Mutational analysis of the influenza virus vRNA promoter

Virus Research, 28 (1993) 99-112 © 1993 Elsevier Science Publishers B.V. All rights reserved 0168-1702/93/$06.00

99

VIRUS 00879

Mutational analysis of the influenza virus vRNA promoter M a r i a Elisa Piccone *, A n a F e r n a n d e z - S e s m a and P e t e r Palese Department of Microbiology., Mount Sinai School of Medicine, New York, NY 10029. USA (Received 3 November 1992; revision received and accepted 21 December 1992)

Summary The influenza virus vRNA promoter was characterized: a complete set of single substitution mutants was generated in the fifteen 3' terminal nucleotides of a synthetic model RNA containing the reporter gene chloramphenicol acetyl transferase (CAT). The contribution of each nucleotide to the function of the promoter was tested by an in vitro assay. This system involves reconstitution of template (mutant) RNAs and purified viral polymerase; the system is primer-dependent and yields full-length complementary (c)RNA and not poly A-containing mRNA. The rescits of this in vitro.replication assay suggest that (1) nucleotides 1 to 14 at the 3' terminus comprise the promoter sequence of the vRNA, (2) not all the mutations in the first 14 nucleotides affect vRNA promoter activity equally and (3) changes in positions 2 and 11 have the greatest effect on this promoter activity. In addition, the template (mutant) RNAs were examined in an in vivo assay. This system involves transfection of plasmid DNA-derived template (mutant) RNAs into helper virus-infected cells and measurement of levels of CAT activity. The expression of template RNAs was found to be highly sensitive to mutations in almost any of the first 14 positions. Differences in the results of the in vivo and the in vitro system are possibly due to the presence of overlapping crY-acting signals which are required for replication of vRNA and the expression of mRNA. Deletion and addition of nucleotides at the 3' end of the promoter resulted in a drastic reduction in template activity in both the in vitro and in vivo assays. Correspondence to: P. Paiese, Department of Microbiology, Mount Sinai School of Medicine. One Gustave Levy Place, New York, NY 10029, USA. * Present address: Plum Island Animal Disease Center. Agricultural Research Service. United States Department of Agriculture, Greenport, NY 11944, USA.

!~ Influenza virus: vRNA promoter: in vitro transcription/replication; ribonucleoprotein transtection: ~c~,cisc genetics: CAT expression

Introduction

The genome of influenza A viruses contains 8 negative-sense RNA segments, which code for l0 viral proteins. In infected cells, the genomic RNA segments serve as templates for the synthesis of subgenomic mRNAs as well as for full-length plus-sense RNAs (complementary or cRNAs), which in turn are templates for the synthesis of the negative-sense genomic RNAs (virion or vRNAs) (Krug et al., 1989). The viral RNA polymerase complex possesses the activities of a replicase as well as of a transcriptase, and catalyzes all influenza virus-specific RNA synthesis (review in Ishihama and Nagata, 1988; Huang et al., 1990). It is likely that this complex is made up of the viral nucleoprotein (NP) and the PB1, PB2 and PA polymerase proteins, but the contribution of cellular a n d / o r viral regulatory proteins has not been definitively excluded (Hatada et al., 1992; Kimura et al., 1992: Kobayashi et al., 1992; Li and Palese, 1992; Seong and Brownlee, 1992). A comparison of the sequences of genomic RNAs of different influenza A viruses revealed highly conserved 12-nucleotide and 13-nucleotide regions at the 3' termini and the 5' termini, respectively (Skehel and Hay, 1978; Robertson, 1979; Desselberger et al., 1980). These termini have inverted complementary sequences and are responsible for the formation of a panhandle structure in the mature virion (Hsu et al., 1987; Honda et al., 1988). It has been postulated that these sequences a n d / o r structures are of vital importance for the replication and packaging of influenza viral RNAs (for review see Luo and Palese, 1992). The ability, to purify, biologically active vira! po!ymerase by cesium chloride gradient centrifugation allowed us for the first time to study the function of these conserved sequences in an experimental setting (Parvin et al., 1989). Our in vitro experiments using purified influenza virus polymerase and synthetic eDNA derived RNAs have shown that the 3' terminal 15 nucleotides of influenza virus RNAs include the promoter for the transcription of viral RNAs (Parvin et al., 1989). In addition, we have developed a ribonucleoprotein (RNP) transfection system in which RNA derived from plasmid DNA is mixed with purified influenza virus po!ymerase complex and transfected into helper virus-infected cells (Luytjes et al., 1989). The RNP transfection system has now allowed us to study in vivo the cis-acting elements required for transcription, replication and expression of the viral RNAs (Luytjes et al., 1989; Luo et al., 1991; Li and Palese, 1992). Using this in vivo RNP transfection system, we suggested that the first 11 3' terminal nucleotides would be sufficient to form a transcriptional promoter for influenza A virus RNAs (Luo et al., 1991). However, this result differed from that reported by another group using a similar in vivo RNP transfection system (Yamanaka et al., 1991); they located the promoter for cRNA synthesis near the 3' terminus but not at the very 3' terminal end. These authors also found that

