Mutational Analysis of the Central Centromere Targeting Domain of Human Centromere Protein C, (CENP-C)

Experimental Cell Research 275, 81–91 (2002) doi:10.1006/excr.2002.5495, available online at http://www.idealibrary.com on

Mutational Analysis of the Central Centromere Targeting Domain of Human Centromere Protein C, (CENP-C) Kang Song, Bobbi Gronemeyer, Wei Lu, Emily Eugster, and John E. Tomkiel 1 Center for Molecular Medicine and Genetics, Wayne State University, Detroit, Michigan 48202

least some of the microtubule motor proteins that generate movement [2– 4], and is thought to play an integral role in communicating with the cell cycle regulatory pathways that control the onset of anaphase (for reviews see [5–7]). In recent years a number of kinetochore components have been discovered in both humans and model organisms (for recent reviews, see [8 –11]), yet we still understand relatively little about the assembly and regulation of this structure. In both the budding and fission yeasts, kinetochore assembly is dictated, at least in part, by the underlying CEN DNA sequences [12–14]. Yet in multicellular organisms, there do not appear to be unique CEN sequences that specify where to construct a kinetochore. Detailed restriction enzyme analysis and sequencing of DNA from stable minichromosomes in both Drosophila and human suggest, rather, that there is an epigenetic component to determining where to assemble a kinetochore [15–18]. Our understanding of what dictates kinetochore formation will require knowledge of the mechanisms by which its individual protein components are assembled and regulated. The human centromere protein C (CENP-C) may be particularly informative in this regard. CENP-C has been localized to the inner kinetochore plate [19], the part of the kinetochore that directly contacts the underlying centromeric chromatin. It is a constitutive component of the centromere, and thus may be involved in facilitating and/or regulating the assembly of additional proteins at kinetochores in mitosis. Injection of anti-CENP-C antibodies into human cells causes a disruption of kinetochores [20], suggesting that CENP-C is essential for kinetochore assembly and/or stability. These cells with disrupted kinetochores delay at metaphase [20], presumably because of the activation of a cell cycle checkpoint that monitors the integrity of the kinetochore. Knockouts of CENP-C homologues in both mouse [21] and chicken [22] recapitulate this disruption of mitosis. Thus, a molecular understanding of how CENP-C is assembled at the kinetochore may yield insights into both the structure

Human centromere protein C (CENP-C) is an essential component of the inner kinetochore plate. A central region of CENP-C can bind DNA in vitro and is sufficient for targeting the protein to centromeres in vivo, raising the possibility that this domain mediates centromere localization via direct DNA binding. We performed a detailed molecular dissection of this domain to understand the mechanism by which CENP-C assembles at centromeres. By a combination of PCR mutagenesis and transient expression of GFP-tagged proteins in HeLa cells, we identified mutations that disrupt centromere localization of CENP-C in vivo. These cluster in a 12 amino acid region adjacent to the core domain required for in vitro DNA binding. This region is conserved between human and mouse, but is divergent or absent in invertebrate and plant CENP-C homologues. We suggest that these 12 amino acids are essential to confer specificity to DNA binding by CENP-C in vivo, or to mediate interaction with another as yet unidentified centromere component. A differential yeast two-hybrid screen failed to identify interactions specific to this sequence, but nonetheless identified 14 candidate proteins that interact with the central region of CENP-C. This collection of mutations and interacting proteins comprise a useful resource for further elucidating centromere assembly. © 2002 Elsevier Science (USA) Key Words: CENP-C; centromere; kinetochore; DNAbinding; yeast two-hybrid; mutagenesis; human; GFP.

INTRODUCTION

Centromeres are the cis-acting chromosomal elements required for chromosome movement during cell division. A proteinaceous structure called the kinetochore, visible by electron microscopy in multicellular eukaryotes, is assembled at centromeres during mitosis. This structure directly mediates attachment of chromosomes to the spindle microtubules [1], houses at 1 To whom correspondence should be addressed, at 5156 Biological Sciences, Center for Molecular Medicine and Genetics, Wayne State University, Detroit, MI 48202, Fax:313-577-6200, E-mail: jtomkiel@ cmb.biosci.wayne.edu.

81

0014-4827/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.

82

SONG ET AL.

of the kinetochore, and its relationship to the cell cycle regulatory pathway. Previous studies have suggested that CENP-C may assemble at centromeres, at least in part, by binding directly to DNA. Transient transfection assays using epitope-tagged CENP-C have defined a central 60 aa domain sufficient for centromere localization [23] and in vitro studies have shown that slightly larger polypeptides containing this domain are capable of binding DNA [23–25]. A second, independent centromere localization domain resides in the carboxy terminus of CENP-C [26]. This domain is capable of homodimerization [25], and thus may allow centromere targeting of CENP-C fusion proteins by mediating interaction with existing centromere-assembled, endogenous CENP-C. Here we have focused on the role of the central domain in centromere targeting. Unlike the carboxyterminal domain, the central domain does not appear capable of mediating homodimerization [25], and therefore likely directs centromere assembly via interaction with another centromere component. We reasoned that a further characterization of this domain might provide insight into the intermolecular interactions required for centromere assembly and function, and/or might generate useful tools to identify the interacting molecules. We describe the results of a targeted mutagenesis and functional analysis of this central centromere targeting domain. MATERIALS AND METHODS Expression of CENP-C/GFP fusion proteins in HeLa cells. DNA encoding a mutant green fluorescent protein (GFP, S65T) [27] that had been optimized for the human codon bias [28] was amplified by PCR and cloned into the BamHI and NotI sites in the polylinker of pcDNA3 (Invitrogen, Carlsbad, CA). The primers used for amplification were 5⬘ GAGGATCCACCATGGAATTCTGGTGAGCAAGGG 3⬘ and 5⬘ GAGCGGCCGCTTACTTGTACAGCTC 3⬘. This vector contains the cytomegalovirus promoter for expression in eukaryotic cells and an SV40 polyadenylation signal, as well as the bacteriophage T7 promoter for expression in bacteria. We further modified the GFP sequences using PCR to introduce a CUG (leucine) codon in place of the start AUG. Upstream from this CUG we placed an out-of-frame AUG within a Kozak’s consensus sequence [29], followed by a unique EcoRI cloning site. GFP is only expressed from this construct if sequences inserted into the EcoRI site encode an open reading frame and either place the upstream ATG in frame or provide another in-frame ATG. Sequences encoding various CENP-C polypeptides were amplified by PCR using full-length CENP-C cDNA as a template (CENP-C ␤, [19]) and cloned into the EcoRI site of this vector. To create full-length CENP-C containing the single R522G point mutation, a SalI-XmnI fragment of the full length CENP-C/GFP was replaced with the corresponding fragment from CENP-C aa1-591 (R522G). HeLa cells were cultured in RPMI medium 1640 (Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal calf serum. Cells were rinsed with Dulbecco’s phosphate-buffered saline (D-PBS, 10 mM NaPO4 (pH 7.4), 0.15 M NaCl, 1 mM EGTA), trypsinized, washed twice with OptiMEM (Gibco BRL), then resuspended at 5 ⫻ 10 6 cells/ml in OptiMEM medium. Cells (0.4 ml) were transfected by

