Mutational Analysis of the 5′ Leader Region of Simian Foamy Virus Type 1

Virology 274, 203–212 (2000) doi:10.1006/viro.2000.0423, available online at http://www.idealibrary.com on

Mutational Analysis of the 5⬘ Leader Region of Simian Foamy Virus Type 1 Jeonghae Park and Ayalew Mergia 1 Department of Pathobiology, College of Veterinary Medicine, University of Florida, Gainesville, Florida 32610 Received March 15, 2000; returned to author for revision May 1, 2000; accepted May 12, 2000 The sequence within the 5⬘ untranslated region of the retroviral genome contains important cis elements for many steps in viral replication. There is limited information available on the role of this region in foamy virus replication. Similar to other retroviruses, the 5⬘ untranslated region of foamy viruses predicts extensive RNA secondary structure. Serial mutations that could change parts of the predicted secondary structure were introduced in the 5⬘ leader sequence including the R-U5 region of simian foamy virus type 1 (SFV-1) to investigate their role in virus genome packaging and virus replication. Point mutations in the R-U5 regions at nucleotide positions 7–12 (I), 241–243 (B), and 256–257 (D) had no effect on virus replication. Base substitution mutation at positions 193–195 (C), however, severely impaired virus replication. Deletion of sequences in the leader region, between the primer-binding site and the gag gene, at positions 364–399 (d1), 397–435 (d2), or 364–435 (d3), which included sequences for RNA genome dimerization, also blocked SFV-1 replication. Interestingly, none of these mutations affected genome packaging or the synthesis of viral transcripts, suggesting that a step(s) of virus replication following packaging is affected. The region between the primer-binding site and the gag gene, therefore, is not essential for foamy virus genome packaging. Furthermore, the cis-acting elements for genome dimerization and packaging appear to be localized in separate regions for foamy viruses. © 2000 Academic Press

Flugel, 1991; Yu et al., 1996a). Translation for pro-pol products commences at an initiator ATG codon located at the 5⬘ end of the pro gene (Enssle et al., 1996; Lochelt and Flugel, 1996; Mergia et al., 1991; Muranyi and Flugel, 1991). Retroviruses have Cys-His motifs in the nucleocapsid domain of the Gag protein necessary for nucleic acid binding (reviewed in Berkowitz et al., 1996; Linial and Miller, 1990). Interestingly, foamy viruses lack this motif, which is present in all other retroviruses (Flugel et al., 1987; Herchenroder et al., 1994; Kupiec et al., 1991; Mergia and Luciw, 1991; Renne et al., 1992). In the corresponding region, foamy viruses contain three Gly-Argrich sequences, and one of these has been shown to be required for nucleic acid binding and virus replication (Yu et al., 1996b). Inspection of the genome of foamy virus particles reveals large amounts of double-stranded DNA and it is estimated that one of five virus particles contains the DNA genome (Yu et al., 1996a). Recently, evidence was established demonstrating that DNA isolated from the virus particle is infectious, suggesting that foamy viruses have a distinct replication pathway (Yu et al., 1999). The sequence within the 5⬘ untranslated leader region of retroviral RNA contains important cis elements for many steps in viral replication. This region is complex, with specific sequences that have features of secondary structures. Sequences throughout the 5⬘ untranslated region have been implicated in viral RNA encapsidation, diploid genome dimerization, and efficient gag translation (Berkowitz et al., 1996; Linial and Miller, 1990; Miele

INTRODUCTION Foamy viruses are a unique group of viruses that belong to a genus of retroviruses. These viruses can infect a variety of cell types from different species and induce extensive cytopathology in cell culture (Hooks and Detrick-Hooks, 1981; Mergia et al., 1996). However, foamy viruses do not cause disease in naturally or experimentally infected animals (Hooks and Detrick-Hooks, 1981). For these reasons, it is suggested that foamy viruses would be ideal viral vectors for gene therapy. This notion has recently enhanced foamy virus research and as a result surprising features of foamy virus replication have been uncovered. Foamy virus replication appears to be regulated by mechanisms that involve differential gene expression. A promoter located at the 3⬘ end of env controls the expression of the early transcripts (regulatory genes) and the LTR regulates the expression of the late transcripts (structural genes) (Campbell et al., 1994; Lochelt et al., 1994; Mergia, 1994). The pro-pol gene product, in which the predicted amino acid sequence is in a different frame from that of gag, is translated from a subgenomic message and lacks the Gag domain (Bodem et al., 1996; Yu et al., 1996a). The amount of this subgenomic message is very low and can be detected only by polymerase chain reaction (PCR) (Bodem et al., 1996; Mergia et al., 1991; Muranyi and