ltll

mutations in positions 6-14 from the 3' end reduced promoter activity of the templates. Additional in vitro studies by Seong and Brownlee (1992) involving the use of selected mutants suggested that the initial 12 nucleotides at the 3' terminus of vRNAs represent the promoter sequence required for cRNA synthesis. In order to precisely define the sequences involved in promoter activity we performed an extensive in vitro and in vivo analysis of the promoter region. By site-directed mutagenesis of plasmid DNA (containing the chloramphenicol acetyltransferase (CAT) gene flanked by the 5' and 3' non-coding sequences of the NS gene of influenza A virus), we have changed each one of the 15 3' terminal nucleotides of the genomic RNA into the 3 other possible nucleotides. Transcription of the mutated promoter linked to the reporter gene was tested both in vitro and in vivo. Our results suggest that nucleotides 1-14 define the promoter for cRNA synthesis and that some positions of the promoter are more sensitive to mutations than others. We also show that the addition or deletion of a nucleotide(s) at the 3' terminus of the promoter dramatically reduces its activity, indicating that an exact 3' terminus is essential for promoter activity.

Materials and Methods

Viruses and cells Influenza A / P R / 8 / 3 4 and A / W S N / 3 3 viruses were grown in 10-day-old embryonated eggs and Madin-Darby bovine kidney (MDBK) cells, respectively (Ritchey et al., 1976; Sugiura et al., 1972). MDBK cells were also used for transfection experiments.

Construction of plasmids Plasmids with mutated promoter sequences were derived from plVACAT1, which contains the chloramphenicol acetyltransferase (CAT) gene flanked by the non-coding sequences of the NS gene of the influenza A virus (Luytjes et al., 1989). Transcription from plVACAT1 by T7 RNA polymerase yields an RNA with the correct 3' and 5' termini of the influenza virus NS gene. To facilitate the construction of mutants one unique Sail restriction enzyme site was created in plVACAT1 by introducing silent mutations in codon 11 (GT-I" to GTC) and codon 12 (GAT to GAC). The p l V A C A T 1 / S (Fig. 1) was constructed as follows: a product was obtained by PCR using plVACATI as template and the primers 5'-CGCCCTGCAGCAAAAGCAGGGTGACAAAGACATAATGGA" GAAAAAAATCACTGGGTATACCACCGTCGACATATCCCAATCGC 3; and 5 ' - C G G A A T T C C G G A T G A G C A T T C A T C A G G 3'. The PCR product was then digested with PstI and BspE I and cloned into the respective sites of plVACAT1. All mutants were constructed by cassette mutagenesis. Briefly, sets of oligonucleotides were annealed and inserted into the appropriate restriction enzyme sites

!(}2

m

TAA

_

""

"

~°

t

ATG

ca

VT

5"

CAT

gene

u~A

5"

CAT

gene

ulc

5"

CAT

gene

ulG

5"

CAT

gene

~

~

CACCCUGCUUUUGCU

3"

A

3"

c

3"

G

3"

Fig. 1. Diagram of plVACAT1/S and RNA transcripts. The top of the diagram shows the structure of the pIVACAT1/S vector which contains the entire coding region of the CAT gene flanked by the noncoding sequences of the NS gene of the influenza A virus, pIVACAT1/S is identical to pIVACAT1 (Luytjes et al.. 1989) except for the unique Sal| restriction enzyme site. Restriction enzyme sites in plVACAT1/S are indicated. Mutations in the 3' noncoding sequence of pIVACAT1/S were introduced by cassette mutagenesis (see Materials and Methods). On the bottom of the diagram, the RNAs are shown which result from T7 RNA polymerase transcription of Hgal iinearized plasmids. The 15 3' terminal nucleotides of wild-type RNA are indicated; changes in mutant RNAs are also indicated. The names of the mutants are shown at the left, for example U1A refers to a mutant with a change in the first nucleotide position from U to A. of p I V A C A T 1 / S . Oligonucleotides were synthesized on an A p p l i e d Biosystems D N A Synthesizer, Model 380B. Standard procedures were used for the digestion, isolation and ligation of fragments and for the transformation of E. coli with plasmid D N A ( M a n i a t i s et al., 1982). Each plasmid was s e q u e n c e d to confirm that the expected substitution was introduced using the S e q u e n a s e kit from U n i t e d States Biochemical Inc. Pla~,mid D N A s were purified by cesium chloride e q u i l i b r i u m gradient centrifugation.

