth, G.T., McVean, G.A., 2012. An integrated map of genetic variation from 1,092 human genomes. Nature 491, 56–65. Behringer, R.R., Finegold, M.J., Cate, R.L., 1994. Mullerian-inhibiting substance function during mammalian sexual development. Cell 79, 415–425. Block, K., Kardana, A., Igarashi, P., Taylor, H.S., 2000. In utero diethylstilbestrol (DES) exposure alters Hox gene expression in the developing mullerian system. FASEB J. 14, 1101–1108. Burel, A., Mouchel, T., Odent, S., Tiker, F., Knebelmann, B., Pellerin, I., Guerrier, D., 2006. Role of HOXA7 to HOXA13 and PBX1 genes in various forms of MRKH syndrome (congenital absence of uterus and vagina). J. Negat. Results Biomed. 5, 4. Chan, Y.Y., Jayaprakasan, K., Zamora, J., Thornton, J.G., RaineFenning, N., Coomarasamy, A., 2011. The prevalence of congenital uterine anomalies in unselected and high-risk populations: a systematic review. Hum. Reprod. Update 17, 761–771. Chen, X., Li, G., Qin, Y., Cui, Y., You, L., Chen, Z.J., 2014. Mutations in HOXA11 are not responsible for Mullerian duct anomalies in Chinese patients. Reprod. Biomed. Online 28, 739–742.
X Chen et al. Cheng, Z., Zhu, Y., Su, D., Wang, J., Cheng, L., Chen, B., Wei, Z., Zhou, P., Wang, B., Ma, X., Cao, Y., 2011. A novel mutation of HOXA10 in a Chinese woman with a Mullerian duct anomaly. Hum. Reprod. 26, 3197–3201. Dang, Y., Qin, Y., Tang, R., Mu, Y., Li, G., Xia, M., Chen, Z.J., 2012. Variants of the WNT7A gene in Chinese patients with mullerian duct abnormalities. Fertil. Steril. 97, 391–394. Davis, R.J., Harding, M., Moayedi, Y., Mardon, G., 2008. Mouse Dach1 and Dach2 are redundantly required for Mullerian duct development. Genesis 46, 205–213. Du, H., Taylor, H.S., 2004. Molecular regulation of mullerian development by Hox genes. Ann. N. Y. Acad. Sci. 1034, 152–165. Ekici, A.B., Strissel, P.L., Oppelt, P.G., Renner, S.P., Brucker, S., Beckmann, M.W., Strick, R., 2013. HOXA10 and HOXA13 sequence variations in human female genital malformations including congenital absence of the uterus and vagina. Gene 518, 267– 272. Fryssira, H., Makrythanasis, P., Kattamis, A., Stokidis, K., Menten, B., Kosaki, K., Willems, P., Kanavakis, E., 2011. Severe developmental delay in a patient with 7p21.1-p14.3 microdeletion spanning the TWIST gene and the HOXA gene cluster. Mol. Syndromol. 2, 45–49. Goodman, F.R., Bacchelli, C., Brady, A.F., Brueton, L.A., Fryns, J.P., Mortlock, D.P., Innis, J.W., Holmes, L.B., Donnenfeld, A.E., Feingold, M., Beemer, F.A., Hennekam, R.C., Scambler, P.J., 2000. Novel HOXA13 mutations and the phenotypic spectrum of handfoot-genital syndrome. Am. J. Hum. Genet. 67, 197–202. Grimbizis, G.F., Gordts, S., Di Spiezio Sardo, A., Brucker, S., De Angelis, C., Gergolet, M., Li, T.C., Tanos, V., Brolmann, H., Gianaroli, L., Campo, R., 2013. The ESHRE/ESGE consensus on the classification of female genital tract congenital anomalies. Hum. Reprod. 