1 To whom correspondence and reprint requests should be addressed. Fax: (352) 392-9704. E-mail: [email protected].

203

0042-6822/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

204

PARK AND MERGIA

et al., 1996). Similar to other retroviruses, the 5⬘ untranslated region of foamy viruses predicts an extensive RNA secondary structure (Fig. 1). The R-U5 and leader region between the primer-binding sites and the gag gene are highly conserved in all primate foamy viruses characterized thus far (Herchenroder et al., 1994; Mergia and Luciw, 1991). A palindromic sequence (UCCCUAGGGA) present in the leader region of all the primate foamy viruses is reported to be important for the dimerization of the diploid genome of human foamy virus (HFV) (Erlwein et al., 1997). The splice donor site involved in generating subgenomic messages is located 51 bases downstream from the transcription initiation site within R, indicating that the sequence between the splice donor site and the start of the gag gene is important in genome packaging (Muranyi and Flugel, 1991). Recent studies on foamy virus vector construction suggest that the 5⬘ untranslated region is critical for gene transduction, similar to other retroviruses (Wu et al., 1998). Additional sequences required for transfer of foamy virus vector are found in the 3⬘ region of the pol gene (Erlwein et al., 1998; Heinkelein et al., 1998; Wu et al., 1998). Whether these cis-acting elements are required for foamy virus genome encapsidation remains to be determined. In order to gain insights into mechanisms of foamy virus genome packaging and replication, we have introduced mutations in the putative secondary structure of the 5⬘ untranslated region of simian foamy virus type 1 (SFV-1) and analyzed the effects on viral transcripts, packaging, and virus production. RESULTS Cloning of an indicator cell line for titration of SFV-1 Yu and Linial (1993) developed a novel sensitive method for quantifying HFV based on the notion that the foamy virus transactivator is necessary for virus replication and gene expression directed by the viral LTR promoter. They established a cell line (FAB) containing a Lac Z gene under the control of the HFV LTR. This cell line expresses ␤-galactosidase (␤-Gal) only in the presence of the HFV tas gene. When FAB cells are infected with HFV, they express ␤-Gal as a result of virus-mediated Tas production and subsequent activation of the promoter controlling the indicator gene. Thus, the number of blue cells can reflect viral titer. Since the SFV-1 tas gene does not transactivate gene expression directed by the HFV LTR (Mergia et al., 1992), it is necessary to develop a similar indicator cell line for titering SFV-1. The plasmid construct (pU3␤-gal/zeo) containing the SFV-1 LTR promoter expressing the LacZ gene and zeocin-resistant gene for selection under the control of SV-40 promoter was transfected into L-929, COS-7, and CRFK cell lines. Cells that survived zeocin selections were further processed for the presence of the LacZ gene by PCR and for ␤-Gal expression by infection with SFV-1. All mock-in-

fected COS-7 and CRFK clones showed a high background with low-level-intensity blue cells. Mock-infected L-929 clones showed no background of ␤-Gal activity. Of 12 L-929 cell clones tested, 1 (LBZ4) expressed ␤-Gal as observed by intense blue color following SFV-1 infection. The LBZ4 cell line was selected to titer SFV-1. Replication analysis of SFV-1 mutants To establish a basis for understanding the mechanisms of genome packaging and replication of SFV-1, we introduced mutations in the R-U5 regions of the LTR and in the leader region between the primer-binding site (PBS) and the start of the gag gene. The sequence of R-U5 plus the leader region between the PBS and the start of the gag gene predicts a stable, complex RNA secondary structure (Fig. 1). Point mutations were introduced in the R-U5 region that could change parts of the structure as shown in Fig. 1. Small deletions were created in the region between the PBS and the gag gene. To determine the effect of these mutations on virus replications, wild-type or mutant SFV-1 proviral DNA was transfected into 293 cells. The cultures were maintained for 12 days and monitored every 2 days for virus replication by measuring virus-associated reverse transcriptase (RT) activity from the supernatants and observing cytopathic effect under a light microscope. Mutants I, B, and D, which had base substitutions at positions 7–12, 242–243, and 256–257, respectively, showed levels of virus production similar to that of the wild type, with RT values reaching a peak at 8 to 10 days posttransfection (Fig. 2A). Transfected cells were observed for up to 12 days for the appearance of cytopathic effect. Cells showed typical cytopathology of foamy virus infection as described previously (Mergia et al., 1996). The extent of cytopathology and the rate at which it occurred among cells transfected with mutants I, B, or D initially varied but reached levels similar to those for the wild type at 8 to 10 days, corresponding to peak RT values (Fig. 2C). Interestingly, supernatants obtained from cells transfected with either a base substitution mutant at positions 193–195 (C) or three deletion mutants at positions 364–399 (d1), 397– 435 (d2), and 364–435 (d3) had no RT activity. Furthermore, no cytopathology was observed in the 12 days posttransfection with these mutants, indicating that virus replication was impaired. Virus titer from either wild-type or mutant transfected cells was determined by infecting the indicator LBZ4 cells. Culture supernatants of 293 cells harvested 4 days after transfection were used to quantify SFV-1 by infecting LBZ4 cells and counting ␤-Gal-positive cells. Cells infected with I, B, or D mutants had numbers of ␤-Galpositive cells equivalent to those for wild-type virusinfected cells, confirming the RT and the cytopathic results. No blue cells were observed when LBZ4 cells

5⬘ LEADER SEQUENCE OF SFV-1

205

FIG. 1. (A) Schematic representation of SFV-1 provirus. (B) The predicted RNA secondary structure of the R-U5 and leader region between the primer-binding site and the gag gene of SFV-1. The secondary structure of SFV-1 RNA was generated by Zucker’s Mfold program (http:// www.ibc.wustl.edu/⬃zucker/rna/foldml.cgi). The secondary model shown here has the lowest free energy among 16 proposed structures predicted by the Mfold program. The calculated free energy is ⫺110.2 kcal. The regions of the predicted stem-loops used to introduce point mutations are boxed. Point mutations were introduced at both the 5⬘ and the 3⬘ R-U5 regions of the provirus. The predicted structures before and after the introduction of the mutations are shown. Mutated nucleotides are indicated with asterisks. d1, d2, and d3 represent deletion mutants and the arrows indicate deleted regions.

were infected with supernatant harvested from C, d1, d2, or d3 transfected cells. The replicative properties of the mutant viruses were also assessed following cell-free infection. LBZ4 cells were infected with a multiplicity of infection of 0.05 of each mutant. Since no virus production was observed from cells transfected with mutants C, d1, d2, or d3, the total supernatant volumes collected were used to infect 293 cells. Culture medium was collected for 10 days at 2-day intervals and titers were determined by infecting the indicator cells. The mutants I, B, and D showed titers similar to that for the wild type, except that mutant I had a log higher virus production at

days 8 through 10 after infection (Fig. 2B). Although all collected supernatant from mutant C and the deletion mutants was used to infect 293 cells, none of the indicator cells were positive for ␤-Gal, indicating that these mutants failed to yield infectious virus particles. The patterns of replication in the infection and transfection systems are consistent and show that mutations in the R-U5 region at positions 7–12, 241–243, and 256–257 had no effect on virus replication. The site-specific mutations at positions 193–195 in the U5 region and the deletion mutations between the PBS and the start of the gag produced severe replication defects.