electroporation using 10 ␮g DNA in 0.4 cm electrode gap GenePulser Cuvettes (Bio-Rad, Hercules, CA) using an Electro Cell Manipulator 600 electroporation system (Biotechnologies and Experimental Research, San Diego, CA). Capacitance and resistance were set at 500 V, resistance at 13 ohms, and capacitance at 550 ␮F. Transfected cells were seeded onto 22-mm coverslips and allowed to express 20 h. Live cells were mounted in D-PBS and examined on a Nikon Optiphot fluorescence microscope at 1000X. Alternatively, cells were fixed and processed for indirect immunofluorescence. Indirect immunofluorescence. HeLa cells were fixed in 1% formaldehyde in D-PBS, and stained for 1 h with polyclonal rabbit antiCENP-B antiserum 764 [30] at 1:1000 in KB (10 mM Tris-HCl, pH 7.7, 150 mM NaCl, 1% BSA) containing 0.1% Triton X-100. After five 3-min washes with KB, cells were stained with biotin-conjugated goat anti-rabbit secondary antibodies (Amersham, Arlington Heights, IL) at 1:1000 for 1 h. Washes were repeated, and cells were stained 1 h with Texas red conjugated avidin at 1:1000 (Amersham), and 1 ␮g/ml DAPI for 10 min. After repeating washes, cells were mounted in 50% glycerol in D-PBS. Images were captured using a Nikon Opitophot microscope and a Photometrics SenSys cooled ccd camera and IPlab imaging software on a MacIntosh PowerPC 7100 computer. Image collages were made using Adobe Photoshop (Adobe Systems, Inc.) and Powerpoint software (Microsoft, Bellevue, WA). PCR mutagenesis. CENP-C was amplified by PCR under mutagenic conditions [31] using primers 5⬘ CAGTGGATCCTGGATTACAATAC 3⬘ (forward) and 5⬘CCGAATTCGTACTCTTTGGTTGC 3⬘ (reverse). Mutated sequences were cloned into the XbaI and EcoRI sites of pcDNA3/CENP-C aa 1–591/GFP. This produced an expression construct that was wild type for sequences encoding CENP-C aa 1– 421 and mutagenized for sequences encoding CENP-C aa 421– 591. Although pcDNA3 does not contain a constitutive bacterial promoter, our modified construct did allow detectable expression of the CENP-C/GFP fusion proteins in E. coli. Presumably, we had created a cryptic bacterial promoter in our construct. Clones were preselected in bacteria for GFP expression by examination under UV light at 40X on a Nikon Optiphot fluorescent microscope. This eliminated constructs in which a stop codon or frameshift mutation in CENP-C had placed the downstream GFP moiety out of frame. A total of 212 mutant clones were selected for expression in HeLa cells. To obtain a higher frequency of mutants in CENP-C between aa 519 and aa 534, the following degenerate primer was designed: 5⬘GGGAATTCGCTCCTCTGATTTTACCACCCA CCATCAGATGGACGCCTGGAAATTCTTCGACTTTTCGTGACAG3⬘ (reverse). This primer was synthesized using a mix of 90% of the indicated nucleotide and 10% of the remaining three nucleotides at the bps in bold type. It was used in combination with the forward primer above to amplify CENP-C, and the resulting fragment was cloned into the XbaI and EcoRI sites of pcDNA3/CENP-C 1–591. This resulted in an expression construct that was wild type for sequences encoding CENP-C aa 1–518 and mutagenized for sequences encoding CENP-C aa 519 –534. Eight clones that expressed GFP in bacteria were selected for transfection into HeLa. DNA sequencing. Single-stranded DNA sequence was obtained for the 220 mutant clones generated by mutagenic PCR. Plasmid DNA was sequenced by the Core facility of the Center for Molecular Medicine and Genetics, Wayne State University, using dye terminator PCR cycle sequencing on an ABI Prism 377 DNA Sequencer (Perkin Elmer, Norwalk, CT) as per manufacturer’s instructions. Only the sequence between bp 1350 and 1760 of the CENP-C ORF was considered for analysis (encoding aa 451–586). SDS-PAGE and immunoblotting. Electrophoresis and blotting were performed as previously described [32]. Rabbit anti-CENP-C 296 –943 antiserum [19] was used at 1:1000 dilution and bound antibodies were detected using horseradish peroxidase-conjugated protein A at 1:5000 and ECL detection reagents (Amersham).

CENP-C CENTROMERE TARGETING Yeast interaction trap screen. The yeast interaction trap screen was performed by a modification of the standard screen [33], in which the constructs encoding the putative interacting proteins were transformed into haploid strains and subsequently combined by mating [34]. DNA encoding amino acids 313– 620 of CENP-C was amplified by PCR using the full-length human CENP-C cDNA [19] as template and the primers 5⬘ CCGAATTCAGTAGATCTTGGATTA 3⬘ and 5⬘ TAGGATCCACTTTCCAATGGCTCACT 3⬘, and cloned into the EcoRI and BamHI sites of pEG202 [35]. To create the same construct bearing the R522G mutation, an XbaI–XmnI fragment was replaced with the corresponding sequences from the pcDNA3/ CENPC aa 1–591/GFP construct bearing the mutation. Haploid RFY206 yeast of the “a” mating type bearing the lacZ reporter plasmid pSH18-34 were transformed with each of these constructs. Yeast bearing the wild-type CENP-C construct were mated en masse to haploid yeast RFY231 of the “alpha” mating type containing a library of HeLa cDNA sequences cloned into pJG4 –5 [35]. A total of 4.8 ⫻ 10 8 diploids were plated on ura- his- trp- leu- Gal/Raf media to screen for transcriptional activation of the 3LexAop:Leu2 gene, and 800 resulting colonies were picked. These were replica plated to urahis- trp- leu- /Glu, and 91 grew in a Gal-dependent manner, indicating a requirement for CENP-C production to activate the reporter genes. PCR amplification using BCO1 and BCO2 primers [34] was performed to recover cDNA inserts. These were grouped based on AluI digestion patterns. Representative PCR products from each group were sequenced and BLAST searches performed to ascertain their identities. The following cDNAs were identified, with the accession number followed by the number of times isolated in parentheses: tropomyosin (M19267, 21), molybdopterin synthase (AF091871, 20), ubiquitin (X63237,10), PCNA (M15796, 5), KIAA0005 (D13630, 5), ribosomal protein L29 (XM_052447, 5), a protein of unknown function (AL137724, 4), RAB24 homologue (Z22819, 3), beta tubulin (X00734, 3), anaphase promoting complex subunit 7 (AF076607, 2), Hsp84 (M36829, 1), SSR alpha subunit (Z12830,1), and nucleosome assembly protein-like 4 (U51281, 1), H326 (U006631, 1). Nine additional clones either did not contain an open reading frame or did not give a product from PCR amplification. Plasmids encoding putative interactors were recovered by transformation of and subsequent purification from E. coli DH5␣. Plasmids were then used to transform haploid RFY231 yeast. Resulting transformants were mated to RFY206 haploid yeast bearing the pEG202 construct producing either wild-type CENP-C aa 313– 620 or CENP-C aa 313– 620 R522G. Growth rates of resulting diploids were monitored on ura- his- trp- leu- Gal/Raf media, and the ␤-galactosidase activities of diploids grown in liquid were determined as described [33].