RNA template synthesis p I V A C A T 1 / S and mutant plasmids were digested with HgaI or other restriction enzymes to produce D N A t e m p l a t e s for T7 polymerase transcription. T h e T7 polymerase reaction was p e r f o r m e d at 37°C for 2 h in a final volume of 100 /zl. The mixture contained 5 ~ g of D N A template, 0.5 m M NTPs, 100 U of R N a s i n (Promega), 0.07/.tM [3H]UTP (spec. act. 23.40 C i / m m o l ; New E n g l a n d N u c l e a r Corp.) and 100 U of T7 R N A polymerase in the r e c o m m e n d e d buffer (Stratagene). The reaction mixture was treated with 5/~l of R Q I D N a s e I (Promega) at 37°C for 15 min. Free nucleotides were removed by using Quick Spin G50 c o l u m n s

103

(Boehringer-Mannheim Biochemicals) and RNA products were ethanol-precipitated and then analyzed on a 4% PAGE in 7 M urea. For visualization of the RNA bands the gels were silver-stained. The amount of transcribed RNA was estimated by the level of the 3H incorporation in the experiment; 1000 CPM of [3H]UTP corresponded to the synthesis of approximately 200 ng of RNA. In citro transcription by the influenza a cirus RNA polymerase The RNA polymerase complex was purified from influenza A / P R / 8 / 3 4 virus according to the previously published protocol (Parvin et al., 1989; Li and Palese, 1992). The concentration of purified influenza virus polymerase proteins was approximately 0.3 /zg//zl. In vitro transcription by the viral polymerase complex was carried out according to Luo et al. (1991) unless otherwise indicated. One/~g of 3H-labeled RNA template was incubated with 1.5 /.tg of purified viral polymerase for 2 h at 30°C in the presence of 0.4 mM ApG primer (SIGMA) or 1/.tg of rabbit globin mRNA (GIBCO), 0.5 mM each ATP, GTP, CTP, 2 0 / z M UTP and 0.5 /zM [32p]UTP (spec. act. 3000 Ci/mmol; New England Nuclear Corp.) in a total volume of 30/zl. The reaction was stopped by adding 180 ~l 0.3 M sodium acetate containing 10 mM EDTA. Following phenol-chloroform extraction and ethanol precipitation, half of each sample was loaded onto a 4% polyacrylamideurea gel. The RNA bands in these gels were localized by autoradiography, cut and eluted by Solvable (DUPONT) for 3 h at 50°C. Counts per minute (CPM) were measured for 3H and 32p. corrections for spillover were made, and the 32p/3H CPM ratio was used to calculate template activity. In each experiment the wild-type RNA was used as control and template activity of mutant RNAs was normalized. RNP transfection and CA T assay The DEAE-dextran RNP transfection protocol was based on a previously published protocol (Enami and Palese, 1991). Briefly, monolayers of MDBK cells in 35-mm diameter dishes were infected with influenza A / W S N / 3 3 virus at a multiplicity of infection of 1 and were then treated with DEAE dextran solution (300/.tg/ml) for 30 min. An RNP transfection mixture (25 #1) containing 0.5/zg of linearized plasmid, 3 /zg of viral polymerase protein and 1 /.tl of T7 RNA polymerase (50 U//xl, Stratagene) were incubated at 37°C for 15 min in the standard transcription buffer. The DNA templates were digested with 2 #1 of RQI DNaseI at 37°C for 15 min. The reaction mixtures were diluted with 100 ~tl of PBS, 0.1% gelatin and transfected into DEAE-treated cells. After 16-18 h, cells were harvested and cell extracts were prepared as described before (Luytjes et al., 1989). CAT assays were done according to standard procedures (Gorman et al.. 1982). The assay mixtures contained (in a final volume of 150 /zl) 2 /zl of [14C]chloramphenicol (spec. act. 50-60 mCi/mmol; New England Nuclear Corp.), 20/zl of 4 mM acetyl coenzyme A (Pharmacia P-L Biochemicals Inc.) and 50 ~tl of cell extract in 0.25 M Tris-HCl pH 7.5. The incubation time was 2 h.

!i14

B 100 [

A 80,

/ eo~-

X

"

.