206

PARK AND MERGIA

FIG. 2. Replication and cytopathic effect of wild-type or mutant SFV-1 virus in transfected (A and C) and infected (B and D) cells. (A) Reverse transcriptase analysis of supernatants from cell cultures transfected with wild-type or mutant pSFV-1 at different time intervals. Reverse transcriptase was assayed under conditions optimized for foamy virus with Mn 2⫹ cations (Benzair et al., 1982). The reverse transcriptase activity is shown in counts per minute. Samples were harvested at the indicated time intervals in triplicate and assayed for reverse transcriptase. Less than 10% variation in replicate samples was observed. (B) Titer of cell-free wild-type or mutant SFV-1. Supernatants from transfected cells were harvested and infected to determine the properties of virus replication. Virus was collected at different time intervals and titered using the indicator LBZ4 cell line and counting ␤-Gal-positive cells. The levels of cytopathic effect induced by the wild-type or the mutants SFV-1 in the transfected and infected cells are indicated in (C) and (D), respectively. Levels of cytopathology were scored as follows: ⫹, 5–10%; ⫹⫹, 10–30%; ⫹⫹⫹, 30–50%; ⫹⫹⫹⫹, 50–70%; ⫹⫹⫹⫹⫹, 70–100% cytopathic effect. The numbers at the top indicate days after DNA transfection or virus infection.

Viral RNA synthesis To determine whether viral RNA synthesis was affected in cells transfected with the mutants C, d1, d2, or d3, total RNA was extracted from 293 cells transfected with wild-type or mutant provirus DNA and analyzed on Northern blots by hybridization with the tas-orf2 region located between env and the LTR. As shown in Fig. 3, the probe hybridized to all foamy virus transcripts that were previously identified as the mRNAs of the full-length transcripts and the subgenomic env and tas-orf2 (Mergia et al., 1991). All mutants including those that did not yield infectious virus particles (C, d1, d2, and d3) showed the same pattern of viral transcripts. Furthermore, all of the mutants and the wild type synthesized similar levels of RNA, indicating that the mutations had no effect on virus

RNA transcription at 2 days posttransfection. Analysis of RNA at 5 days posttransfection of the wild-type and mutants I, B, and D showed similar RNA band patterns, with increased amounts of transcripts that encode the structural genes (Fig. 4A). None of the transcripts that encode the structural genes were detected by Northern analysis at 5 days posttransfection with RNA isolated from cells transfected with mutant C or the deletion mutants. These transcripts, however, were detected in these samples by reverse transcriptase-polymerase chain reaction (RT-PCR) (Fig. 4C). In RNA samples isolated from cells transfected with these mutants, less abundant 2.8-kb transcripts that represented the tas-orf2 messages were present at 5 days posttransfection. Taken together these results indicated that none of the

5⬘ LEADER SEQUENCE OF SFV-1

207

Analysis of virus particle-associated genome

FIG. 3. Northern analysis of SFV-1 transcripts from 293 cells harvested 2 days after transfection. Cells were transfected with wild-type (Wt) or mutant (I, B, C, D, d1, d2, or d3) SFV-1 provirus. M represents RNA isolated from mock transfected cells. Probe from the tas-orf2 region of SFV-1 was used to identify viral messages.

mutations introduced affected viral RNA synthesis. With the deletion mutants and mutant C, however, virus replication was impaired after RNA synthesis and as a result the next round of virus replication was blocked. As the number of nontransfected cells increased, the amount of total viral RNA recovered was diluted out at 5 days posttransfection, thereby limiting the detection of the transcripts that encode structural proteins, which were already less abundant to begin with at 2 days posttransfection. A faint band of the tas-orf2 messages represented viral RNA only from transfected cells, which was abundant at 2 days posttransfection.

To determine whether the viral genome produced from cells transfected with mutant provirus was encapsidated into virions, dot blot hybridization was performed with nucleic acid isolated from virus particles. Culture medium was harvested at day 2 or 5 posttransfection to isolate virions. Viral nucleic acids were blotted onto a nylon membrane and hybridized to a gag-specific 32Plabeled probe. As shown in Fig. 5A, at 2 days posttransfection, all mutants were positive for viral nucleic acid with the gag-specific probe, indicating packaging of the viral genome. The particle-associated nucleic acid was also detected by RNase protection assay from the culture supernatant of all mutants including C, d1, d2, and d3 (Fig. 6). RNAs from virus particles C, d1, d2, and d3 revealed similar levels of the expected protected fragments of 365, 271, 235, and 235 nucleotides, respectively, when hybridization was done with the 443-nucleotide riboprobe synthesized with pSPE-X vector. At 5 days posttransfection, the gag probe also hybridized to nucleic acid isolated from viral particles harvested from cells transfected with wild type or mutants I, B, or D (Fig. 5C). However, no gag-specific nucleic acid was observed from supernatant harvested at 5 days posttransfection from cells transfected with mutant C or the deletion mutants. These results corroborated the finding that these mutations impaired virus replication. The fact that gag-specific nucleic acid was observed in the virion at 2 days posttransfection but not at 5 days by dot blots indicates that packaging of the viral genome was not affected; rather a subsequent step(s) of SFV-1 replication was impaired, limiting the detection of the packaged genome at day 5.