28, 2032–2044. Jorgensen, E.M., Ruman, J.I., Doherty, L., Taylor, H.S., 2010. A novel mutation of HOXA13 in a family with hand-foot-genital syndrome and the role of polyalanine expansions in the spectrum of Mullerian fusion anomalies. Fertil. Steril. 94, 1235–1238. Jun, K.R., Seo, E.J., Lee, J.O., Yoo, H.W., Park, I.S., Yoon, H.K., 2011. Molecular cytogenetic and clinical characterization of a patient with a 5.6-Mb deletion in 7p15 including HOXA cluster. Am. J. Med. Genet. A 155A, 642–647. Lalwani, S., Wu, H.H., Reindollar, R.H., Gray, M.R., 2008. HOXA10 mutations in congenital absence of uterus and vagina. Fertil. Steril. 89, 325–330. Liatsikos, S.A., Grimbizis, G.F., Georgiou, I., Papadopoulos, N., Lazaros, L., Bontis, J.N., Tarlatzis, B.C., 2010. HOX A10 and HOX A11 mutation scan in congenital malformations of the female genital tract. Reprod. Biomed. Online 21, 126–132. MacLaughlin, D.T., Teixeira, J., Donahoe, P.K., 2001. Perspective: reproductive tract development – new discoveries and future directions. Endocrinology 142, 2167–2172. Mahon, K.A., Westphal, H., Gruss, P., 1988. Expression of homeobox gene Hox 1.1 during mouse embryogenesis. Development 104 (Suppl.), 187–195. Mortlock, D.P., Innis, J.W., 1997. Mutation of HOXA13 in hand-footgenital syndrome. Nat. Genet. 15, 179–180. Mueller, G.C., Hussain, H.K., Smith, Y.R., Quint, E.H., Carlos, R.C., Johnson, T.D., Delancey, J.O., 2007. Mullerian duct anomalies: comparison of MRI diagnosis and clinical diagnosis. AJR Am. J. Roentgenol. 189, 1294–1302. Naora, H., Montz, F.J., Chai, C.Y., Roden, R.B., 2001. Aberrant expression of homeobox gene HOXA7 is associated with mullerianlike differentiation of epithelial ovarian tumors and the generation of a specific autologous antibody response. Proc. Natl Acad. Sci. U.S.A. 98, 15209–15214. Pellegrini, M., Pantano, S., Lucchini, F., Fumi, M., Forabosco, A., 1997. Emx2 developmental expression in the primordia of the reproductive and excretory systems. Anat. Embryol. (Berl) 196, 427– 433.
HOXA7 and HOXA9 mutations in Chinese women with Müllerian duct abnormalities Rall, K., Barresi, G., Walter, M., Poths, S., Haebig, K., Schaeferhoff, K., Schoenfisch, B., Riess, O., Wallwiener, D., Bonin, M., Brucker, S., 2011. A combination of transcriptome and methylation analyses reveals embryologically-relevant candidate genes in MRKH patients. Orphanet J. Rare Dis. 6, 32. Saravelos, S.H., Cocksedge, K.A., Li, T.C., 2008. Prevalence and diagnosis of congenital uterine anomalies in women with reproductive failure: a critical appraisal. Hum. Reprod. Update 14, 415– 429. Sultan, C., Biason-Lauber, A., Philibert, P., 2009. Mayer-RokitanskyKuster-Hauser syndrome: recent clinical and genetic findings. Gynecol. Endocrinol. 25, 8–11. Taylor, H.S., 2008. Endocrine disruptors affect developmental programming of HOX gene expression. Fertil. Steril. 89, e57–e58. Taylor, H.S., Vanden Heuvel, G.B., Igarashi, P., 1997. A conserved Hox axis in the mouse and human female reproductive system: late establishment and persistent adult expression of the Hoxa cluster genes. Biol. Reprod. 57, 1338–1345.