_g :~ 40; o

I

0 0

0.5

1 I~CAT1/S

t

t

1.5

2

0a 2.5

0

t 2

l

~-

.

4

i

i

6

8

._.

T I M E (hr)

R N A t e m p l a t e (~9)

Fig. 2. In vitro synthesis of cRNA using IVACATI/S RNA as template. A: different amounts of 3H-labeled IVACAT1/S RNA were used as template for influenza virus polymerase transcription (see Materials and Methods). B: 1 #g of ~H-labeled IVACATI/S RNA was used as template for in vitro influenza virus transcription and the amounts of cRNA made were determined for different incubation times (see Materials and Methods).

Results

Optimization of in citro conditions for template activity In order to compare the activity of different templates we determined the conditions for the in vitro transcription assays. As shown in Fig. 2A the amount of [~NIA

.,,,,,

nrr~'lHr.,~A

l.,,~.r~au~.~.,~t

!..,,, , , . , , , , . ; ¢ ; ~ A vy

Vutttt~u

;..,,el ........ tltttu~tlLa

: ...... ¥11Utb

!.~ ldUlylll~ldb~

: J IIIFIK;i:I~UH

I" .... J....... lllll~i:l.lly lip

tO

I

/.tg of R N A template. Using 1 # g of RNA it appears that the synthesis increases linearly during the first 2 h (Fig. 2B). The salt concentration and the temperature at which the reaction was performed were the same as those used previously by Parvin et al. (1989). However, in contrast to the earlier study, the finai concentration of the polymerase proteins was raised to 0.05 /~g//~l because it was found that this condition increased the efficiency of the reaction for longer RNA templates. Comparisons between wild-type and mutated promoters were made using 1 /xg of RNA template for a 2-h incubation period at 30°C. It should be noted that for this analysis only two different preparations of polymerase were employed and specific mutants were examined in vitro and in vivo using the same batch of polymerase. Also, each reaction point represents two or more separate experiments.

Mutational analysis of the 15 3' terminal nucleotides of the vRNA As described in Materials and Methods, specific point mutations were introduced in the 15 3' terminal nucleotides of the model vRNA. The relative template

105 160 140~ i

i.-

,

i

lOO

o ILl

>

,

i

J ILl "

4oi

GAC GAU AUC GAC GAG GAC GAC GAU AUC GAC GAU GAU GAU GUC GAU

3' 1U 2C 3G 4U 5U 6U 7U 8C 9G ;0U 11C 12C 13C 14A 15C Fig. 3. Mutational analysis of the vRNA promoter in vitro. Template activity of wild-type RNA and of RNAs with ~mtations in the 15 3' terminal positions was measured by in vitro transcription using influenza virus polymerase. The sequence of the 15 3' terminal nuclemides of the wild-type RNA which corresponds to that of the influenza A virus NS gene is shown at the bottom. The template activities of the three substitution mutations in each position are indicated. The ability of each template promoter to direct the cRNA synthes~s using ApG as primer was compared with that of the wild- t2,.'pe promoter (see Materials and Methods). In each experiment the activity of IVACAT1/S RNA was normalized to 100%. Solid bars represent the average from r,vo or more independent experiments.

activities for these mutants are shown in Fig. 3. In this system mutations in the second position resulted in the lowest transcription levels (less than 15% of wild type activity). Similarly, changes in the I lth position reduced the relative activity to 50% or less. In positions 3, 5, and 10 mutations to certain nucleotides also reduced the relative template activity to 50% or less. Thus, these positions seem to tolerate mutations least well. In contrast, no mutations in positions 6, 8, 12, and 15 reduced template activity by more than 25%. Interestingly, there was no position which showed an increase in activity of more than 50% relative to that of the wild-type promoter. It was previously shown that the 3' terminal sequences of influenza virus RNAs were highly conserved up to and including position 12: it was therefore surprising that changes in the 12th position did not result in a change of template activity in our system. It was also unexpected that changes in positions 13 and 14. which are not conserved in different influenza virus RNAs, resultcd in a differential promoter activity.

Use of capped mRNA as primer The in vitro transcription system using shorter model RNAs has previously been shown to yield full-length c R N A copies rather than polyadenylated transcripts

10~

120

100

-

8 0 ~-

60 i

i 4 o ~-

20

0

WT

I m ,

C2G

C2A

C2U

Fig. 4. Priming activits of rabbit globin mRNA in vitro. I V A C A T 1 / S RNA and mutants in position 2 v,ere analyzed ~vith rabbit globin mRNA. The activity of cRNA synthesis is represented as relative to that of the reaction in which I V A C A T 1 / S RNA is used for template and rabbit globin m R N A as primer. Solid bars represent the average from two experiments.

