- Email: [email protected]
Mutations in genes causing human familial isolated hyperparathyroidism do not account for hyperparathyroidism in Keeshond dogs
Available online at www.sciencedirect.com
The Veterinary Journal The Veterinary Journal 174 (2007) 652–654 www.elsevier.com/locate/tvjl
Short Communication
Mutations in genes causing human familial isolated hyperparathyroidism do not account for hyperparathyroidism in Keeshond dogs Barbara J. Skelly *, Robin J.M. Franklin Department of Veterinary Medicine, University of Cambridge, Madingley Road, Cambridge CB3 0ES, UK Accepted 20 October 2006
Abstract The roles of the calcium sensing receptor gene (CaSR) and the multiple endocrine neoplasia gene (MEN1) were investigated in Keeshond dogs with familial hyperparathyroidism. Mutations in these genes have been shown to cause familial isolated hyperparathyroidism (FIH) in humans. Affected dogs were identified through measurement of blood calcium and parathyroid hormone levels. Parathyroid tissue and whole blood was used to clone the cDNAs and individual exonic sequences of both candidate genes. No sequence abnormalities were identified when comparing normal and affected dogs, suggesting that a mapping strategy may be the most appropriate approach for identifying the genetic basis of this valuable comparative canine disease model. 2006 Elsevier Ltd. All rights reserved. Keywords: Canine hyperparathyroidism; Candidate genes; Animal model; Keeshond
Keeshonden have been recognised to have the highest incidence of primary hyperparathyroidism and make up approximately 33% of the total number of these cases in dogs (Refsal et al., 2001). Considering the small numbers of this breed, an inherited predisposition to the disease seems likely. Affected dogs show benign adenomatous or hypertrophic changes in the parathyroid gland. Although initially normocalcaemic, from around middle age the plasma calcium levels rise slowly until a severely hypercalcaemic state is reached (>4 mmol/L). When untreated, the condition can lead to irreversible renal pathology and chronic renal failure. In humans a broader spectrum of disorders is described, including familial isolated hyperparathyroidism, the only non-syndromic manifestation (FIH, OMIM:145000), familial hypocalciuric hypercalcaemia (FHH, OMIM: 145980), multiple endocrine neoplasia type 1 (MEN1,
*
Corresponding author. Tel.: +44 1223 337649; fax: +44 1223 337610. E-mail address: [email protected] (B.J. Skelly).
1090-0233/$ - see front matter 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.tvjl.2006.10.018
OMIM:131100) and type 2A (MEN2A, OMIM:171400) and hyperparathyroidism-jaw tumour syndrome (HPTJT, OMIM:145001). Separate genes have been associated with FHH (calcium sensing receptor gene, CaSR), MEN1 (MEN1, encoding a tumour suppressor), MEN2A (RET) and HPT-JT (HRPT2, encoding parafibromin, another tumour suppressor). Mutations in these genes do not account for all clinical cases suggesting that other loci may be involved. FIH has been associated with mutations in three genes, MEN1, CaSR and HRPT2 (Warner et al., 2004). A diagnosis of FIH is reached if the diagnostic criteria for any of the other phenotypes are not met when using standard, non-molecular genetic tests. In human FIH patients, the MEN1 and CaSR genes are assessed initially, since HRPT2 is a less common cause of disease (Simonds et al., 2004). MEN1 and CaSR represent strong candidate genes for familial hyperparathyroidism in the Keeshond. In this study, we have examined whether mutations in these genes were responsible for the phenotype shown in this breed of dog.