599
Wu, K., Chang, X., Wei, D., Xu, C., Qin, Y., Chen, Z.J., 2013. Lack of association of WNT5A mutations with Mullerian duct abnormalities. Reprod. Biomed. Online 26, 164–167. Zhu, Y., Shi, Y., Chen, Z., You, L., Wang, L., Yang, Z., 2012. Effect of Mullerian duct abnormalities on fertility outcomes and mutation of HOXA13 genes. Prog. Obstet. Gynecol. 21, 197–199.
Declaration: The authors report no financial or commercial conflicts of interest.
Received 11 February 2014; refereed 3 July 2014; accepted 3 July 2014.
w w w. s c i e n c e d i r e c t . c o m w w w. r b m o n l i n e . c o m
ARTICLE
Mutation screening of HOXA7 and HOXA9 genes in Chinese women with Müllerian duct abnormalities Xinxia Chen a,b, Yulan Mu a, Chunyan Li a, Guangyu Li a, Hui Zhao c,d, Yingying Qin a, Zi-Jiang Chen a,e,* a
Center for Reproductive Medicine, Provincial Hospital Affiliated to Shandong University, National Research Center for Assisted Reproductive Technology and Reproductive Genetics, The Key Laboratory for Reproductive Endocrinology of Ministry of Education, Shandong Provincial Key Laboratory of Reproductive Medicine, 324 Jingwu Road, Jinan 250021, China; b School of Nursing, Shandong University, 44 Wenhua Road, Jinan 250012, China; c School of Biomedical Sciences, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong Special Administrative Region, China; d School of Biomedical Sciences Core Laboratory, The Chinese University of Hong Kong Shenzhen Research Institute, 10 Yuexing Erdao, Nanshan District, Shenzhen 518000, China; e Center for Reproductive Medicine, Renji Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai Key Laboratory for Assisted Reproduction and Reproductive Genetics, 145 Middle Shandong Rd, Shanghai 200001, China * Corresponding author.
E-mail address: [email protected] (Z-J Chen). Dr Xinxia Chen received her MD from Shandong University, Shandong, China, in 2007. She is now pursuing her PhD at the center for Reproductive medicine of Shandong University, one of the largest IVF centers in China and is a pioneer in IVF, oocyte cryopreservation and reproductive endocrinology and genetic diseases. Xinxia Chen has received both clinical and laboratory training.
Abstract HOXA genes in groups 7–13 have been proven to play a role in determining positional identity along the genitalia axis. The aim of the present study was to explore the relationship between HOXA7 and HOXA9 mutations and Müllerian duct abnormalities (MDA). One hundred and ninety-two Chinese patients with MDA abnormalities and 192 healthy controls were recruited. All coding regions of HOXA7 and HOXA9 were amplified and sequenced directly. Rs2301721 and rs2301720 in HOXA7, rs35355140 and rs7810502 in HOXA9 were identified in patients with MDA and controls. One rare single nucleotide polymorphism rs189587233 in 3′ UTR of HOXA9 gene was detected in one patient with didelphic uterus and absent in the 192 controls. This polymorphism, however, is known to exist in the normal Chinese population. Our results indicated that variants in the HOXA7 and HOXA9 genes were not common in Chinese women with Müllerian duct abnormalities. © 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.rbmo.2014.07.012 1472-6483/© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
596
X Chen et al.