FIG. 4. (A) Northern blot analysis of SFV-1 RNA from cells harvested 5 days after transfection. (B) Schematic representation of primers used for RT-PCR of SFV-1 RNA isolated 5 days after transfection. A primer (c) at the 5⬘ end of the pol gene was used to generate cDNA. Primers at the beginning of R (a) and the 3⬘ end of U5 (b) were used to amplify the cDNA. The position and size of the PCR product are indicated. (C) RT-PCR of cellular RNA harvested at 5 days from cells transfected with wild-type (Wt) or mutant C, d1, d2, or d3. M is RT-PCR from mock transfected cells. ⫹RT represents RT-PCR in the presence of reverse transcriptase and ⫺RT in the absence of the enzyme.

208

PARK AND MERGIA

contained viral nucleic acid as determined with gagspecific probe, indicating packaging of the viral genome. Therefore, these mutations affected steps of virus replication following packaging. Sequences at the 3⬘ end of the pol gene and the 5⬘ untranslated region are critical for foamy virus vector construction (Erlwein et al., 1998; Heinkelein et al., 1998; Wu et al., 1998). However, the precise cis-acting element(s) for encapsidation of the viral genome is not defined. For other retroviruses, the leader region located between the primer-binding sites and the start of the gag gene is critical for packaging of the genome (Berkowitz

FIG. 5. Dot blot analysis of SFV-1 nucleic acids from virions isolated 2 (A) and 5 (C) days after transfection. Nucleic acids isolated from cell-free virus particles were subjected to dot blot analysis with gagspecific probe. Each sample represents nucleic acid from virions isolated from an equivalent amount of culture supernatants. Signals of viral nucleic acids were quantified by image analysis using Image Store 7500 (Ultra Violet Product Ltd., San Gabriel, CA) and are expressed as a percentage relative to the wild-type value (B and D). Titer of virus particles was expressed as a percentage of the wild-type titer.

DISCUSSION The 5⬘ untranslated region of foamy virus forms an extensive stable RNA secondary structure. There is only limited information available on the function of this region in foamy virus replication. To determine the role of this structure in foamy virus replication, we have introduced a series of mutations in the leader region including the R-U5 that potentially affect parts of the secondary structure. Among several base substitution mutations we created in the R-U5 region, alteration of the sequence at positions 193–195 of U5 severely impaired virus replication. Deletion of the sequences in the leader region at positions 364–399 and 397–435 also blocked SFV-1 replication. Although virus replication was impaired, these mutants synthesized both spliced and unspliced messages at levels similar to the wild type. Cell-free virions (harvested at 2 days posttransfection) of these mutants

FIG. 6. Analysis of RNA content of virions of wild-type or mutant SFV-1 by RNase protection experiments. (A) The 5⬘ end of the SFV-1 provirus that includes the LTR, the leader region, and the 5⬘ end of the gag gene with relevant restriction sites is shown. The probe used for protection is indicated by an arrow below the genome representation. (B) The products of protected RNAs were analyzed in 7 M urea–8% polyacrylamide gel. The first lane represents molecular markers in nucleotides. Lanes 2–10 are RNase-resistant products remaining after hybridization of the riboprobe to RNA isolated from virions of the wild-type (wt), mutant (I, B, C, D, d1, d2, or d3), or mock transfected cells (M). Lanes 11 and 12 represent RNase treated and untreated riboprobe, respectively.

5⬘ LEADER SEQUENCE OF SFV-1

et al., 1996; Linial and Miller, 1990). In HIV-1, there are two clearly defined packaging elements within the leader region. Deletions in the untranslated region of HIV between the major splice donor and the gag initiation codon identified a major cis-acting packaging signal sequence (Aldovini and Young, 1990; Clavel and Orenstein, 1990; Lever et al., 1989). For efficient encapsidation of the HIV-1 genome, sequences upstream of the splice donor site are also required (Kim and O’Rear, 1994; Paillart et al., 1996). Our results showed that deletion of SFV-1 sequences in the corresponding region had no effect on packaging; it had only a minor role, if any. In HIV-2 the packaging signal is also located in the leader region (McCann and Lever, 1997). However, in contrast to HIV-1, the sequence between the splice donor site and gag plays a lessor role in genome encapsidation and the major cis-acting packaging element is found to be immediately upstream of the 5⬘ splice donor site (McCann and Lever, 1997). Similarly, the encapsidation site for avian leukosis virus (ALV) lies upstream of the splice donor site (Katz et al., 1986; Sorge et al., 1983). The splice donor site for foamy virus is within R of the LTR and is located 51 bases downstream from the transcription initiation site (Muranyi and Flugel, 1991). We altered one of the stem structures in the R region upstream of the splice donor site (mutant I) by base substitutions, but this had no effect on virus replication and genome packaging. The sequence between the splice donor site and the gag start codon is considerably long compared to other retroviruses and may contain important cis-acting elements that are critical for virus replication. However, site-specific mutations introduced in the region between the splice donor and the primer-binding site also had no effect on genome packaging. The packaging signal for SFV-1 may lie in the R-U5 region where no mutations were introduced. Alternatively, since foamy viruses have a distinct replication pathway, our results may reflect the complexity and uniqueness of foamy virus genome encapsidation. Furthermore, it remains to be determined whether the sequences at the 3⬘ end of the pol gene are involved in foamy virus genome packaging. Dimerization is postulated to act as a positive signal for encapsidation of two genomic RNA molecules (Bieth et al., 1990; Darlix et al., 1990; Katoh et al., 1993; Prats et al., 1990). This process is also linked to reverse transcription and gag translation (Bieth et al., 1990; Panganiban and Fiore, 1988). For HFV RNA genome dimerization, three sites, including one that includes a palindromic sequence, are identified in the leader region between the primer-binding site and the gag gene (Erlwein et al., 1997). This region has also been identified to be critical for foamy virus vector construction (Wu et al., 1998). The mutant d1 that we created has a 36nucleotide deletion including the palindromic sequence. Mutant d2 has a deletion of 39 nucleotides immediately following the palindromic sequence and before the be-