B.J. Skelly, R.J.M. Franklin / The Veterinary Journal 174 (2007) 652–654
The Keeshond population studied consisted of 180 dogs from a UK population of around 1000. The small population size meant that many dogs were related and where possible whole families were sampled. Total calcium concentrations were measured in all dogs. Ionised calcium was measured in some dogs when the sample quality was suitable. Concentrations of parathyroid hormone (PTH) were measured in hypercalcaemic dogs by radioimmunoassay (Cambridge Specialist Laboratories). Total RNA (from hypertrophied parathyroid tissue or normal kidney) was reverse transcribed to cDNA using an oligo dT primer in the presence of 25 units avian myeloblastosis virus (AMV) reverse transcriptase and 10 mmol dNTPs. Standard PCR amplification reactions contained 0.2 mmol each dNTP, 1 · PCR buffer, 2.5 U Taq polymerase and 50 pmol of each primer in a total volume of 50 lL. Cycling conditions were 95 C denaturation for 15 min, followed by 30 cycles of 30 s at 95 C, 30 s at a primer specific annealing temperature and 30 s at 72 C. PCR products for sequencing were column purified (MinElute, Qiagen). Samples were sequenced using an Applied Biosystems Inc. automated sequencer. The computer software Omega (Oxford Biosciences) was used to analyse sequence data. Of the 180 Keeshonden investigated, 37 were hypercalcaemic (plasma total calcium concentrations >2.80 mmol/ L). A minority of dogs (5–10) were blood sampled when showing clinical signs, whereas most, even severely hypercalcaemic, dogs were considered to be normal for their age by their owners. Most hypercalcaemic dogs were related to two family lines and were the direct or indirect offspring of two sires imported from the USA. PTH concentrations were measured in 25 dogs; 17 were above the normal range (10–60 pg/mL) and eight were high normal. Renal failure was excluded as a cause of hypercalcaemia with high PTH. Primers to amplify the coding regions of CaSR (cDNA) and each exon and its flanking regions of both genes were designed with reference to the published human cDNA sequences and the canine genomic sequence (Table 1). All exons and flanking regions of MEN1 were found to be identical in all dogs investigated, apart from an ‘a’ to ‘g’ transition in position 17 from the donor splice site of exon 6 (numbering based on comparison between human cDNA, GenBank submission NM_000244 and canine genomic DNA, NW_876266.1). This change was found in two affected Keeshonden (father and daughter) but was not found in another 10 affected dogs, including those that were closely related, or in any of the normal controls. A ‘c’ to ‘g’ transversion in CASR was found in mutant dog cDNA at position 2943 of the comparable human cDNA (GenBank submission NM_000388). The genomic canine sequence (GenBank NW_876299.1) publishes a ‘g’ in this position and therefore this was discounted as a disease inducing change. The exons and flanking regions were sequenced and two further polymorphisms were identified, a ‘g’ to ‘a’ transition at position 29 from the acceptor splice site of exon 5 and a ‘c’ to ‘t’ transition at position 32 from
653
Table 1 The primer sequences used for amplification of the cDNA and individual exons of CaSR and the individual exons of MEN1 Exon number
Forward
Reverse
CaSR genomic primers 2 3 4 5 6 7
gagagaaggcatcactatgg caagagtaacagagccatg agaacaggttctggctgtc agtttactgtccttgtgcag tgtacttggtgtcagagttg aagtggctgcatccgataac
cttgatctttggctgctactc aatgtaaagccagaggtagg tatctgagtcagatgctcag aagctcagcacaacttcctg aaggtaccttctcagcctag cctgtcagagaacatgacc
gagagaaggcatcactatgg ttggagtagcagccaaagatc gatgagttctgcaactgctc aggaagtctgtccacaatgg gtcaaggccaccaaccgag caagctaccgcaaccaggag gcaagagcaacagtgaagac
cttgatctttggctgctactc acatctggatctcttcctc gtaggtgcttcaggacctag ggagaagaggaggaggtag cgtggcacgtgatgaagatg gatgaccttctgcttgcatc ctggactggccacctgcttc
gcaagagagtgtagggaatg gagaactggtgaagaaggtc ttgcctcagccaagacctac atctatctggtaggctgagc tttgtgccatccacggcaac tcatttccaagtgaagaacc tcatctcttttgaagccag gaagatattggcttgtctcc
cggtccttgaagtaggaacg gaacattgcgattgcgacag gtccagtgccggcttcttag cataaagttcctctctcctc ggtggttggaaattagatag aatgtagctctctgcacatg gccaatatcttcaggatcac cctccatccgattgagtgc
CaSR exonic primers
MEN1 genomic primers 2 3 4 5 and 6 7 8 9 10
For both genes, the first exon is non-coding. For MEN1, exons 5 and 6 were amplified together.