(Parvin et al., 1989). Under the modified conditions used in the present analysis it was also not possible to detect polyA-containing products using ApG as primer. We therefore thought that a change in primer might lead to the synthesis of polyA-containing products and we examined several templates using capped globin mRNA as primer. Again, the products initiated by capped globin mRNA were not polyadenylated, unlike the transcripts obtained from detergent-treated, purified influenza virus (Bouloy et al., 1978). Interestingly, priming with capped globin mRNA of templates in which the 2nd position was changed to U, A or G also yielded lower activity than that found when wild-type template was used (Fig. 4). This finding is in agreement with experiments using ApG as primer which showed that a C in position 2 is crucial for the functioning of the promoter.

Effect of promoter mutations on CAT expression To determine if mutated promoters could be recognized and functional in vivo, we used the previously described RNP transfection system. In order to compare the different promoters, all the components and conditions of the assay were standarized. Initially, the amount of plasmid DNA used was varied between 0.5 and 2/.tg per dish to determine the linear range of the expression of transfected RNP complexes (data not shown). At a concentration of 1/xg DNA/dish the CAT activity reached a plateau and then slowly decreased; RNP transfections were therefore performed using 0.5/.Lg of template DNA. The expression of CAT protein after RNP transfection of RNAs containing mutant promoters is summarized in Fig. 5. All data were normalized using p l V A C A T 1 / S as template. The in vivo assay was more sensitive to mutations in

1117 250

200 ~ A v

II-o

1°°I

ILl

100 I-.. --I

u,i a-

5o o

3'

T ......

.......

i

, .....

I .....................

.

. . . . .

,,li

GAG GAU AUG Gt,C GAG GAG GAG GAU AUG GAG GAU GAU GAU GLIC GAU 1U

2C

3G 4U

5U

6U

7U

8C

9G

10U 11C 12C 13C 14A 15C

Fig. 5. CAT activity of cells RNP transfected with mutated templates. The sequence of the 15 3' terminal nucleotides of the wild-type RNA promoter is shown at the bottom. The three substitution mutations at each position are also indicated. The RNP transfections were performed as described in Materials and Methods. The CAT expression is normalized to that produced by transfection of pIVACAT1/S RNA. All CAT assays were run in the linear range (using appropriate dilutions) and solid bars indicate results from at least two independent experiments.

the promoter than the in vitro assay: mutations which had little or no effect in the in vitro assay abolished CAT expression in the in vivo system. For example, mutants with changes in positions 8 and 12 showed less than 5% template activity in vivo but the in vitro activity was comparable to that of the wild-type promoter. Mutations in positions 4, 6, and 14 showed a level of CAT activity greater than 5% of that of the wild-type promoter, but the relative values were lower than those of the in vitro assay. Only mutant U7G and mutants in position 15 have comparable values in the in vitro and in vivo assays. In fact, mutants C15U and C15A appear to be higher in the in vivo assay compared to the in vitro assay. Since most of the mutant RNAs which showed undetectable CAT activity in the in vivo assay were not sequenced in their entirety, additional control experiments were performed. For this purpose mutants U1G and G3A were reverted to wild-type by cassette mutagenesis using appropriate oligonucleotides. Following RNP transfection both revertants showed CAT expression levels similar to that obtained by I V A C A T 1 / S RNA containing the wild-type promoter (Fig. 6). This suggests that the differences seen between in vitro and in vivo results are solely a consequence of mutations in the promoter region and not in the coding sequence of the CAT protein.

I 0S

%

<1

0 "

71

<1

60

t

t

o 0

0

+

<1

52

t O0

U1G U1GR G3A G3AR

en • -~

em en qn'en men =-0 _= =

t

ii

%..II

II

~ m,

e..

-.;

_

I

I

9,

et, qn

ii

Ii

en

.

o ~nD

Q

5" c A C C C U G C U U U

w, o

eD

G C U

m,,

Q~

° t

Ill'~

'~

qmm

~

Ilk,

'm'mm

Q

~

U1G

U1GR G3A

3' ,~

G3A R

Fig. 6. C A T expression of two mutants repaired by cassette mutagenesis. A: CAT conversion levels of mutant and revertant RNAs following RNP transfection. Lanes 1 and ,, "~" infection with the helper A \ W S N \ 3 3 virus alone (negative control) and followed by RNP transfection with p l V A C A T 1 / S (positive control). Lane 3; RNP transfection with mutant R N A U I G . Lane 4: RNP transfection with revertant R N A U ] G R, in which the mutation in position I has been repaired. Lane 5, RNP transfection with mutant R N A G3A. Lane 6: RNP transfection with revertant R N A G3A R, in which the mutation in position 3 has been repaired. B: sequence analysis of mutant plasmids U I G and G3A and of revertant plasmids U1G R and G3A R. The wild-type promoter sequence is shown at the right. Point mutations are indicated by arrnws.