209

ginning of the gag initiation codon. The fact that our results showed genome encapsidation with these mutants indicates packaging of the foamy virus genome without the prerequisite of dimerization. Similarly, mutations that prevent in vitro dimerization impaired infectivity despite normal virion RNA content in HIV-1, indicating that RNA dimerization is not necessary for genome packaging (Clever and Parslow, 1997; Tchenio and Heidmann, 1995). For foamy viruses, therefore, the cis-elements for dimerization and packaging may be localized in separate regions of the SFV-1 genome. Furthermore, packaging of the genome with mutant C and the deletions indicate that viral protein synthesis is not impaired by these mutations. The mutations in C could introduce defects in several steps of reverse transcription such as the initiation complex and strand jump. To establish a stable initiation complex for reverse transcription in avian retroviruses, two secondary structures in the middle of U5 and in the leader region flanking the primer-binding site are required (Aiyar et al., 1994; Cobrinik et al., 1991; Miller et al., 1997). A deletion in the 3⬘ part of U5 did not block packaging but affected reverse transcription in murine leukemia virus (Murphy and Goff, 1989). The mutation region of mutant C lies in the 5⬘ part of U5 of SFV-1 and this region could contribute to forming a stable initiation complex of reverse transcription. Thus, the lack of replication could be caused by a defect at the level of reverse transcription. It is interesting to note that we observe no reverse transcriptase activities in supernatants harvested from cells transfected with mutant C or any of the deletion mutants. The regions where these mutations were introduced may be critical for association or enzymatic activity of the reverse transcriptase. After the submission of this article, Heinkeliein et al. (2000) suggested that a similar region in the HFV genome might be required for polymerase incorporation and/or activity. Baldwin and Linial (1998) reported that Pol is not required for assembly of HFV core particles or packaging of the viral genome, supporting our observation that the SFV-1 genome can be packaged even though no reverse transcriptase activity was detected. MATERIALS AND METHODS Virus and cell cultures Cell lines 293 (human embryonic kidney fibroblasts), COS-7 (African green monkey fibroblasts), CRFK (Crandell feline kidney fibroblasts), and L929 (murine fibroblasts) were obtained from the American Type Culture Collection (Rockville, MD). Cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum. SFV-1 was propagated in the 293 cell line.

210

PARK AND MERGIA TABLE 1

Oligonucleotide Primers Used in PCR for Construction of Mutants Primer a

Sequence b

Nucleotide positions c

F1 R1 R2 R3 IR IF CR CF BR BF DR DF

atagatatcgtgcactgcg tgtgtcgacaattgtcgtgga cacgatatcccgacttata actgatatccctagggatta agcgagttctgttgagctcccgt ggagctcaacagaactcgctgcgccgag cataaaggggtgaaagagac tctttcacccctttatgtaaagtga actagatccaccctaagca ttagggatggatctagtgggataagtg tacccacaaatcccactag gtgggatttgtgggtactacacttat

400–411 329–317 365–351 396–384 19–4 ⫺1–27 202–183 186–210 250–231 234–260 264–246 249–274

a

R, reverse primer; F, forward primer. Underlined sequences are modified from wild-type DNA sequence. c Nucleotide number position ⫹ 1 represents the beginning of the R region of the LTR. b

Construction of plasmids All plasmids were derived from a SFV-1 infectious proviral DNA, pSFV-1. The construction of pSFV-1 was described previously (Mergia and Wu, 1998). Recombinant DNA manipulations were performed by standard techniques (Sambrook et al., 1989). Site-specific mutations were constructed by PCR with pairs of oligonucleotides containing altered sequences as described previously (Ho et al., 1989). Primers used for mutations are listed in Table 1. Base substitutions were introduced in the R region at positions 7–12 (I) and in the U5 region at positions 241–243 (B), 193–195 (C), and 256–257 (D) (Fig. 1). In all these mutants, the sequences were altered at both the 5⬘ and the 3⬘ LTRs. Proviruses with deletion mutations in the leader region between the PBS and the start of the gag were created by ligating and subcloning appropriate PCR-generated DNA fragments. Mutants d1, d2, and d3 contained proviruses with deletions at positions 364–399, 397–435, and 364–435, respectively. All mutations were confirmed by sequencing doublestranded DNA templates using the Perkin–Elmer Applied Biosystem Division (PE/ABD) 373A automated DNA sequencer. DNA transfections The proviral genome of either wild-type or mutant SFV-1 was transfected into 293 cells by using a liposome-mediated method with LipofectAMINE Reagent (Life Technologies, Inc., Gaithersburg, MD). Briefly, cells were seeded at a density of 3 ⫻ 10 5 in six-well plates and incubated overnight. The transfection was performed the next day when the cells were 70 to 80% confluent. One to two micrograms of DNA was mixed with LipofectAMINE reagent and used to transfect 293 cells. Five hours after