the donor splice site of exon 7 (numbers based on the identification of exons by comparison between human cDNA, canine cDNA and canine genomic sequence, GenBank submission NW_876299.1). Both of these changes were identified in both normal and affected dogs. We ruled out simple, small-scale mutations in the coding regions of two of the genes most commonly seen to cause hyperparathyroidism. In some human cases, linkage to the MEN1 and CaSR loci has been established without subsequent mutation identification through direct sequencing (Chandrasekharappa et al., 1997; Carpten et al., 2002). This illustrates the insensitivity of direct sequencing and its inability to identify large deletions or mutations in noncoding or regulatory DNA. Other gene loci are implicated in FIH (Yoshimoto et al., 1998; Tahara et al., 1996; Correa et al., 2002). This study did not address the role of HRPT2, which is occasionally mutated in families with FIH (Carpten et al., 2002). However, as the further investigation of this disease through a candidate gene approach is likely to prove equally unrewarding, the dogs involved in this study will now be used in an investigation of hyperparathyroidism through a mapping strategy. Acknowledgement This study was supported by the UK Kennel Club Charitable Trust and the North of England Keeshond Club. The authors would like to acknowledge the support of Jane Saunders and Anji Marfleet in the completion of this study.
654
B.J. Skelly, R.J.M. Franklin / The Veterinary Journal 174 (2007) 652–654
References Carpten, J.D., Robbins, C.M., Villablanca, A., Forsberg, L., Prescuittini, S., Bailey-Wilson, J., Simonds, W.F., Gillanders, E.M., Kennedy, A.M., Chen, J.D., Agarwal, S.K., Sood, R., Jones, M.P., Moses, T.Y., Haven, C., Petillo, D., Leotlela, P.D., Harding, B., Cameron, D., Pannett, A.A., Hoog, A., Heath 3rd, H., James-Newton, L.A., Robinson, B., Zarbo, R.J., Cavaco, B.M., Wassif, W., Perrier, N.D., Rosen, I.B., Kristoffersson, U., Turnpenny, P.D., Farnebo, L.O., Besser, G.M., Jackson, C.E., Morreau, H., Trent, J.M., Thakker, R.V., Marx, S.J., The, B.T., Larsson, C., Hobbs, M.R., 2002. HRPT2, encoding parafibromin, is mutated in hyperparathyroidism-jaw tumour syndrome. Nature Genetics 32, 676–680. Chandrasekharappa, S.C., Guru, S.C., Manickam, P., Olufemi, S.E., Collins, F.S., Emmert-Buck, M.R., Debelenko, L.V., Zhuang, Z.P., Lubensky, I.A., Liotta, L.A., Crabtree, J.S., Wang, Y.P., Roe, B.A., Weisemann, J., Boguski, M.S., Agarwal, S.K., Kester, M.B., Kim, Y.S., Heppner, C., Dong, Q.H., Spiegel, A.M., Burns, A.L., Marx, S.J., 1997. Positional cloning of the gene for multiple endocrine neoplasia-type 1. Science 276, 404–407. Correa, P., Juhlin, C., Rastad, J., Akerstrom, G., Westin, G., Carling, T., 2002. Allelic loss in clinically and screening-detected primary hyperparathyroidism. Clinical Endocrinology 56, 113–117.
Refsal, K.R., Provencher-Bolloger, A.L., Graham, P.A., Nachreiner, R.F., 2001. Update on the diagnosis and treatment of disorders of calcium regulation. Veterinary Clinics of North America Small Animal Practice 31, 1043–1062. Simonds, W.F., Robbins, C.M., Agarwal, S.K., Hendy, G.N., Carpten, J.D., Marx, S.J., 2004. Familial isolated hyperparathyroidism is rarely caused by germline mutation in HRPT2, the gene for the hyperparathyroidism-jaw tumour syndrome. Journal of Clinical Endocrinology and Metabolism 89, 96–102. Tahara, H., Smith, A., Gaz, R.D., Cryns, V.L., Arnold, A., 1996. Genomic localisation of novel candidate tumour suppressor gene loci in human parathyroid adenomas. Cancer Research 56, 599–605. Warner, J., Epstein, M., Sweet, A., Singh, D., Burgess, J., Stranks, S., Hill, P., Perry-Keene, D., Learoyd, D., Robinson, B., Birdsey, P., Mackenzie, E., The, B.T., Prins, J.B., Cardinal, J., 2004. Genetic testing in familial isolated hyperparathyroidism: unexpected results and their implications. Journal of Medical Genetics 41, 155–160. Yoshimoto, K., Endo, H., Tsuyuguchi, M., Tanaka, C., Kimura, T., Iwahana, H., Kato, G., Sano, T., Itakura, M., 1998. Familial isolated primary hyperparathyroidism with parathyroid carcinomas: clinical and molecular features. Clinical Endocrinology 48, 67–72.