RESULTS

GFP-Tagged CENP-C Is Targeted to Centromeres We used the jellyfish green fluorescent protein [36] as a visual tag to monitor expression and localization of CENP-C polypeptides in HeLa cells. Use of GFP allowed us to observe expressed proteins directly in living cells, permitting rapid screening of mutant protein localizations while avoiding the possibility of fixation artifacts associated with use of epitope tags. We made constructs that expressed GFP as a carboxy-terminal fusion to several CENP-C polypeptides. In these constructs, the methionine start codon of GFP was mutated so that GFP expression would be dependent on translation through the upstream CENP-C sequences. This ensured that GFP alone was not expressed as a result of internal translational initiation.

83

We first tested if the GFP moiety would interfere with the centromere localization of full-length and truncated versions of CENP-C. A fusion protein of full-length CENP-C and a carboxy-terminal GFP tag localized to centromeres when transiently expressed in interphase HeLa cells (Fig. 1A). Similarly, a fusion protein between CENP-C aa 1–591 and GFP also localized to centromeres (Fig. 1A). We failed to observed mitotic cells expressing either fusion protein. This may mean that expression of the fusion proteins interfered with cell cycle progression, or that the GFP signal was masked by assembly of mitosis-specific centromere components. Our conclusions based on visualization of the GFP tag are therefore limited to centromere localization of CENP-C during interphase. GFP localization to centromeres was verified in fixed cells by indirect immunofluorescence staining using antibodies to another known centromere component, CENP-B (Fig. 1A) [37]. Twenty cells, each expressing either full-length CENP-C/GFP or CENP-C aa1–591/ GFP fusion proteins, were scored for coincidence between GFP and CENP-B antibody spots. Of the GFP foci, 88.9 and 87.6% were positive for anti-CENP-B staining (1118/1258 and 1070/1221, respectively). We also tested the localization of a fusion protein between the CENP-C aa 421–591 and GFP. This small fragment includes a previously defined centromere localization domain and a putative DNA-binding domain [23]. Protein produced from this construct also localized to centromeres, albeit with a higher background of noncentromere-localized nuclear protein (Fig. 1B). This high nuclear background is similar to the expression pattern observed previously using this same region of CENP-C fused to the avian coronavirus M protein tag [23]. In living cells we observed centromere localization of these GFP-tagged CENP-C polypeptides in virtually all expressing cells. Fixation, however, caused a marked reduction in GFP signal, and disrupted the centromere localization of the smallest fusion protein in most cells. This may explain why we could detect centromere localization of a similar short peptide in only a small percentage of fixed cells in a previous study [23]. These results verified that the carboxy-terminal fusion of GFP to CENP-C polypeptides does not interfere with their ability to target to centromeres. They are also consistent with our previous results that showed that an in vivo centromere localization domain is encoded by CENP-C aa 478 –537 [23]. From these observations, we concluded that GFP would be a useful tag for monitoring assembly of CENP-C at the centromere.

84

SONG ET AL.

FIG. 1. CENP-C/GFP fusion proteins localize to centromeres when transiently expressed in HeLa cells. (A) GFP localizations and anti-CENP-B antibody staining patterns coincide in cells expressing GFP fused to the carboxy terminus of either full-length CENP-C (aa 1–943) or a truncated CENP-C (aa 1–591) containing the central centromere localization domain. (B) In live HeLA cells, GFP alone is not localized to centromeres, while CENP-C(aa 421–591)/GFP fusion protein is localized in a punctate intranuclear pattern consistent with centromere localization. Bar ⫽ 10 ␮m.

Point Mutations in CENP-C Define Critical Amino Acid Residues Involved in Centromere Targeting We next asked if we could identify the amino acid residues within the central centromere localization domain that are critical for centromere targeting. To do this, we induced point mutations in a CENP-C cDNA in the nucleotides encoding aa 421–591 using mutagenic PCR [31]. Mutated sequences were used to replace the corresponding wild-type sequence in an expression vector that produced CENP-C aa 1–591 fused at its carboxy-terminus to GFP (CENP-C aa 1–591/GFP). We used this truncated version of CENP-C, rather than the full-length protein, so that we could assay the centromere targeting of the central localization domain independently of the carboxyl-terminal centromere localization domain, which resides in amino acids aa 584 –943, [26]. Regions upstream of the central targeting domain were included because we found that localization of this larger fusion protein was not disrupted by fixation. This allowed us to fix and stain cells with anti-centromere antibodies to verify GFP localization at centromeres.

We expected that a number of our mutant clones would contain stop codons or frameshifts that would preclude translation through the downstream GFP tag and thus be uninformative. Serendipitously, our modified mammalian expression vector contained a cryptic promoter that allowed expression of the CENPC/GFP fusion proteins in bacteria. We were thus able to eliminate clones with stop codons in the upstream CENP-C sequences by visually screening E. coli transformants. DNA sequencing of three clones that did not express GFP in E. coli confirmed that all three contained at least one stop codon in the CENP-C-encoding sequences upstream of GFP. We selected 212 clones that expressed GFP in bacteria, and transfected HeLa cells with expression plasmid DNA harvested from these clones. All of these clones produced a GFP signal in transfected HeLa cells. Three localization patterns were observed; a representative clone of each class is pictured in Fig. 2A. The majority (204) showed GFP localization at centromeres. Four clones produced proteins that we could not detect at centromeres, even in cells that were clearly expressing high levels of the fusion protein. An additional four clones produced 1–15 faint GFP spots in nuclei of expressing cells, which suggested a reduced centromere targeting ability. These punctate signals disappeared on fixation, and thus could not be verified as centromeres by antibody colocalization. We have conservatively classified these mutants as having “weak” centromere localization. After the localizations of the mutant proteins were determined, clones were sequenced to identify mutations. The frequency of mutation was 3.2% per bp. Eighty clones contained at least one mutation that resulted in an amino acid substitution; the remainder were wild type or contained only silent mutations. All of the proteins that showed reduced centromere local-

FIG. 5. Localization patterns of CENP-C fusion proteins in formaldehyde-fixed transfected HeLa cells. Both CENP-C aa 634 –943/ GFP and full-length CENP-C aa 1–943(R522G)/GFP colocalize with anti-CENP-B antibody staining. Bar ⫽ 10 ␮m.