KEYWORDS: HOXA7, HOXA9, Müllerian duct abnormalities, single nucleotide polymorphisms
Introduction Müllerian ducts, also named paramesonephric ducts, are the primordial origin of the female internal reproductive system. With the absence of anti-Müllerian hormone, Müllerian ducts develop into the upper part of the vagina, cervix, uterus and oviducts (MacLaughlin et al., 2001). Normal development of the embryonic female reproductive system includes three stages: formation of Müllerian ducts, fusion of both ducts and absorption of septum. In response, Müllerian-duct abnormalities (MDA) mainly consist of three types: failure of organogenesis, resulting in Mayer–Rokitansky–Kuster–Hauser (MRKH) syndrome or unicornuate uterus; failure of fusion, leading to didelphic or bicornuate uterus; and failure of septal absorption, causing uterine or vaginal septum (Grimbizis et al., 2013). The prevalence of MDA is estimated to be 5.5% in the general population and 25% in infertile women with a history of spontaneous abortion (Chan et al., 2011; Saravelos et al., 2008). They are often accompanied by renal defects (25%), musculoskeletal (10–12%) and, rarely cardiac or auditory anomalies (Mueller et al., 2007). Several factors have been suggested to contribute to the cause of MDA, such as environmental factors, intrauterine exposure to radiation or drugs and chromosomal abnormalities (Block et al., 2000; Taylor, 2008). Despite the fact that the MDA are sporadic and multifactorial, genetic factors still play an important role in this disease. Some candidate genes have been screened to evaluate their roles in the malformation, such as LHX1, PAX2, PBX1 and the WNT family (Abecasis et al., 2012; Dang et al., 2012; Sultan et al., 2009; Wu et al., 2013), but few could be proven pathogenically. The homeobox (HOX) family includes 39 genes arranged in four clusters termed HOX A, B, C and D on different chromosomes. Highly conserved between species, homeodomain proteins direct the early morphogenesis and spatial identity along the anterior–posterior axis. HOXA7-13 genes play a role in the development of cells along the genitalia axis (Du and Taylor, 2004; Naora et al., 2001; Taylor et al., 1997). HOXA7 is expressed specifically in regions of the neuoectoderm and mesoderm in mouse embryos, and the epithelium of fallopian tubes and endometrium in humans (Mahon et al., 1988; Naora et al., 2001). Previous studies have revealed that patients carrying deletions located at chromosome 7p15 or 7p21.1-p14.3, covering the HOXA7 gene, have either features similar to the hand–foot–genital syndrome or severe developmental delay (Fryssira et al., 2011; Jun et al., 2011). HOXA9 is expressed in the primordia of fallopian tubes during embryogenesis and oviducts in adults. Aberrant expression and methylation of HOXA9 was found in patients with MRKH (Rall et al., 2011). HOXA genes have long been considered candidates for MDA, owing to the fundamental role played in embryological genitalia and reproduction (Burel et al., 2006; Cheng et al., 2011; Ekici et al., 2013; Lalwani et al., 2008; Liatsikos et al., 2010). Few studies had been conducted on HOXA7 and HOXA9 genes, except for mutational screening in six patients with MRKH (Burel et al., 2006). In this study, 192 Chinese patients with MDA were examined to elucidate
whether HOXA7 and HOXA9 mutation was causative for the malformation.