Promoter requires a specific 3' sequence Earlier in vitro results had suggested that the influenza virus promoter requires the presence of a preci~e 3' terminus (Parvin et al., 1989). The present RNP transfection system allowed us to extend these studies in an in vivo assay. p I V A C A T I / S was linearized with XbaI and SacI, which produced RNAs containing 13 and 30 additional nucleotides at the 3' terminus, respectively (Fig. 1).

1 i19

Table 1 Effect on template activity of adding and deleting nucleotides at the 3' terminus of the promoter sequence p l V A C A T I / S was digested with Hgal which generates the 3' terminus of the wild-type prom.z,ter (control). Templates I V A C A T I / S - X RNA. IVACATI/S-S RNA and I V A C A T I / S - P RNA were obtained by T7 RNA polymerase iranscription from p l V A C A T I / S following digesti-m with Xbal. Sac l and Pstl, respectively. I V A C A T I / S - X RNA and IVACATI/S-S RNA contain 13 and 30 additional nucleotides derived from the cloning vector p u c I g , respectively. IVACATI/S-P RNA lacks the first nucleotide U present in the wild-type sequence. In vitro transcription with viral polymerase proteins and CAT assays were done as described in Materials and Methods. The values are the average of two or more experiments Template RNA

3' sequence

Relative promoter activitiy (c;)

Relative CAT activity ( % )

IVACATI/S IVACAT1/S-X IVACAT1/S-S IVACATI/S-P

~CUGCUUUUGCU 3' CUGCUUUUGCU(N)13 3' ~CUGCUUUUGCU(N)3o 3' ~CUGCUUUUGC,.x 3'

100 <5 <5 24

100 < 1 < i 1.8

These templates showed a markedly reduced level of in vitro transcription and less than 1% CAT activity relative to the wild-type R N A in the in vivo amplification and expression assay (Table 1). Also, the deletion of the first U residue at the 3' end by PstI digestion decreased the promoter activity in both in vivo and in vitro assays. The last point is important since not eveff mutation in the first nucleotide was associated with a drastic reduction in in vitro template activity. These results taken together then strongly suggest that the optimal promoter activity' in vitro as well as in vivo requires the precise 3' terminal sequence (without addition or deletion of nucleotides), found in the wild-type promoter.

Discussion

In this paper we have studied the sequence of the influenza virus vRNA promoter by a detailed mutational analysis. A series of synthetic viral RNAs containing single point mutations in the 3' terminal sequence was constructed, and the activity of these promoter mutants was analyzed both in vitro and in vivo. Our resuits showed that mutations in the first 14 3' terminal nucleotides affected the in vitro promoter activity. It should be noted that we use an artificial cut-off of 75% of the wild-type promoter activity as the criterion of whether or not a mutation has an effect on promoter activity. However, as shown in Fig. 3, not every mutation in position 14 leads to a reduction of promoter activity below 75¢~of that of the wild-type promoter. Our criteria for defining the promoter also do not take into account the possible effects resulting from the introduction of double or multiple mutations into the promoter sequence. For example, in our earlier studies we used a construct that had mutations in positions 12, 13, 14, and 15 (Luo