CENP-C CENTROMERE TARGETING

FIG. 2. Localization patterns of mutated CENP-C aa 1–591/GFP fusion proteins in transfected HeLa cells. (A) Formaldehyde-fixed cells stained with DAPI and anti-CENP-B antibodies. The top panel depicts a cell expressing a CENP-C/GFP fusion that contains 22 missense mutations (D471E, S486I, K492R, E494D, K498R, S501T, R521G, S528C, E537V, S538C, N543F, N548S, S557R, K559I, S560Y, K562E, K563N, N565Y, Q566L, S567L, K569E, R572G) that localizes to centromeres. The middle panels show localization of a mutated protein (R522G) that fails to target to centromeres. The bottom panels show a cell expressing a mutated protein (V533G) that gives a weak GFP signal at centromeres in living cells, but which is labile to fixation and not apparent here. (B) GFP localization patterns in living cells expressing CENP-C1-591/GFP constructs with the single point mutations V533G, R522G, and W531R, respectively. Bar ⫽ 10 ␮m.

ization contained substitutions in aa 522–533, suggesting that this region may play a critical role in centromere targeting. To specifically mutagenize this region, we designed a partially degenerate PCR primer which included the DNA encoding these residues. This primer was synthesized using a mix of 90% of the correct nucleotide and 10% of the remaining three nucleotides at each position. It was used in combination with a standard primer to amplify a region of CENP-C encoding aa 421–534. These mutated sequences were then substituted for wild-type sequences in the expression vector encoding CENP-C aa 1–591/GFP. Eight clones were selected that produced GFP in bacteria, and these were transfected into HeLa and scored for centromere localization. One of these failed to localize, and two others showed weak centromere localization.

85

Sequencing revealed that all eight clones were mutated, and contained a total of 24 bp changes that resulted in 12 different substitutions. In total, 12 of 16 of the targeted amino acids had been mutagenized. These data were pooled with the previous experiment and are summarized in Fig. 3. In total, the collection of 88 mutated clones represented a total of 320 bp changes, resulting in 203 different aa substitutions. Substitutions were obtained in 110/136 aa encoded by the mutagenized sequence. A full list of each amino acid substitution encoded by each mutated construct can be found in the Appendix. A comparison of the sequences encoding the five proteins that failed to localize detectably to centromeres revealed that each contains a mutation in the codon for arginine 522 (R522) (Appendix). In contrast, none of the clones that produce centromere-localized protein is mutated in R522. Expression of CENP-C aa 1-591/GFP in which only R522 had been mutated (R522G) confirmed that mutation of R522 alone was sufficient to disrupt centromere localization (Fig. 2B). We verified that a fusion protein of the expected size was indeed expressed in transfected cells by probing immunoblots of total cell lysates with a rabbit anti-CENP-C antibody (Fig. 4). These results suggest that arginine at position 522 is required for centromere targeting, and that this basic residue may play a direct role in mediating interactions between CENP-C and another centromere component. The six mutant proteins that showed weak centromere localization each had mutations in at least one of three other residues, R525, W531, or V533 (Appendix). One had a single mutation in V533, implicating this residue in centromere localization. Expression of CENP-C aa 1-591/GFP in which only W531 had been mutated (W531R) confirmed that mutation of W531 alone also significantly reduced centromere localization (Fig. 2B). Expression of the W531R and V533G fusion proteins was also verified by immunoblotting (Fig. 4). Together, these mutations define a 12-aa region that is critical for centromere targeting. In all cases where centromere targeting was diminished or abolished, at least one residue had been mutated between aa 522 and 534. These results identify this region as a candidate domain for DNA and/or protein interactions that are involved in localizing CENP-C to the centromere. Lanini and McKeon [26] showed that CENP-C also contains a centromere localization domain between amino acids 584 and 943, that has the ability to target human CENP-C to centromeres in baby hamster kidney cells. We expressed CENP-C aa 634 –943/GFP in HeLa cells, and confirmed the ability of this domain to target to centromeres in a human cells as well (Fig. 5). To ask if mutation of the central centromere targeting domain dominantly interfered with centromere target-

86

SONG ET AL.

FIG. 3. Partial amino acid sequence of CENP-C, including the central centromere targeting domain (light shading, 478 –537) [23]. Dark shading indicates the positions of two putative nucleoplasmin-like nuclear localization signals [19]. Amino acids listed above the sequence are PCR-induced substitutions present in mutant proteins that disrupted centromere localization in vivo. Amino acids listed below the sequence are substitutions present in mutant proteins that retain the ability to target to centromeres. Outlining indicates substitutions that were found exclusively in mutants that disrupt centromere localization. The bold line is positioned beneath the 12 amino acid region that is mutated in each of the proteins that has a reduced ability to localize to centromeres.

ing by this carboxy-terminal domain, we examined localization of full-length CENP-C aa 1–943/GFP fusion protein in which we had incorporated the R522G mutation. The R522G mutation had no detectable effect on centromere localization of full-length CENP-C, as determined in formaldehyde fixed cells by colocalization

of the GFP signal with anti-CENP-B antibody staining (Fig. 5). Of 576 GFP spots scored in 10 cells, 522 (90.6%) colocalized with CENP-B antibody staining. These results suggest that the two centromere-targeting domains of CENP-C are capable of functioning independently with respect to centromere localization.

CENP-C CENTROMERE TARGETING

FIG. 4. Immunoblot of CENP-C/GFP fusion proteins expressed in HeLa cells probed with rabbit anti-CENP-C. (A) Wild-type CENPC1-591. (B) CENP-C1-591 (R522G)/GFP. (C) CENP-C1-591 (W531R)/ GFP. (D) CENP-C1-591 (V533G)/GFP.