Materials and methods A total of 192 patients with MDA and 192 controls were recruited among patients attending the Center for Reproductive Medicine, Provincial Hospital affiliated to Shandong University between January 2009 and December 2012 because of infertility. All 384 participants were Han Chinese, with 46, XX karyotype and normal secondary sexual characteristics. Previous screening in HOXA11 and HOXA13 genes was carried out, and no causative mutations were found in all participants (Chen et al., 2014; Zhu et al., 2012). The diagnosis of MDA was confirmed through transvaginal ultrasonography, hysteroscopy and hysterosalpingogram. The category of cases included formation defect: uterine agenesis (n = 15) and unicornuate uterus (n = 53); fusion defect: didelphic uterus (n = 41) and bicornuate uterus (n = 39); and absorption defect: septate uterus (n = 44). Clinical characteristics of the patients are shown in Table 1. One hundred and ninety-two controls were women from couples who were infertile due to male or tubal factors. Ultrasonography, hysteroscopy and hysterosalpingogram were used to exclude reproductive tract defects. The study was approved by the Institutional Review board of Reproductive medicine of Shandong University on 10 February, 2013 (IRB reference no. 19). Informed consent was obtained from each participant. Genomic DNA was extracted from peripheral blood samples, and all exons of HOXA7 and HOXA9 were amplified by polymerase chain reaction (PCR). Four pairs of primers were designed, and the PCR conditions are shown as Table 2. The PCR products were first analysed by agarose gel electrophoresis and then automatically sequenced (ABI PRISM 310; Applied Biosystems). For any novel variants, PCR was repeated independently three times and the products were sequenced both forwards and reverse. Chi-squared test was used for statistical analysis, and P < 0.05 was considered statistically significant. Table 1 Clinical characteristics of 192 patients with Müllerianduct abnormalities. Characteristic Total number of patients Primary infertility Spontaneous abortion One spontaneous abortion Recurrent spontaneous abortion Formation defect Fusion defect Absorption defect Kidney deformities Unilateral kidney agenesis Ectopic kidney
n (%) 192 109 41 8 33 68 80 44 4 3 1
(56.77) (21.35) (4.17) (17.19) (35.42) (41.67) (22.92) (2.08) (1.56) (0.52)
HOXA7 and HOXA9 mutations in Chinese women with Müllerian duct abnormalities
597
Table 2 Primers and polymerse chain reaction conditions for exons of HOXA7 and HOXA9. Gene HOXA7
Exon
Primer
Temperature (°C)
Length (bp)
Exon 1
CACCTGTGAGGACTGCTGAGAT GCTACCGGCTCGCAACAG TCTGGGACAGCAGCCTAACG GGGTGGGTAGAGTGCAGGTTG CCACCAAGTTGTTACATGAAATCTG CGAAGGCAGGCTCGAGAGA TGCCAGGGTTCCATTGTGT GGTTTGCCTTGGAAAAGATGT
57
689
60
550
56
750
58
555
Exon 2 HOXA9
Exon 1 Exon 2
Table 3 Gene
HOXA7
HOXA9
Variants of the HOXA7 and HOXA9 genes in Chinese patients with Müllerian duct abnormalities and controls.a Location
Variant
Exon 1
rs2301721
Exon 1
rs2301720
Exon 1
rs35355140
3′ UTR
rs7810502
3′ UTR
rs189587233
Genotype frequency
Allele frequency
Genotype
MDA n (%)
Control n (%)
Allele
MDA (%)
Control (%)
AA AG GG CC AC AA GG TG TT TT CT CC CC CG
151 38 3 151 38 3 133 54 5 38 136 18 191 1
151 35 6 151 35 6 121 62 9 49 126 17 192 0
A G
88.5 11.5
87.8 12.2
A C
88.5 11.5
87.8 12.2
G T
83.3 16.7
79.2 20.8
T C
55.2 44.8
58.3 41.7
C G
99.7 0.3
100.0 0.0
(78.6) (19.8) (1.6) (78.6) (19.8) (1.6) (69.3) (28.1) (2.6) (19.8) (70.8) (9.4) (99.5) (0.5)
(78.6) (18.2) (3.1) (78.6) (18.2) (3.1) (63.0) (32.3) (4.7) (25.5) (65.6) (8.9) (100.0) (0.0)
MDA = Müllerian duct abnormalities. a No statistically significant differences were found.
Results All exons and exon-intron boundaries of HOXA7 and HOXA9 were sequenced. Five known single-nucleotide polymorphisms were found: rs2301721 and rs2301720 in exon 1 of HOXA7; rs35355140 in exon 1 of HOXA9, rs7810502 and rs189587233 in 3′ UTR of HOXA9. The former four singlenucleotide polymorphisms were identified in both cases and controls, whereas rs189587233 was only detected in one patient with didelphic uterus. Comparison of genotype and allelic frequencies between cases and controls showed no statistically significant difference. Results are shown in Table 3.