transfection 1 ml of DMEM with 20% FBS was added to the culture without removing the transfection mixture. The medium was replaced with DMEM containing 10% FBS 24 h after transfection. Supernatants from transfected cells were harvested every other day to monitor virus production. A plasmid construct expressing the LacZ gene (pCV7-9) was used as a control to monitor for transfection efficiency (Wu and Mergia, 1999). Reverse transcriptase assay RT assays were performed as described previously (Benzair et al., 1982). Briefly, 1 ml of supernatant taken from infected cell culture was centrifuged for 1 h at 12,000 rpm to pellet the virus. Supernatants for RT were harvested every 2 days for 12 days. The pellet was resuspended in 50 ␮l of 50 mM Tris–HCl (pH 8), NP-40 (0.1%), dithiothreitol (1 mM), KCl (40 mM), EGTA (0.5 mM), MnCl 2 (1 mM), and BSA (100 ␮g/ml). Virus particle-associated RT activity was assayed in triplicate with [ 3H]dTTP as a precursor and poly(rA)/oligo(dT) as a template/ primer. Establishing a ␤-Gal expression cell line for titering SFV-1 Plasmid pL1 (FFV)␤-gal/zeo, a gift from Dr. Axel Rethwilm of Technische Universita¨t Dresden, Germany, contained the LacZ gene under feline foamy virus (FFV) LTR promoter. This plasmid also had a zeocin-resistance gene under the control of a SV40 promoter for selection. Plasmid pU3␤-gal/zeo was constructed by replacing the FFV promoter sequence in pL1 (FFV)␤-gal/zeo with the U3 region of the SFV-1 LTR at the unique Bgl/II to BamHI sites. The U3 region of SFV-1 was obtained by digesting plasmid pSFV-1LTR/CAT-41 (Mergia et al., 1991) with BamHI. One microgram of pU3␤-gal/zeo was transfected into COS-7, CRFK, and L929 cells in 6-well plates. Two days after transfection, cells were 10-fold serially diluted and transferred to 100-mm plates. Drug-resistant cells were selected by culturing cells in medium containing 300 ␮g/ml of zeocin (InVitrogen, Carlsbad, CA). The presence of the Lac-Z gene was confirmed by PCR using pairs of primers in the surviving cells. Stably transfected cells were transferred to 24-well plates and tested for ␤-gal expression by infecting them with SFV-1 virus stock. A cell line (LBZ4), derived from L929 cells, which expresses ␤-gal upon SFV-1 infection, was used as an indicator cell for further experiments. To titer the level of virus production from cells transfected with either wild-type or mutant SFV-1, the indicator (LBZ4) cells were seeded at 3 ⫻ 10 4 cells per well in a 24-well cell culture plate. Supernatants harvested from cells transfected with wild-type or mutant SFV-1 proviral DNA were 10-fold serial diluted and used to infect the LBZ4 cells. Forty-eight hours after infection, in situ staining for ␤-Gal activity was performed by fixing cells with

5⬘ LEADER SEQUENCE OF SFV-1

0.25% gluteraldehyde and staining with 0.2% 5-bromo-4chloro-3-indolyl-b-D-galactopyranoside. Blue-stained positive cells were viewed under a microscope and scored. RNA isolation and blot hybridization Cytoplasmic RNA was extracted from cells transfected with either wild-type or mutant proviral DNA. Cells were harvested from three wells of a six-well culture plate and RNA was isolated using Tri-Zol reagent (Gibco BRL, Frederick, MD). The RNA was treated with 10 units of RNase-free DNase I (Ambion, Austin, TX) for 30 min at 37°C. DNase was removed by treating samples with phenol:chloroform:isoamyl alcohol (25:24:1) twice and by ethanol precipitation. Twenty-five micrograms of RNA was fractionated on a 1.1% agarose gel containing 2.2 M formaldehyde and transferred to a nylon membrane (MagnaGraph; Micron Separations Inc., Minnetonka, MN) for hybridization. The membrane was hybridized under stringent conditions to a [␣- 32P]dATP-labeled DNA fragment representing the tas-orf2 region located between env and the LTR. Virion nucleic acids were prepared from supernatant of proviral DNA transfected cells. Culture supernatants harvested 2 or 5 days posttransfection were treated with RNase-free DNase I. The level of virus production from each of the transfected cells was determined by infecting the indicator cells (LBZ4) and scoring ␤-Gal-positive cells as described above. Virus particles were pelleted by layering over an equal volume of TNE [10 mM Tris– HCl, 150 mM NaCl, 1 mM EDTA (pH 7.5)] containing 20% sucrose and by centrifugation at 25,000 rpm for 2 h. The pellets were resuspended in TNE and lysed with 1% SDS and 200 ␮g/ml Proteinase K (Sigma, St. Louis, MO) at 37°C for 30 min. The lysed samples were extracted with phenol:chloroform:isoamyl alcohol and ethanol-precipitated. Viral nucleic acids were dot blotted using Dot Blot Manifold (Gibco BRL) onto a nylon membrane and hybridized with a [␣- 32P]dATP-labeled DNA fragment of the gag region of SFV-1. RNase protection assay For RNase protection analysis of the SFV-1 genome in the virus particles, the pSP73 plasmid (Promega Biotec, Madison, WI) was used. The SFV-1 DNA fragment from the 3⬘ end V3 of the LTR to the 5⬘ end of gag that includes the first 180 nucleotides of the gag sequences was digested with restriction enzymes EcoRI and XbaI and cloned into pSP73 to generate pSPE-X. The pSP73 clone containing the SFV-1 insert was linearized by digestion with restriction enzyme NarI located at the S⬘ end of the primer-binding site. 32P-labeled antisense riboprobe was generated in in vitro transcription reactions with SP6 polymerase (Promega) (Melton et al., 1984). Virus particles were prepared by transfection of mutant or wild-type

211

provirus. The genome was isolated from virus particles and was used for RNase protection with SFV-1 antisense probe using the Direct Protect RNase Protection Assay kit as recommended by the manufacturer (Ambion). ACKNOWLEDGMENTS This research was supported by grants from the National Institutes of Health to A. Mergia (AI39126 and AI42563).