Yeast Two-Hybrid Screen for CENP-C- the Interacting Proteins The central domain amino acids we identified as critical for centromere localization lie outside of the “core” DNA binding sequences essential for DNA binding in vitro [25]. This suggested that, rather than directly interacting with DNA, the region we have defined might instead interact with another centromere protein. We sought to identify this putative protein using a differential yeast two-hybrid protein interaction screen. First, we screened a HeLa cDNA library using as bait the wild-type sequences encoding CENP-C amino acids 313– 620. From this initial screen we identified 17 classes of cDNAs encoding different putative interacting proteins (see Materials and Methods). Each putative interacting protein was then tested for interaction with the same region of CENP-C in which the mutation encoding R522G had been introduced. None of the interactions was abolished or measurably diminished by the mutation, as assayed by a Leu2 ⫹ reporter-dependent growth on leucine-minus media, or by liquid assays of ␤-gal reporter gene expression level. These results suggest either that this domain does not mediate interaction with another protein, or merely that we failed to identify the relevant interacting protein. The proteins we identified, although unlikely to be required for CENP-C assembly at centromeres, may nonetheless truly interact with CENP-C in vivo. Further investigation will be required to determine their precise role(s), if any, at centromeres. DISCUSSION

Understanding kinetochore assembly and function will not only require detailed knowledge of each of its constituent proteins, but also determination of how these individual parts interact and coordinate to form a cohesive unit. We have taken a step toward this goal by further characterizing the central centromere local-

87

ization domain of CENP-C, a protein essential for both the structure and function of kinetochores. A number of observations suggest that CENP-C is a critical component in kinetochore assembly. It is constitutively present at centromeres, and therefore may act early in the assembly process. It resides within the inner kinetochore plate [19] a location that suggests a role in setting up a foundation on which to add other kinetochore components. Indeed, inhibition of CENP-C by antibody injection appears to destroy this foundation, and leads to disruption of the trilaminar structure [20]. The phenotypes of CENP-C knockouts in both chicken and mouse support a critical role in chromosome segregation [21, 22]. Finally, CENP-C shares homology with the yeast centromere protein Mif2p [38, 39]. MIF2 has been shown to interact genetically with components of the yeast essential core protein complex, Cbf3, and Mif2p coimmunoprecipitates with DNA sequences of the yeast centromere from chemically cross-linked nuclei [39, 40]. The conservation at the amino acid level implies that CENP-C may also interact with conserved functional components of the human kinetochore. Here we have specifically addressed the domain structure of CENP-C in regard to its assembly at centromeres. It had previously been shown that CENP-C possesses two centromere targeting domains that can function independently to localize the protein [23, 26]. One of these maps within a central region that can both target CENP-C to centromeres and bind DNA in vitro [23–25]. The second maps to the carboxy-terminal region, which is conserved in the budding yeast CENP-C homolog Mif2p [38], and is capable of mediating homodimerization [25]. We focused on the central targeting domain, as it seemed more likely to be involved in interactions with other centromere components, and thus more likely to shed insight on such interactions. We found that essential residues for centromere localization in vivo map to amino acids 522–534. A BLAST homology search revealed that this region is highly conserved in the mouse CENP-C homolog, which is either identical or has conservative substitutions at each position with the exception of V534. Each of the four amino acids identified as critical for centromere targeting are identical in the mouse [41]. These residues are not conserved, however, in nonmammalian CENP-C homologs, including Sacchalomyces cerevisiae Mif2p [42], Caenorhabditis elegans HCP-4 [43], Gallus domesticus CENP-C [22], or Zea mays CENP-C [44]. Thus, this domain appears to be a mammalianspecific feature of CENP-C. A motif search (http:// www.motif.genome.ad.jp/) failed to identify the presence of this sequence in other known proteins. These critical amino acids for centromere localization map outside of the “core” DNA binding sequences,

88

SONG ET AL.

aa 396 – 498, shown to be necessary and sufficient for in vitro DNA binding [25]. However, they map within a flanking region that is required for stronger DNA binding in Southwestern blotting assays [25]. Thus, amino acids 522–534 may be necessary for stabilizing contacts between CENP-C and DNA in vivo, or may act in conferring specificity to the core DNA binding domain. Such centromere specificity may not depend on DNA sequence per se, but rather might be involved in recognizing a centromere-specific sequence conformation, as has been proposed for alpha satellite DNA [45]. Alternatively, the model of the CENP-C central domain targeting to centromeres by direct DNA binding may be too simplistic. Fifty-eight of our fusion proteins were mutated in the “core” domain required for in vitro DNA binding (aa 396 – 498, [25]), but not in the 12 amino acids required for centromere targeting. Each of these retained the ability to target to centromeres. These results suggest that DNA binding may not be necessary for centromere localization, and bring into question the in vivo significance of the in vitro DNA binding observations. Direct tests of our mutations for effects on in vitro DNA binding by CENP-C may further clarify the relationship between its in vitro DNA binding ability and centromere assembly. Another possibility is that the critical amino acids we identified might be a site of posttranslational modification necessary for centromere assembly. In consideration of this possibility, we looked for consensus sequences for known protein modifications. Of particular interest is the consensus sequence “␺ K X E” for Ubc9 binding and SUMO-1 modification, where ␺ is hydrophobic and X is any amino acid [46]. There is only one occurrence of this motif in human CENP-C, at amino acids 533–536, partially overlapping the 12 amino acids essential for centromere targeting. Indirect evidence suggests a connection between SUMO-1 modification and CENP-C, although CENP-C has not been shown directly to be SUMO modified. First, the yeast homologue of SUMO-1, SMT3, was isolated as a suppressor of mutations in the MIF2 gene [47]. Second, CENP-C is a substrate for proteosome degradation induced by the viral protein Vmw110 [48]. Other proteins identified as preferential targets of Vmw110-induced degradation are SUMO-1 modified forms of the ND10 proteins PML and Sp100 [49, 50], leading to speculation that CENP-C may also be SUMO-1 modified [48]. Our data, however, suggest that SUMO-1 modification at this site is not essential for centromere targeting, as we have identified two mutations in the putatively modified lysine residue at position 536 that do not abolish localization (K536N and K536R). Lastly, the critical residues within the central targeting domain may be necessary for interacting with another centromere protein. While our efforts to identify such a protein using the yeast two-hybrid system