Discussion Different genes are involved in Müllerian-duct development in animal models. These include genes essential for the formation of reproductive ducts (e.g. EMX2V, WNT family, LHX1, DACH1/DACH2 and PAX2) (Davis et al., 2008; Pellegrini et al., 1997; Wu et al., 2013); genes responsible for the regression of Müllerian duct in males (e.g. AMH and its receptor AMHR2)
(Behringer et al., 1994); and genes participating in the continuing development of female Müllerian duct (e.g. the HOX family) (Du and Taylor, 2004). Expression of the HOXA genes during the formation of Müllerian duct was highly conserved. HOXA13 was the first gene to be identified as causative for human reproductive tract malformation (Mortlock and Innis, 1997). Later, investigations focused on HOXA10, HOXA11, HOXA13, HOXA7 and HOXA9 genes (Burel et al., 2006; Cheng et al., 2011; Ekici et al., 2013; Lalwani et al., 2008; Liatsikos et al., 2010). Novel missense and truncation variants were identified in HOXA10, which were preliminarily verified or predicted to be potentially causative (Cheng et al., 2011; Ekici et al., 2013). Mutations in HOXA13 were discovered to be responsible for hand–foot–genital syndrome and Guttmacher syndrome (Goodman et al., 2000; Jorgensen et al., 2010). No evidence, however, was found for an association between HOXA11 mutation and MDA (Burel et al., 2006; Chen et al., 2014; Liatsikos et al., 2010). The shift of HOXA9 expression from oviducts to the uterus was observed in the T-shaped uterus after diethylstilbestrol exposure (Block et al., 2000). It was presumed that ectopic expression of HOXA9 induced by internal or external disturbances might contribute to the pathogenesis of MDA. Rall et al. (2011), however, reported that
598 patients with MRKH exhibited distinct expression of HOXA5 and HOXA9 owing to decreased methylation level. It provides reasons to pursue other epigenetic mechanisms regulating the development of female reproductive tract. In the present study, the coding regions of HOXA7 and HOXA9 were sequenced, but no causative variants were identified. This is consistent with a previous study, in which no mutation or polymorphism was found in the coding sequence of HOXA7 and HOXA9 in six patients with MRKH (Burel et al., 2006). The only perturbation found in the MDA group but not in controls was rs189587233 in 3′ UTR of the HOXA9 gene. This polymorphism, however, was previously detected with 1% frequency in Southern Han Chinese from the 1000 Genomes Project (Abecasis et al., 2012), and 0.5% in the Northern Han population from which one sample carried G allele for rs189587233 in the present study. Therefore, it is unlikely to be causative for MDA. In summary, our results suggest that mutations in the HOXA7 and HOXA9 genes were not common in Chinese women with MDA. Future studies in larger cohorts from different ethnic populations are required to elucidate the role of HOX genes in the development of reproductive malformations.
Acknowledgements The authors thank Yuehong Bian, Shizhen Su, Changming Zhang, Yongzhi Cao from the center for Reproductive Medicine, Provincial Hospital Affiliated to Shandong University, and Tao Li from Shandong Provincial Hospital for technical support. The authors acknowledge receipt of the following financial support for the research, authorship, and/or publication of this article: grant from the National Basic Research Program of China [973 program-2012CB944700]; the National Natural Science Foundation of China [81270662, 81370687]; Foundation for the Author of National Excellent Doctoral Dissertation of PR China (201078); Independent Innovation Foundation of Shandong University (IIFSDU, 2012TS130).