The Veterinary Journal The Veterinary Journal 174 (2007) 652–654 www.elsevier.com/locate/tvjl
Short Communication
Mutations in genes causing human familial isolated hyperparathyroidism do not account for hyperparathyroidism in Keeshond dogs Barbara J. Skelly *, Robin J.M. Franklin Department of Veterinary Medicine, University of Cambridge, Madingley Road, Cambridge CB3 0ES, UK Accepted 20 October 2006
Abstract The roles of the calcium sensing receptor gene (CaSR) and the multiple endocrine neoplasia gene (MEN1) were investigated in Keeshond dogs with familial hyperparathyroidism. Mutations in these genes have been shown to cause familial isolated hyperparathyroidism (FIH) in humans. Affected dogs were identified through measurement of blood calcium and parathyroid hormone levels. Parathyroid tissue and whole blood was used to clone the cDNAs and individual exonic sequences of both candidate genes. No sequence abnormalities were identified when comparing normal and affected dogs, suggesting that a mapping strategy may be the most appropriate approach for identifying the genetic basis of this valuable comparative canine disease model. 2006 Elsevier Ltd. All rights reserved. Keywords: Canine hyperparathyroidism; Candidate genes; Animal model; Keeshond
Keeshonden have been recognised to have the highest incidence of primary hyperparathyroidism and make up approximately 33% of the total number of these cases in dogs (Refsal et al., 2001). Considering the small numbers of this breed, an inherited predisposition to the disease seems likely. Affected dogs show benign adenomatous or hypertrophic changes in the parathyroid gland. Although initially normocalcaemic, from around middle age the plasma calcium levels rise slowly until a severely hypercalcaemic state is reached (>4 mmol/L). When untreated, the condition can lead to irreversible renal pathology and chronic renal failure. In humans a broader spectrum of disorders is described, including familial isolated hyperparathyroidism, the only non-syndromic manifestation (FIH, OMIM:145000), familial hypocalciuric hypercalcaemia (FHH, OMIM: 145980), multiple endocrine neoplasia type 1 (MEN1,
*
Corresponding author. Tel.: +44 1223 337649; fax: +44 1223 337610. E-mail address: [email protected] (B.J. Skelly).
1090-0233/$ - see front matter 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.tvjl.2006.10.018
OMIM:131100) and type 2A (MEN2A, OMIM:171400) and hyperparathyroidism-jaw tumour syndrome (HPTJT, OMIM:145001). Separate genes have been associated with FHH (calcium sensing receptor gene, CaSR), MEN1 (MEN1, encoding a tumour suppressor), MEN2A (RET) and HPT-JT (HRPT2, encoding parafibromin, another tumour suppressor). Mutations in these genes do not account for all clinical cases suggesting that other loci may be involved. FIH has been associated with mutations in three genes, MEN1, CaSR and HRPT2 (Warner et al., 2004). A diagnosis of FIH is reached if the diagnostic criteria for any of the other phenotypes are not met when using standard, non-molecular genetic tests. In human FIH patients, the MEN1 and CaSR genes are assessed initially, since HRPT2 is a less common cause of disease (Simonds et al., 2004). MEN1 and CaSR represent strong candidate genes for familial hyperparathyroidism in the Keeshond. In this study, we have examined whether mutations in these genes were responsible for the phenotype shown in this breed of dog.