have been unsuccessful, these negative results do not rule out this possibility. The mRNA encoding such a putative interacting protein may be rare and thus under-represented in our library, or expression of the protein may be toxic to yeast. This model of CENP-C targeting via protein interactions is attractive in that is does not invoke sequence specificity for determining centromere assembly of CENP-C. Previous attempts to identify a specific target sequence for CENP-C by immunoprecipitation following in vitro DNA binding were unsuccessful [23]. In addition, studies on neocentromeres argue against a requirement for centromere-specific DNA sequences in humans. Marker chromosomes that lack detectable alphoid satellite DNA can be stably maintained, indicating that they have aquired centromere-like segregation function [15, 51–54]. In one case, detailed restriction enzyme analysis and sequencing has shown that a stable marker chromosome was derived entirely from euchromatic sequences [15, 17]. Rather than a specific DNA sequence, centromere location may be determined by an epigenetic mark [55, 56]. This mark may consist of a specific conformation of centromeric DNA, a heritable chromatin structure, or modification of either the DNA or associated proteins. Importantly, a role of this central centromere targeting domain in protein–protein interactions does not preclude the possibility that DNA binding by CENP-C is required for its proper assembly at centromeres. Contacts between CENP-C and DNA may indeed be critical for establishing proper kinetochore structure, but may not be sufficient for the assembly of CENP-C at centromeres. Clearly, these studies are only a first step in defining the role of CENP-C in kinetochore assembly. Our understanding of how CENP-C is assembled remains limited by the lack of knowledge of other components with which it interacts. Both the specific mutations that abolish centromere localization and the candidate CENP-C interacting proteins we have identified here should provide useful tools for defining these interacting components, and eventually for testing the impact of these interactions on centromere assembly and function. APPENDIX

PCR-induced mutants in CENP-C fall into three classes with respect to their ability to localize to centromeres. The amino acid changes as identified by conceptual translation of mutated DNA sequences are shown. Six mutants were identified that showed a punctate intranuclear pattern consistent with centromere localization in fewer than 5% of expressing cells (1– 6). These were all mutated in one of three amino acid residues, indicated by underlining. An additional

89

CENP-C CENTROMERE TARGETING

five mutants never showed centromere localization (7– 11). All of these are mutated at arginine 522. The remainder localize to centromeres (12–204). centromere localization V533G R525C ⫹ W531V R525T ⫹ P527A W531G ⫹ K534R E494G ⫹ R525G R456G ⫹ K474R ⫹ S502G ⫹ T518A ⫹ W531R ⫹ I576V ⫹ Q581R No centromere localization 7 R522G ⫹ W531R 8 K519I ⫹ R522S ⫹ W531G 9 R522I ⫹ I523F ⫹ S524R ⫹ W530R ⫹ V532G ⫹ V533I 10 D491G ⫹ E512G ⫹ R522G ⫹ E536G ⫹ S567P ⫹ L578P 11 R460G ⫹ K484R ⫹ T488A ⫹ K492R ⫹ T514A ⫹ R522G ⫹ R525G ⫹ D529G ⫹ K534E ⫹ S538G Centromere localization 12 L462M 13 Q581R 14 E512G 15 K586I 16 E474V 17 E464G 18 L578I 19 S542G 20 K490R 21 K484E 22 A584T 23 Q451L 24 T561S 25 V533I 26 H553P 27 T575A 28 V513E 29 E464A 30 L508F 31 S567P 32 S486G 33 A584V 34 E537K 35 T571I 35 H465L 36 M478V ⫹ N543Y 37 V481M ⫹ S502N 38 S544P ⫹ S560P 39 S544T ⫹ S560T 40 D491E ⫹ V513E 41 S474P ⫹ N506S 42 K519I ⫹ K569M 43 H465R ⫹ Q477R 44 S538C ⫹ Y541C 45 H465Q ⫹ P551Q 46 E467V ⫹ L550F 47 K519E ⫹ S554A 48 D471V ⫹ R580G 49 R525G ⫹ K579R 50 K496E ⫹ D459G 51 R499H ⫹ N565T 52 S487G ⫹ E537Y 53 L550F ⫹ N565I 54 P480S ⫹ R489K ⫹ S515L 55 V509L ⫹ N543Y ⫹ K574N 56 E467G ⫹ N470D ⫹ S535T

E493G ⫹ E494G ⫹ S495F V481A ⫹ V509G ⫹ H554P V546L ⫹ S557N ⫹ K586R M468V ⫹ N548S ⫹ L550S K475E ⫹ K490G ⫹ Y541H E503V ⫹ K519I ⫹ K569M K597E ⫹ S524P ⫹ I576T T514A ⫹ R525G ⫹ T583A S501T ⫹ L508I ⫹ V509L ⫹ S520R S487G ⫹ V509I ⫹ E536G ⫹ T575A H465Y ⫹ K490I ⫹ V546I ⫹ I571F Y481G ⫹ E493G ⫹ E494V ⫹ K498R E467G ⫹ D471G ⫹ S502R ⫹ N565S E464G ⫹ D471G ⫹ V473A ⫹ I523T E464R ⫹ K475E ⫹ T518A ⫹ K519R R460G ⫹ K498E ⫹ S502G ⫹ K562R V509A ⫹ E511G ⫹ E512G ⫹ N543H ⫹ S544P Q455R ⫹ E463G ⫹ K487R ⫹ K507R ⫹ H554N D452G ⫹ M478I ⫹ T514S ⫹ L550F ⫹ R572W K534R ⫹ K563R ⫹ I571T ⫹ K579R ⫹ K582E R460S ⫹ K505R ⫹ T561A ⫹ Q566R ⫹ R572G D471G ⫹ S538G ⫹ V540A ⫹ N548D ⫹ K569E K485R ⫹ K497R ⫹ E512G ⫹ I523V ⫹ N543S ⫹ T583A N506I ⫹ V513E ⫹ R547K ⫹ N515K ⫹ K574N ⫹ T574N S487R ⫹ T488A ⫹ S520G ⫹ T564A ⫹ S567P ⫹ R572G N461D ⫹ K476E ⫹ T488A ⫹ V513A ⫹ I523V ⫹ T561A K490R ⫹ K507E ⫹ V540A ⫹ K563E ⫹ I571T ⫹ I576T R460G ⫹ R489G ⫹ K490R ⫹ S528P ⫹ K534N ⫹ N570D ⫹ K582E 85 N462T ⫹ S524P ⫹ S528P ⫹ E537G ⫹ S528P ⫹ E537G ⫹ N548D ⫹ K573R 86 E467G ⫹ K476E ⫹ K492R ⫹ K497R ⫹ E537G ⫹ K562E ⫹ K563E ⫹ T564A ⫹ K586E 87 Q455R ⫹ R456G ⫹ M462T ⫹ E463G ⫹ K485E ⫹ I523T ⫹ M552T ⫹ H554R ⫹ K563R ⫹ Q566R 88 D471E ⫹ S486I ⫹ K492R ⫹ E494D ⫹ K498R ⫹ S501T ⫹ R521G ⫹ S528C ⫹ E537V ⫹ S538C ⫹ N543F ⫹ N548S ⫹ S557R ⫹ K559I ⫹ S560Y ⫹ K562E ⫹ K563N ⫹ N565Y ⫹ Q566L ⫹ S567L ⫹ K569E ⫹ R572G

57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84

Weak 1 2 3 4 5 6

This work was supported in part by American Cancer Society Institutional Research grant IRG-162H to J.T. We thank Michael Hagen of the Center for Molecular Medicine and Genetics Core Facility for performing DNA sequencing of the CENP-C mutants, Brian Seed for providing a clone of the humanized GFP cDNA, Russ Finley for providing the yeast two-hybrid strains and library, and Ann Pluta, Mary Murray, and Albert Briscoe Jr. for critical reading of the manuscript.