References Abecasis, G.R., Auton, A., Brooks, L.D., Depristo, M.A., Durbin, R.M., Handsaker, R.E., Kang, H.M., Marth, G.T., McVean, G.A., 2012. An integrated map of genetic variation from 1,092 human genomes. Nature 491, 56–65. Behringer, R.R., Finegold, M.J., Cate, R.L., 1994. Mullerian-inhibiting substance function during mammalian sexual development. Cell 79, 415–425. Block, K., Kardana, A., Igarashi, P., Taylor, H.S., 2000. In utero diethylstilbestrol (DES) exposure alters Hox gene expression in the developing mullerian system. FASEB J. 14, 1101–1108. Burel, A., Mouchel, T., Odent, S., Tiker, F., Knebelmann, B., Pellerin, I., Guerrier, D., 2006. Role of HOXA7 to HOXA13 and PBX1 genes in various forms of MRKH syndrome (congenital absence of uterus and vagina). J. Negat. Results Biomed. 5, 4. Chan, Y.Y., Jayaprakasan, K., Zamora, J., Thornton, J.G., RaineFenning, N., Coomarasamy, A., 2011. The prevalence of congenital uterine anomalies in unselected and high-risk populations: a systematic review. Hum. Reprod. Update 17, 761–771. Chen, X., Li, G., Qin, Y., Cui, Y., You, L., Chen, Z.J., 2014. Mutations in HOXA11 are not responsible for Mullerian duct anomalies in Chinese patients. Reprod. Biomed. Online 28, 739–742.
X Chen et al. Cheng, Z., Zhu, Y., Su, D., Wang, J., Cheng, L., Chen, B., Wei, Z., Zhou, P., Wang, B., Ma, X., Cao, Y., 2011. A novel mutation of HOXA10 in a Chinese woman with a Mullerian duct anomaly. Hum. Reprod. 26, 3197–3201. Dang, Y., Qin, Y., Tang, R., Mu, Y., Li, G., Xia, M., Chen, Z.J., 2012. Variants of the WNT7A gene in Chinese patients with mullerian duct abnormalities. Fertil. Steril. 97, 391–394. Davis, R.J., Harding, M., Moayedi, Y., Mardon, G., 2008. Mouse Dach1 and Dach2 are redundantly required for Mullerian duct development. Genesis 46, 205–213. Du, H., Taylor, H.S., 2004. Molecular regulation of mullerian development by Hox genes. Ann. N. Y. Acad. Sci. 1034, 152–165. Ekici, A.B., Strissel, P.L., Oppelt, P.G., Renner, S.P., Brucker, S., Beckmann, M.W., Strick, R., 2013. HOXA10 and HOXA13 sequence variations in human female genital malformations including congenital absence of the uterus and vagina. Gene 518, 267– 272. Fryssira, H., Makrythanasis, P., Kattamis, A., Stokidis, K., Menten, B., Kosaki, K., Willems, P., Kanavakis, E., 2011. Severe developmental delay in a patient with 7p21.1-p14.3 microdeletion spanning the TWIST gene and the HOXA gene cluster. Mol. Syndromol. 2, 45–49. Goodman, F.R., Bacchelli, C., Brady, A.F., Brueton, L.A., Fryns, J.P., Mortlock, D.P., Innis, J.W., Holmes, L.B., Donnenfeld, A.E., Feingold, M., Beemer, F.A., Hennekam, R.C., Scambler, P.J., 2000. Novel HOXA13 mutations and the phenotypic spectrum of handfoot-genital syndrome. Am. J. Hum. Genet. 67, 197–202. Grimbizis, G.F., Gordts, S., Di Spiezio Sardo, A., Brucker, S., De Angelis, C., Gergolet, M., Li, T.C., Tanos, V., Brolmann, H., Gianaroli, L., Campo, R., 2013. The ESHRE/ESGE consensus on the classification of female genital tract congenital anomalies. Hum. Reprod. 28, 2032–2044. Jorgensen, E.M., Ruman, J.I., Doherty, L., Taylor, H.S., 2010. A novel mutation of HOXA13 in a family with hand-foot-genital syndrome and the role of polyalanine expansions in the spectrum of Mullerian fusion anomalies. Fertil. Steril. 