REFERENCES Aiyar, A., Ge, Z., and Leis, J. (1994). A specific orientation of RNA secondary structures is required for initiation of reverse transcription. J. Virol. 68, 611–618. Aldovini, A., and Young, R. A. (1990). Mutations of RNA and protein sequences involved in human immunodeficiency virus type 1 packaging result in production of noninfectious virus. J. Virol. 64, 1920– 1926. Baldwin, D. N., and Linial, M. L. (1998). The roles of Pol and Env in the assembly pathway of human foamy virus. J. Virol. 72, 3658–3665. Benzair, A.-B., Rhodes-Feuillette, A., Emanoil-Ravicovich, R., and Peries, J. (1982). Reverse transcriptase from simian foamy virus serotype 1: Purification and characterization. J. Virol. 44, 720–724. Berkowitz, R. D., Fisher, J., and Goff, S. P. (1996). RNA packaging. Curr. Top. Microbiol. Immunol. 214, 177–218. Bieth, E., Gabus, C., and Darlix, J. L. (1990). A study of the dimer formation of Rous sarcoma virus RNA and of its effect on viral protein synthesis in vitro. Nucleic Acids Res. 18, 119–127. Bodem, J., Lochelt, M., Winkler, I., Flower, R. P., Delius, H., and Flugel, R. M. (1996). Characterization of the spliced pol transcript of feline foamy virus: The splice acceptor site of the pol transcript is located in gag of foamy viruses. J. Virol. 70, 9024–9027. Campbell, M., Renshaw-Gegg, L., Renne, R., and Luciw, P. A. (1994). Characterization of the internal promoter of simian foamy viruses. J. Virol. 68, 4811–4820. Clavel, F., and Orenstein, J. M. (1990). A mutant of human immunodeficiency virus with reduced RNA packaging and abnormal particle morphology. J. Virol. 64, 5230–5234. Clever, J. L., and Parslow, T. G. (1997). Mutant human immunodeficiency virus type 1 genomes with defects in RNA dimerization or encapsidation. J. Virol. 71, 3407–3414. Cobrinik, D., Aiyar, A., Ge, Z., Katzman, M., Huang, H., and Leis, J. (1991). Overlapping retrovirus U5 sequence elements are required for efficient integration and initiation of reverse transcription. J. Virol. 65, 3864–3872. Darlix, J. L., Gabus, C., Nugeyre, M. T., Clavel, F., and Barre-Sinoussi, F. (1990). Cis elements and trans-acting factors involved in the RNA dimerization of the human immunodeficiency virus HIV-1. J. Mol. Biol. 216, 689–699. Enssle, J., Jordan, I., Mauer, B., and Rethwilm, A. (1996). Foamy virus reverse transcriptase is expressed independently from the Gag protein. Proc. Natl. Acad. Sci. USA 93, 4137–4141. Erlwein, O., Bieniasz, P. D., and McClure, M. O. (1998). Sequences in pol are required for transfer of human foamy virus-based vectors. J. Virol. 72, 5510–5516. Erlwein, O., Cain, D., Fischer, N., Rethwilm, A., and McClure, M. O. (1997). Identification of sites that act together to direct dimerization of human foamy virus RNA in vitro. Virology 229, 251–258. Flugel, R. M., Rethwilm, A., Mauer, B., and Darai, G. (1987). Nucleotide sequence analysis of the env gene and its flanking regions of the human spumaretrovirus reveals two novel genes. EMBO J. 6, 2077– 2084. Heinkelein, M., Schmidt, M., Fischer, N., Moebes, A., Lindemann, D., Enssle, J., and Rethwilm, A. (1998). Characterization of a cis-acting