REFERENCES 1.

Reider, C. L. (1982). The formation, structure and composition of the mammalian kinetochore and kinetochore fiber. Int. Rev. Cytol. 79, 1–58.

2.

Wordeman, L., Steurer, E., Sheetz, M., and Mitchison, T. (1991). Chemical subdomains within the kinetochore of isolated CHO mitotic chromosomes. J. Cell Biol. 114, 285–294.

3.

Cooke, C. A., Schaar, B., Yen, T. J., and Earnshaw, W. C. (1997). Localization of CENP-E in the fibrous corona and outer plate of mammalian kinetochores from prometaphase through anaphase. Chromosoma 106, 446 – 455.

4.

Yao, X., Anderson, K. L., and Cleveland, D. W. (1997). The microtubule-dependent motor centromere-associated protein E (CENP-E) is an integral component of kinetochore corona fibers

90

5. 6.

7. 8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

SONG ET AL. that link centromeres to spindle microtubules. J. Cell Biol. 139, 435– 447. Nicklas, R. B. (1997). How cells get the right chromosomes. Science 275, 632– 637. Skibbens, R. V., and Hieter, P. (1998). Kinetochores and the checkpoint mechanism that monitors for defects in the chromosome segregation machinery. Annu. Rev. Genet. 32, 307–337. Shah, J. V., and Cleveland, D. W. (2000). Waiting for anaphase: Mad2 and the spindle assembly checkpoint. Cell 103, 997–1000. Clarke, L. (1998). Centromeres: Proteins, protein complexes, and repeated domains at centromeres of simple eukaryotes. Curr. Opin. Genet. Dev. 8, 212–218. Craig, J. M., Earnshaw, W. C., and Vagnarelli, P. (1999). Mammalian centromeres: DNA sequence, protein composition, and role in cell cycle progression. Exp. Cell Res. 246, 249 –262. Dobie, K. W., Hari, K. L., Maggert, K. A., and Karpen, G. H. (1999). Centromere proteins and chromosome inheritance: A complex affair. Curr. Opin. Genet. Dev. 9, 206 –217. Warburton, P. E. (2001). Epigenetic analysis of kinetochore assembly on variant human centromeres. Trends Genet. 17, 243–247. Clarke, L., and Carbon, J. (1980). Isolation of a yeast centromere and construction of functional small circular chromosomes. Nature 287, 504 –509. Hieter, P., Pridmore, D., Hegemann, J. H., Thomas, M., Davis, R. W., and Philipsen, P. (1985). Functional selection and analysis of yeast centromeric DNA. Cell 42, 913–921. Koshland, D., Kent, J. C., and Hartwell, L. H. (1985). Genetic analysis of the mitotic transmission of minichromosomes. Cell 40, 393– 403. du Sart, D., Cancilla, M. R., Earle, E., Mao, J. I., Saffery, R., Tainton, K. M., Kalitsis, P., Martyn, J., Barry, A. E., and Choo, K. H. (1997). A functional neo-centromere formed through activation of a latent human centromere and consisting of nonalpha-satellite DNA. Nat. Genet. 16, 144 –153. Williams, B. C., Murphy, T. D., Goldberg, M. L., and Karpen, G. H. (1998). Neocentromere activity of structurally acentric mini-chromosomes in Drosophila. Nat. Genet. 18, 30 –37. Barry, A. E., Bateman, M., Howman, E. V., Cancilla, M. R., Tainton, K. M., Irvine, D. V., Saffery, R., and Choo, K. H. (2000). The 10q25 neocentromere and its inactive progenitor have identical primary nucleotide sequence: Further evidence for epigenetic modification. Genome Res. 10, 832– 838. Maggert, K. A., and Karpen, G. H. (2000). Acquisition and metastability of centromere identity and function: Sequence analysis of a human neocentromere. Genome Res. 10, 725–728. Saitoh, H., Tomkiel, J., Cooke, C. A., Ratrie, H., Maurer, M., Rothfield, N. F., and Earnshaw, W. C. (1992). CENP-C, an autoantigen in scleroderma, is a component of the human inner kinetochore plate. Cell 70, 115–125. Tomkiel, J., Cooke, C. A., Saitoh, H., Bernat, R. L., and Earnshaw, W. C. (1994). CENP-C is required for maintaining proper kinetochore size and for a timely transition to anaphase. J. Cell Biol. 125, 531–545. Kalitsis, P., Fowler, K. J., Earle, E., Hill, J., and Choo, K. H. (1998). Targeted disruption of mouse centromere protein C gene leads to mitotic disarray and early embryo death. Proc. Natl. Acad. Sci. USA 95, 1136 –1141. Fukagawa, T., and Brown, W. R. (1997). Efficient conditional mutation of the vertebrate CENP-C gene. Hum. Mol. Genet. 6, 2301–2308. Yang, C. H., Tomkiel, J., Saitoh, H., Johnson, D. H., and Earnshaw, W. C. (1996). Identification of overlapping DNA-binding

and centromere-targeting domains in the human kinetochore protein CENP-C. Mol. Cell Biol. 16, 3576 –3586. 24.

Sugimoto, K., Yata, H., Muro, Y., and Himeno, M. (1994). Human centromere protein C (CENP-C) is a DNA-binding protein which possesses a novel DNA-binding motif. J. Biochem. (Tokyo) 116, 877– 881.

25.

Sugimoto, K., Kuriyama, K., Shibata, A., and Himeno, M. (1997). Characterization of internal DNA-binding and C-terminal dimerization domains of human centromere/kinetochore autoantigen CENP-C in vitro: Role of DNA-binding and selfassociating activities in kinetochore organization. Chromosome Res. 5, 132–141.

26.

Lanini, L., and McKeon, F. (1995). Domains required for CENP-C assembly at the kinetochore. Mol. Biol. Cell 6, 1049 – 1059.

27.

Heim, R., Prasher, D. C., and Tsien, R. Y. (1994). Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc. Natl. Acad. Sci. USA 91, 12501–12504.

28.

Haas, J., Park, E. C., and Seed, B. (1996). Codon usage limitation in the expression of HIV envelope glycoprotein. Curr. Biol. 6, 315–324.