94, 1235–1238. Jun, K.R., Seo, E.J., Lee, J.O., Yoo, H.W., Park, I.S., Yoon, H.K., 2011. Molecular cytogenetic and clinical characterization of a patient with a 5.6-Mb deletion in 7p15 including HOXA cluster. Am. J. Med. Genet. A 155A, 642–647. Lalwani, S., Wu, H.H., Reindollar, R.H., Gray, M.R., 2008. HOXA10 mutations in congenital absence of uterus and vagina. Fertil. Steril. 89, 325–330. Liatsikos, S.A., Grimbizis, G.F., Georgiou, I., Papadopoulos, N., Lazaros, L., Bontis, J.N., Tarlatzis, B.C., 2010. HOX A10 and HOX A11 mutation scan in congenital malformations of the female genital tract. Reprod. Biomed. Online 21, 126–132. MacLaughlin, D.T., Teixeira, J., Donahoe, P.K., 2001. Perspective: reproductive tract development – new discoveries and future directions. Endocrinology 142, 2167–2172. Mahon, K.A., Westphal, H., Gruss, P., 1988. Expression of homeobox gene Hox 1.1 during mouse embryogenesis. Development 104 (Suppl.), 187–195. Mortlock, D.P., Innis, J.W., 1997. Mutation of HOXA13 in hand-footgenital syndrome. Nat. Genet. 15, 179–180. Mueller, G.C., Hussain, H.K., Smith, Y.R., Quint, E.H., Carlos, R.C., Johnson, T.D., Delancey, J.O., 2007. Mullerian duct anomalies: comparison of MRI diagnosis and clinical diagnosis. AJR Am. J. Roentgenol. 189, 1294–1302. Naora, H., Montz, F.J., Chai, C.Y., Roden, R.B., 2001. Aberrant expression of homeobox gene HOXA7 is associated with mullerianlike differentiation of epithelial ovarian tumors and the generation of a specific autologous antibody response. Proc. Natl Acad. Sci. U.S.A. 98, 15209–15214. Pellegrini, M., Pantano, S., Lucchini, F., Fumi, M., Forabosco, A., 1997. Emx2 developmental expression in the primordia of the reproductive and excretory systems. Anat. Embryol. (Berl) 196, 427– 433.
HOXA7 and HOXA9 mutations in Chinese women with Müllerian duct abnormalities Rall, K., Barresi, G., Walter, M., Poths, S., Haebig, K., Schaeferhoff, K., Schoenfisch, B., Riess, O., Wallwiener, D., Bonin, M., Brucker, S., 2011. A combination of transcriptome and methylation analyses reveals embryologically-relevant candidate genes in MRKH patients. Orphanet J. Rare Dis. 6, 32. Saravelos, S.H., Cocksedge, K.A., Li, T.C., 2008. Prevalence and diagnosis of congenital uterine anomalies in women with reproductive failure: a critical appraisal. Hum. Reprod. Update 14, 415– 429. Sultan, C., Biason-Lauber, A., Philibert, P., 2009. Mayer-RokitanskyKuster-Hauser syndrome: recent clinical and genetic findings. Gynecol. Endocrinol. 25, 8–11. Taylor, H.S., 2008. Endocrine disruptors affect developmental programming of HOX gene expression. Fertil. Steril. 89, e57–e58. Taylor, H.S., Vanden Heuvel, G.B., Igarashi, P., 1997. A conserved Hox axis in the mouse and human female reproductive system: late establishment and persistent adult expression of the Hoxa cluster genes. Biol. Reprod. 57, 1338–1345.
599
Wu, K., Chang, X., Wei, D., Xu, C., Qin, Y., Chen, Z.J., 2013. Lack of association of WNT5A mutations with Mullerian duct abnormalities. Reprod. Biomed. Online 26, 164–167. Zhu, Y., Shi, Y., Chen, Z., You, L., Wang, L., Yang, Z., 2012. Effect of Mullerian duct abnormalities on fertility outcomes and mutation of HOXA13 genes. Prog. Obstet. Gynecol. 21, 197–199.
Declaration: The authors report no financial or commercial conflicts of interest.
Received 11 February 2014; refereed 3 July 2014; accepted 3 July 2014.