110

et al., 10'-)1). This construct IVACAT18 RNA revealed promoter activity similar to that of the control IVACAT1 RNA containing the wild-type promoter sequence. In this earlier study we were thus misled in defining the vRNA promoter as containing only the first 11 nucleotides when in fact a systematic analysis suggests the involvement of additional nucleotides beyond position 11. Another limitation of our in vitro system concerns the efficiency of the assay. We estimate that only a small percentage of templates (0.05-0.1%) gets copied in a two-hour reaction and conclusions derived from the in vitro study may not fully apply to virus replicating in cells. It is difficult to directly compare the results obtained in the present study with those described by Yamanaka et al. (1991) and by Seong and Brownlee (1992), since the pol.vrnerase purification, the nature of the mutations in the synthetic template RNAs, and/or the assay readout differ in the three systems. Nevertheless, the results obtained by the three laboratories agree in implicating the first 12-14 nucleotides at the 3' end as being important for the vRNA promoter. However, it should be made clear that with none of the in vitro systems presently available, is it possible to direct the synthesis of polyA-containing mRNA. Therefore, we assume that in our conditions promoter activity in vitro mimics cRNA synthesis. However, the possibility that this system gives non-polyadenylated m R N A cannot be excluded. In any case, we do not have as yet an in vitro system to address the question of what factors determine the switch from cRNA to m R N A synthesis and vice versa. Also, it should be noted that the level of cRNA synthesis in our reconstitution system is markedly reduced in the absence of primers, and thus our system differs from the situation in vivo and a system which uses infected cell extracts (Shapiro et al., 1988). However, the latter in vitro replication system does not allow the analysis of mutated templates. Although t e m n l a t e s w i t h r n m l t a t i n n ~ in t h e f i r s t r~n~itinn r w ~ rarnrnntpr activities similar to that of I V A C A T I / S RNA, templates with mutations in the second position show a markedly reduced promoter activity in vitro. This result was seen whether ApG (that binds to the first and second nucleotides in the promoter sequence), or capped globin mRNA (which binds only to the first nucleotide), was used as primer, suggesting an important role for this position in the promoter. A deletion of the first nucleotide was also associated with a marked reduction in template activity. This finding - together with studies showing that extra nucleotides at the 3' end are also detrimental for promoter activity - reveals a strong requirement for a precise 3' end as well as for specific sequences in several positions. It should be noted that, in contrast to the vRNA promoter, changes in the second position of the cRNA promoter were not associated with a reduced in vitro template activity (Li and Palese, 1992). The in vivo system used involves measurement of CAT expression following RNP transfection into helper virus-infected cells but this system does not permit us to distinguish the steps involved in transcription, replication or translation of RNAs. A positive signal can be interpreted to mean that none of the steps is impaired. In contrast, the absence or the lowering of the CAT signal does not "...7 . . . . . .

~-- .

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

1"I . . . . . . . .

I"

~

I ~"

~ ' ' ' ~ L ' # L

111

allow us to draw a definitive conclusion. Almost all mutations introduced into the 14 3' terminal sequence of the I V A C A T 1 / S RNA resulted in a drastic reduction of the expression of CAT activity. Some of these mutations may reduce the CAT signal via an impairment of the cRNA promoter. Other mutations may interfere with a different step in RNA synthesis. For example, transcription of mRNA requires the presence of a functional polyadeny!ation signal. Since the polyadenylation signal requires a double-stranded panhandle structure of the RNA (Luo et al., 1991), some mutations in the templates would affect this signal without interfering with the promoter activity per se. Mutations at the very 3' end would appear not to disrupt the panhandle structure required for polyadenylation of mRNAs, and yet no CAT expression is detected using such constructs. This finding thus suggests that in this region (the very 3' end of the promoter) there are other cis-acting signals or structural domains in the RNA which when altered would interfere with the expression of CAT. Alternatively, the in vitro assay of the promoter sequences does not faithfully mimic conditions of cRNA synthesis. The in vitro and in vivo levels of activity are not altered for any of the mutants in position 15 as compared to the wild type, suggesting that the cRNA promoter does not extend beyond position 14. The present studies were designed to analyze the sequences required for the synthesis of plus-sense influenza virus RNAs, and the introduction of mutations in the 3' end of a synthetic RNA led to a better definition of the promoter sequence using an in vitro and an in vivo system.

Acknowledgements We sincerely thank Dr. Adolfo Garcia-Sastre for helpful discussions. This work was supported by Merit Award AI-18998 to P.P. from the National Institutes of Health. The work is also in partial fulfillment of the Ph.D. requirement of A.F.-S.

References Bouloy, M., Plotch, S.J. and Krug, R.M. (1978) Globin mRNAs are primers fi)r the transcription of influenza viral RNA in vitro. Proc. Natl. Acad. Sci. USA 75, 4886-4890. Desselberger, U., Racanielio, V.R., Zazra, J.J. and Palese, P. (1980)The 3' and 5' end terminal sequences of influenza A, B and C virus RNA segments are highly conserved and show partial inverted complementarity. Gene 8, 315-328. Enami, M. and Palese, P. (1991) High efficiency formation of influenza virus transfectants. J. Virol. 65. 2711-2713. Gorman, M., Moffat, L.F. and Howard. B.H. (1982) Recombinant genomes which express chloramphenicol acetyl-transferase in mammalian cells. Mol. Cell. Biol. 2, 1044-1051. Hatada, E., Takizawa, T and Fukuda, R. (1992) Specific binding of influenza A virus NSI protein to the virus minus-sense RNA in vitro. J. Gen. Virol. 73, 17-25. Honda, A., Ueda, K., Nagata, K. and lshihama, A. (1988) RNA polymerase of influenza virus: role of NP on RNA chain elongation. J. Biochem. 104, 1021-1026.