29.

Kozak, M. (1991). An analysis of vertebrate mRNA sequences: Intimations of translational control. J. Cell Biol. 115, 887–903.

30.

Goldberg, I. G., Sawhney, H., Pluta, A. F., Warburton, P. E., and Earnshaw, W. C. (1996). Surprising deficiency of CENP-B binding sites in African green monkey alpha-satellite DNA: Implications for CENP-B function at centromeres. Mol. Cell Biol. 16, 5156 –5168.

31.

Fromant, M., Blanquet, S., and Plateau, P. (1995). Direct random mutagenesis of gene-sized DNA fragments using polymerase chain reaction. Anal. Biochem. 224, 347–353.

32.

Rothfield, N., Whitaker, D., Bordwell, B., Weiner, E., Senecal, J.-L., and Earnshaw, W. C. (1987). Detection of anticentromere antibodies using cloned autoantigen CENP-B. Arthritis Rheum. 30, 1416 –1419.

33.

Golemis, E., Gyuris, G., and Brent, R. (1996). Interactiontrap/ two-hybrid system to identify interacting proteins. In “Current Protocols in Molecular Biology,” (F. A. Ausubel et al., Eds.), pp. 20.21.21–20.21.28, John Wiley & Sons; New York.

34.

Brent, R., and Finley, R. L., Jr. (1997). Understanding gene and allele function with two-hybrid methods. Annu. Rev. Genet. 31, 663–704.

35.

Gyuris, J., Golemis, E., Chertkov, H., and Brent, R. (1993). Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75, 791– 803.

36.

Prasher, D. C., Eckenrode, V. K., Ward, W. W., Prendergast, F. G., and Cormier, M. J. (1992). Primary structure of the Aequorea victoria green-fluorescent protein. Gene 111, 229 – 233.

37.

Pluta, A., Saitoh, N., Goldberg, I., and Earnshaw, W. C. (1992). Identification of a subdomain of CENP-B that is necessary and sufficient for targeting to the human centromere. J. Cell Biol. 116: 1081–1093.

38.

Brown, M. T. (1995). Sequence similarities between the yeast chromosome segregation protein Mif2 and the mammalian centromere protein CENP-C. Gene 160, 111–116.

39.

Meluh, P. B., and Koshland, D. (1995). Evidence that the MIF2 gene of Saccharomyces cerevisiae encodes a centromere protein with homology to the mammalian centromere protein CENP-C. Mol. Biol. Cell 6, 793– 807.

40.

Meluh, P. B., and Koshland, D. (1997). Budding yeast centromere composition and assembly as revealed by in vivo crosslinking. Genes Dev. 11, 3401–3412.

CENP-C CENTROMERE TARGETING 41.

42.

43.

44.

45.

46.

47.

48.

49.

Kalitsis, P., MacDonald, A. C., Newson, A. J., Hudson, D. F., and Choo, K. H. (1998). Gene structure and sequence analysis of mouse centromere proteins A and C. Genomics 47, 108 –114. Meeks-Wagner, D., Wood, J. S., Garvik, B., and Hartwell, L. H. (1986). Isolation of two genes that affect mitotic chromosome transmission in S. cerevisiae. Cell 44, 53– 63. Moore, L. L., and Roth, M. B. (2001). HCP-4, a CENP-C-like protein in Caenorhabditis elegans, is required for resolution of sister centromeres. J. Cell Biol. 153, 1199 –1208. Dawe, R. K., Reed, L. M., Yu, H. G., Muszynski, M. G., and Hiatt, E. N. (1999). A maize homolog of mammalian CENPC is a constitutive component of the inner kinetochore. Plant Cell 11, 1227–1238. Schueler, M. G., Higgins, A. W., Rudd, M. K., Gustashaw, K., and Willard, H. F. (2001). Genomic and genetic definition of a functional human centromere. Science 294, 109 –115. Sampson, D. A., Wang, M., and Matunis, M. J. (2001). The small ubiquitin-like modifier-1 (SUMO-1) consensus sequence mediates Ubc9 binding and is essential for SUMO-1 modification. J. Biol. Chem. 276, 21664 –21669. Meluh, P. B., and Koshland, D. (1996). Suppressors of MIF2, a putative centromere protein gene in Saccharomyces cerevisiae. Mol. Biol. Cell 6, 360a. Everett, R. D., Earnshaw, W. C., Pluta, A. F., Sternsdorf, T., Ainsztein, A. M., Carmena, M., Ruchaud, S., Hsu, W. L., and Orr, A. (1999). A dynamic connection between centromeres and ND10 proteins. J. Cell Sci. 112, 3443–3454. Chelbi-Alix, M. K., and de The, H. (1999). Herpes virus induced proteasome-dependent degradation of the nuclear bodies-associated PML and Sp100 proteins. Oncogene 18, 935–941.

Received October 18, 2001 Revised version received January 22, 2002 Published online March 11, 2002

91

50.

Everett, R. D., Earnshaw, W. C., Findlay, J., and Lomonte, P. (1999). Specific destruction of kinetochore protein CENP-C and disruption of cell division by herpes simplex virus immediateearly protein Vmw110. Embo. J. 18, 1526 –1538.

51.

Voullaire, L. E., Slater, H. R., Petrovic, V., and Choo, K. H. (1993). A functional marker centromere with no detectable alpha-satellite, satellite III, or CENP-B protein: Activation of a latent centromere? Am. J. Hum. Genet. 52, 1153–1163.

52.

Ohashi, H., Wakui, K., Ogawa, K., Okano, T., Niikawa, N., and Fukushima, Y. (1994). A stable acentric marker chromosome: Possible existence of an intercalary ancient centromere at distal 8p. Am. J. Hum. Genet. 55, 1202–1208.

53.

Sacchi, N., Magnani, I., Fuhrman-Conti, A. M., Monard, S. P., and Darfler, M. (1996). A stable marker chromosome with a cryptic centromere: Evidence for centromeric sequences associated with an inverted duplication. Cytogenet. Cell Genet. 73, 123–129.

54.

Depinet, T. W., Zackowski, J. L., Earnshaw, W. C., Kaffe, S., Sekhon, G. S., Stallard, R., Sullivan, B. A., Vance, G. H., Van Dyke, D. L., Willard, H. F., Zinn, A. B., and Schwartz, S. (1997). Characterization of neo-centromeres in marker chromosomes lacking detectable alpha-satellite DNA. Hum. Mol. Genet. 6, 1195–1204.

55.

Karpen, G. H., and Allshire, R. C. (1997). The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489 – 496.

56.

Wiens, G. R., and Sorger, P. K. (1998). Centromeric chromatin and epigenetic effects in kinetochore assembly. Cell 93, 313– 316.