B.J. Skelly, R.J.M. Franklin / The Veterinary Journal 174 (2007) 652–654
The Keeshond population studied consisted of 180 dogs from a UK population of around 1000. The small population size meant that many dogs were related and where possible whole families were sampled. Total calcium concentrations were measured in all dogs. Ionised calcium was measured in some dogs when the sample quality was suitable. Concentrations of parathyroid hormone (PTH) were measured in hypercalcaemic dogs by radioimmunoassay (Cambridge Specialist Laboratories). Total RNA (from hypertrophied parathyroid tissue or normal kidney) was reverse transcribed to cDNA using an oligo dT primer in the presence of 25 units avian myeloblastosis virus (AMV) reverse transcriptase and 10 mmol dNTPs. Standard PCR amplification reactions contained 0.2 mmol each dNTP, 1 · PCR buffer, 2.5 U Taq polymerase and 50 pmol of each primer in a total volume of 50 lL. Cycling conditions were 95 C denaturation for 15 min, followed by 30 cycles of 30 s at 95 C, 30 s at a primer specific annealing temperature and 30 s at 72 C. PCR products for sequencing were column purified (MinElute, Qiagen). Samples were sequenced using an Applied Biosystems Inc. automated sequencer. The computer software Omega (Oxford Biosciences) was used to analyse sequence data. Of the 180 Keeshonden investigated, 37 were hypercalcaemic (plasma total calcium concentrations >2.80 mmol/ L). A minority of dogs (5–10) were blood sampled when showing clinical signs, whereas most, even severely hypercalcaemic, dogs were considered to be normal for their age by their owners. Most hypercalcaemic dogs were related to two family lines and were the direct or indirect offspring of two sires imported from the USA. PTH concentrations were measured in 25 dogs; 17 were above the normal range (10–60 pg/mL) and eight were high normal. Renal failure was excluded as a cause of hypercalcaemia with high PTH. Primers to amplify the coding regions of CaSR (cDNA) and each exon and its flanking regions of both genes were designed with reference to the published human cDNA sequences and the canine genomic sequence (Table 1). All exons and flanking regions of MEN1 were found to be identical in all dogs investigated, apart from an ‘a’ to ‘g’ transition in position 17 from the donor splice site of exon 6 (numbering based on comparison between human cDNA, GenBank submission NM_000244 and canine genomic DNA, NW_876266.1). This change was found in two affected Keeshonden (father and daughter) but was not found in another 10 affected dogs, including those that were closely related, or in any of the normal controls. A ‘c’ to ‘g’ transversion in CASR was found in mutant dog cDNA at position 2943 of the comparable human cDNA (GenBank submission NM_000388). The genomic canine sequence (GenBank NW_876299.1) publishes a ‘g’ in this position and therefore this was discounted as a disease inducing change. The exons and flanking regions were sequenced and two further polymorphisms were identified, a ‘g’ to ‘a’ transition at position 29 from the acceptor splice site of exon 5 and a ‘c’ to ‘t’ transition at position 32 from
653
Table 1 The primer sequences used for amplification of the cDNA and individual exons of CaSR and the individual exons of MEN1 Exon number
Forward
Reverse
CaSR genomic primers 2 3 4 5 6 7
gagagaaggcatcactatgg caagagtaacagagccatg agaacaggttctggctgtc agtttactgtccttgtgcag tgtacttggtgtcagagttg aagtggctgcatccgataac
cttgatctttggctgctactc aatgtaaagccagaggtagg tatctgagtcagatgctcag aagctcagcacaacttcctg aaggtaccttctcagcctag cctgtcagagaacatgacc
gagagaaggcatcactatgg ttggagtagcagccaaagatc gatgagttctgcaactgctc aggaagtctgtccacaatgg gtcaaggccaccaaccgag caagctaccgcaaccaggag gcaagagcaacagtgaagac
cttgatctttggctgctactc acatctggatctcttcctc gtaggtgcttcaggacctag ggagaagaggaggaggtag cgtggcacgtgatgaagatg gatgaccttctgcttgcatc ctggactggccacctgcttc
gcaagagagtgtagggaatg gagaactggtgaagaaggtc ttgcctcagccaagacctac atctatctggtaggctgagc tttgtgccatccacggcaac tcatttccaagtgaagaacc tcatctcttttgaagccag gaagatattggcttgtctcc
cggtccttgaagtaggaacg gaacattgcgattgcgacag gtccagtgccggcttcttag cataaagttcctctctcctc ggtggttggaaattagatag aatgtagctctctgcacatg gccaatatcttcaggatcac cctccatccgattgagtgc
CaSR exonic primers
MEN1 genomic primers 2 3 4 5 and 6 7 8 9 10
For both genes, the first exon is non-coding. For MEN1, exons 5 and 6 were amplified together.