212

PARK AND MERGIA

sequence in the Pol region required to transfer human foamy virus vectors. J. Virol. 72, 6307–6314. Herchenroder, O., Renne, R., Loncar, D., Cobb, E. K., Murthy, K. K., Schneider, J., Mergia, A., and Luciw, P. A. (1994). Isolation, cloning, and sequencing of simian foamy viruses from chimpanzees (SFVcpz): High homology to human foamy virus (HFV). Virology 201, 187–199. Ho, S. N., Hunt, H. D., Horton, R. M., and Pullen, J. K. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59. Hooks, J. J., and Detrick-Hooks, B. (1981). Spumavirinae: Foamy virus group infections. Comparative aspects and diagnosis. In “Comparative Diagnosis of Viral Disease” (E. Kurstak and C. Kurstak, Eds.), Vol. 4, pp. 599–618. Academic Press, New York. Katoh, I., Yasunaga, T., and Yoshinaka, Y. (1993). Bovine leukemia virus RNA sequences involved in dimerization and specific gag protein binding: Close relation to the packaging site avian, murine, and human retroviruses. J. Virol. 67, 1830–1839. Katz, R. A., Terry, R. W., and Skalka, A. M. (1986). A conserved cis-acting sequence in the 5⬘ leader of avian sarcoma virus RNA is required for packaging. J. Virol. 59, 163–167. Kim, H. J., K., K. L., and O’Rear, J. J. (1994). A short sequence upstream of the 5⬘ major splice site is important for encapsidation of HIV-1 genomic RNA. Virology 198, 336–340. Kupiec, J., Kay, A., Hayat, M., Ravier, R., Peries, J., and Galibert, F. (1991). Sequence analysis of the simian foamy virus type 1 genome. Gene 101, 185–194. Lever, A., Gottlinger, H., Haseltine, W., and Sodroski, J. (1989). Identification of a sequence required for efficient packaging of human immunodeficiency virus type 1 RNA into virions. J. Virol. 63, 4085–4087. Linial, M. L., and Miller, A. D. (1990). Retroviral RNA packaging: Sequence requirements and implications. Curr. Top. Microbiol. Immunol. 157, 125–185. Lochelt, M., and Flugel, R. M. (1996). The human foamy virus pol gene is expressed as a Pro-Pol polyprotein and not as a Gag–Pol fusion protein. J. Virol. 70, 1033–1040. Lochelt, M., Flugel, R. M., and Aboud, M. (1994). The human foamy virus internal promoter directs the expression of the functional Bel 1 and Bet protein early after infection. J. Virol. 68, 638–645. McCann, E. M., and Lever, A. M. (1997). Location of cis-acting signals important for RNA encapsidation in the leader sequence of human immunodeficiency virus type 2. J. Virol. 71, 4133–4137. Melton, J. D., Krieg, P. A., Rebaglainti, M. R., Maniatis, T., Zinn, K., and Green, M. R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 12, 7035–7056. Mergia, A. (1994). Simian foamy virus type 1 contains a second promoter located at the 3⬘ end of the env gene. Virology 199, 219–222. Mergia, A., Leung, N. J., and Blackwell, J. (1996). Cell tropism of the simian foamy virus type 1 (SFV-1). J. Med. Primatol. 25, 2–7. Mergia, A., and Luciw, P. A. (1991). Replication and regulation of primate foamy viruses. Virology 184, 475–482. Mergia, A., Pratt-Lowe, E., Shaw, K. E. S., Renshaw-Gegg, L. W., and Luciw, P. A. (1992). cis-acting regulatory regions in the long terminal repeat of simian foamy virus type 1. J. Virol. 66, 251–257. Mergia, A., Shaw, K. E. S., Pratt-Lowe, E., Barry, P. A., and Luciw, P. A. (1991). Identification of the simian foamy virus transcriptional transactivator gene (taf). J. Virol. 65, 2903–2909. Mergia, A., and Wu, M. (1998). Characterization of provirus clones of simian foamy virus type 1 (SFV-1). J. Virol. 72, 817–822.

Miele, G., Mouland, A., Harrison, G. P., Cohen, E., and Lever, A. M. (1996). The human immunodeficiency virus type 1 5⬘ packaging signal structure affects translation but does not function as an internal ribosome entry site structure. J. Virol. 70, 944–951. Miller, J. T., Ge, Z., Morris, S., Das, K., and Leis, J. (1997). Multiple biological roles associated with the Rous sarcoma virus 5⬘ untranslated RNA U5-IR stem and loop. J. Virol. 71, 7648–7656. Muranyi, W., and Flugel, R. M. (1991). Analysis of splicing patterns of human spumaretrovirus by polymerase chain reaction reveals complex RNA structures. J. Virol. 65, 727–735. Murphy, J. E., and Goff, S. P. (1989). Construction and analysis of deletion mutations in the U5 region of Moloney murine leukemia virus: Effects on RNA packaging and reverse transcription. J. Virol. 63, 319–327. Paillart, J. C., Berthoux, L., Ottmann, M., Darlix, J. L., Marquet, R., Ehresmann, B., and Ehresmann, C. (1996). A dual role of the putative RNA dimerization initiation site of human immunodeficiency virus type 1 in genomic RNA packaging and proviral DNA synthesis. J. Virol. 70, 8348–8354. Panganiban, A. T., and Fiore, D. (1988). Ordered interstrand and intrastrand DNA transfer during reverse transcription. Science 241, 1064– 1069. Prats, A. C., Roy, C., Wang, P. A., Erard, M., Housset, V., Gabus, C., Paoletti, C., and Darlix, J. L. (1990). cis elements and trans-acting factors involved in dimer formation of murine leukemia virus RNA. J. Virol. 64, 774–783. Renne, R., Freidl, E., Schweizer, M., Fleps, U., Turek, R., and NeumannHaefelin, D. (1992). Genomic organization and expression of simian foamy virus type 3 (SFV-3). Virology 186, 597–608. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463– 5467. Sorge, J. D., Ricci, W., and Hughes, S. H. (1983). Cis-acting RNA packaging locus in the nucleotide direct repeat of Rous-sarcoma virus. J. Virol. 48, 667–675. Tchenio, T., and Heidmann, T. (1995). The dimerization/packaging sequence is dispensable for both the formation of high-molecularweight RNA complexes within retroviral particles and the synthesis of proviruses of normal structure. J. Virol. 69, 1079–1084. Wu, M., Chari, S., Yanchis, T., and Mergia, A. (1998). Cis-acting sequences required for simian foamy virus type 1 (SFV-1) vectors. J. Virol. 72, 3451–3454. Wu, M., and Mergia, A. (1999). Packaging cell lines for simian foamy virus type 1 vectors. J. Virol. 73, 4498–4501. Yu, S. F., Baldwin, D. N., Gwynn, S. R., Yendapalli, S., and Linial, M. L. (1996a). Human foamy virus replication: A pathway distinct from that of retroviruses and hepadnaviruses. Science 271, 1579–1582. Yu, S. F., Edelmann, K., Strong, R. K., Moebes, A., Rethwilm, A., and Linial, M. L. (1996b). The carboxyl terminus of the human foamy virus Gag protein contains separable nucleic acid binding and nuclear transport domains. J. Virol. 70, 8255–8262. Yu, S. F., and Linial, M. L. (1993). Analysis of the role of the bel and bet open reading frames of human foamy virus by using a new quantitative assay. J. Virol. 67, 6618–6624. Yu, S. F., Sullivan, M. D., and Linial, M. L. (1999). Evidence that the human foamy virus genome is DNA. J. Virol. 73, 1565–1572.