112 ttsu, M.--I'.. Parxin. J.D.. Gupta. S.. Kr3.stal, M. and Palest, P. 119871 Gen,+mic RNAs of influenza viruses arc held in a circular conformation in virions and infected cells by a terminal panhandle. Proc. Natl. Acad. Sci. USA 84, 81411-8144. Huang, T.-S., Palese, P. and K+'stal. M. (itlqtl) Determination of influenza virus proteins required for genome replication. J. Virol. 84, 5669-5673. lshihama, A. and Nagata. K. 119881 Viral RNA polymerases. CRC Crit. Rev., Biochem. 23, 27-76. Kimura, N., Nishida, M., Nagata, K., lshihama, A., Oda, K. and Nakada, S. (1u,921 Transcription of a recombinant influenza viral RNA in cells that can express the influenza virus RNA polymerase and nucleoprotein genes. J. Gen. Virol. 73, 1321-1328. Kobayashi, M., Tuchiya K,, Nagata, K. and Ishihama, A. 119921 Reconstitution of influenza virus RNA polymerase from three subunits expressed using recombinant baculovirus system. Virus Res. 22, 235-245. Krug. R.M., Alonso-Kaplen, F.V., Julkunen I. and Katze, M.G. 119891 Expression and replication of the influenza virus genome. In R.M. Krug (Ed.), The influenza viruses, Plenum Publishin~ Corp., New York, pp. 89-152. Li. X.Q, and Palese, P. (1~c12~ Mutational analysis of the promoter required for influenza virus virion RNA synthesis. J. Virol. 6~, 4331-4338. Luo, G.X., Luytjes, W., Enami, M. and Palese, P. 11991) The polyaden~clation signal of influenza virus RNA imolves a stretch of uridines followed by the RNA duplex of the panhandle structure. J. Virol. 65, 2861-2867. Luo, G.X. and Palese. P. 119921 Genetic analysis of influenza virus. Curr. Opinion Genet. Dev. 2, 77-81. Luo, G.X., Bergmann, M.. Garcia-Sastre, A. and Palese, P. 119921 Mechanism of attenuation of a chimeric influenza A / B transfectant virus. J. Virol., 66, 4679-4685. Luytjes, W., K~'stal. M., Parvi,1, J.D. ant; Palese, P. (1%9) Amplification, expression and packaging of a foreign gene by influenza virus. Cell 59, 1108-1113. Maniatis, T., Fritsch, E.F. and Sambrook. J. 119821 Molecular cloning: a laboratory manual. Cold Spring Harbor Laborato~'. Cold Spring Harbor, NY. Parvin, J.D.. Pal~se, P. Honda, A., Ishihama, A. and Krystal, M. (1989~ Promoter analysis ,ff the influenza virus RNA polymerase. J. Virol. 63, 5142-5152. Ritchey. M.B, Palese, P :and Kilbourne, E.D. 11976) The RNAs of influenza A, B and C ~,iruses. J. Virol. 18, 738-744. Robertson, J.S. ( 197915' and 3' terminal nucleotide sequences of the RNA segments of influenza virus. Nucleic. Acids Res. 6. 3745-3757. Seong. B.L. and Brownlee. G.G. (19921 A new method for reconstituting influenza polymerase and RNA in ~,itro: a study of the promoter elements for cRNA and vRNA synthesis in vitro and viral rescue in vivo. Virology 186. 247-260. Shapiro. G.I. and Krug, R.M. 119881 Influenza virus RNA replication in vitro: synthesis of viral template RNAs and virion RNAs in the absence of an added primer. J. Virol. 62, 2285-2290. Skehel, J.J. and Hay, A.J. 119781 Nucleotide sequences at the 5' termini of influenza virus RNAs and their transcripts. Nucleic Acids Res. 5, 121t7-1219. Sugiura, A.. Tobita. K. and Kilbourne. E.D. 119721 Isolation and preliminary characterization of temperature-sensitive mutants of influenza virus. J. Virol. 111.639-697. Yamanaka. K.. Ogasa~vara. N.. Yoshikawa. H., lshihama. A. and Nagata. K. 11991) In vivo analysis of the promoter structure of the influenza virus RNA genome using a transfection system with an engineered RNA. Proc. Natl. Acad. Sci. USA 88, 5369-5373,