the donor splice site of exon 7 (numbers based on the identification of exons by comparison between human cDNA, canine cDNA and canine genomic sequence, GenBank submission NW_876299.1). Both of these changes were identified in both normal and affected dogs. We ruled out simple, small-scale mutations in the coding regions of two of the genes most commonly seen to cause hyperparathyroidism. In some human cases, linkage to the MEN1 and CaSR loci has been established without subsequent mutation identification through direct sequencing (Chandrasekharappa et al., 1997; Carpten et al., 2002). This illustrates the insensitivity of direct sequencing and its inability to identify large deletions or mutations in noncoding or regulatory DNA. Other gene loci are implicated in FIH (Yoshimoto et al., 1998; Tahara et al., 1996; Correa et al., 2002). This study did not address the role of HRPT2, which is occasionally mutated in families with FIH (Carpten et al., 2002). However, as the further investigation of this disease through a candidate gene approach is likely to prove equally unrewarding, the dogs involved in this study will now be used in an investigation of hyperparathyroidism through a mapping strategy. Acknowledgement This study was supported by the UK Kennel Club Charitable Trust and the North of England Keeshond Club. The authors would like to acknowledge the support of Jane Saunders and Anji Marfleet in the completion of this study.
654
B.J. Skelly, R.J.M. Franklin / The Veterinary Journal 174 (2007) 652–654
References Carpten, J.D., Robbins, C.M., Villablanca, A., Forsberg, L., Prescuittini, S., Bailey-Wilson, J., Simonds, W.F., Gillanders, E.M., Kennedy, A.M., Chen, J.D., Agarwal, S.K., Sood, R., Jones, M.P., Moses, T.Y., Haven, C., Petillo, D., Leotlela, P.D., Harding, B., Cameron, D., Pannett, A.A., Hoog, A., Heath 3rd, H., James-Newton, L.A., Robinson, B., Zarbo, R.J., Cavaco, B.M., Wassif, W., Perrier, N.D., Rosen, I.B., Kristoffersson, U., Turnpenny, P.D., Farnebo, L.O., Besser, G.M., Jackson, C.E., Morreau, H., Trent, J.M., Thakker, R.V., Marx, S.J., The, B.T., Larsson, C., Hobbs, M.R., 2002. HRPT2, encoding parafibromin, is mutated in hyperparathyroidism-jaw tumour syndrome. Nature Genetics 32, 676–680. Chandrasekharappa, S.C., Guru, S.C., Manickam, P., Olufemi, S.E., Collins, F.S., Emmert-Buck, M.R., Debelenko, L.V., Zhuang, Z.P., Lubensky, I.A., Liotta, L.A., Crabtree, J.S., Wang, Y.P., Roe, B.A., Weisemann, J., Boguski, M.S., Agarwal, S.K., Kester, M.B., Kim, Y.S., Heppner, C., Dong, Q.H., Spiegel, A.M., Burns, A.L., Marx, S.J., 1997. Positional cloning of the gene for multiple endocrine neoplasia-type 1. Science 276, 404–407. Correa, P., Juhlin, C., Rastad, J., Akerstrom, G., Westin, G., Carling, T., 2002. Allelic loss in clinically and screening-detected primary hyperparathyroidism. Clinical Endocrinology 56, 113–117.
Refsal, K.R., Provencher-Bolloger, A.L., Graham, P.A., Nachreiner, R.F., 2001. Update on the diagnosis and treatment of disorders of calcium regulation. Veterinary Clinics of North America Small Animal Practice 31, 1043–1062. Simonds, W.F., Robbins, C.M., Agarwal, S.K., Hendy, G.N., Carpten, J.D., Marx, S.J., 2004. Familial isolated hyperparathyroidism is rarely caused by germline mutation in HRPT2, the gene for the hyperparathyroidism-jaw tumour syndrome. Journal of Clinical Endocrinology and Metabolism 89, 96–102. Tahara, H., Smith, A., Gaz, R.D., Cryns, V.L., Arnold, A., 1996. Genomic localisation of novel candidate tumour suppressor gene loci in human parathyroid adenomas. Cancer Research 56, 599–605. Warner, J., Epstein, M., Sweet, A., Singh, D., Burgess, J., Stranks, S., Hill, P., Perry-Keene, D., Learoyd, D., Robinson, B., Birdsey, P., Mackenzie, E., The, B.T., Prins, J.B., Cardinal, J., 2004. Genetic testing in familial isolated hyperparathyroidism: unexpected results and their implications. Journal of Medical Genetics 41, 155–160. Yoshimoto, K., Endo, H., Tsuyuguchi, M., Tanaka, C., Kimura, T., Iwahana, H., Kato, G., Sano, T., Itakura, M., 1998. Familial isolated primary hyperparathyroidism with parathyroid carcinomas: clinical and molecular features. Clinical Endocrinology 48, 67–72.