- Email: [email protected]
Mutations in the human BOULE gene are not a major cause of impaired spermatogenesis
Mutations in the human BOULE gene are not a major cause of impaired spermatogenesis Mutation screening of the BOULE gene in 156 men with azoospermia or severe oligozoospermia revealed no relevant mutations; thus, mutations in BOULE can be eliminated as a major cause of impaired spermatogenesis. (Fertil Steril威 2005;83:513–5. ©2005 by American Society for Reproductive Medicine.)
It is generally assumed that genetic factors play an important role in the pathophysiology of impaired spermatogenesis. However, while the BOULE gene is required for normal germ cell development in several species; mutations in the human BOULE gene do not seem to be a cause of impaired spermatogenesis in men with severe oligozoospermia or azoospermia. Subfertility, defined as the inability to conceive after one year of unprotected intercourse, affects 10-15% of couples. In ⬃50% this is due to impaired spermatogenesis. Although frequently suggested, evidence of a genetic aetiology of impaired spermatogenesis is scarce (1). To date, the generally accepted causes are numerical and structural chromosomal abnormalities and Y-chromosome deletions. However, these genetic abnormalities explain only ⬃15% of the cases of impaired spermatogenesis. Thus, in the majority of cases, subfertility due to spermatogenic failure remains idiopathic in nature (1, 2).
Studies in Drosophila have shown that boule is essential for spermatogenesis, because loss of function of this gene results in azoospermia due to meiotic arrest (11). Furthermore, it has been shown that the human BOULE gene, located on chromosome 2, can rescue meiotic defects in infertile flies, illustrating the conserved function of this gene throughout species (12). BOULE is exclusively expressed in secondary spermatocytes and round spermatids (13). In contrast to DAZ and DAZL, the role of BOULE in human impaired spermatogenesis has never been thoroughly investigated. The aim of the present study was therefore to determine whether mutations in this gene can explain the severe oligozoospermia or azoospermia phenotypes in humans. We included male partners of subfertile couples who were referred to the Center for Reproductive Medicine of the Academic Medical Center, Amsterdam, consecutively from January 1998 until March 2003 for this study. Written informed consent was obtained from all participants. This study was approved by the Institutional Review Board of the Academic Medical Center.
Several studies have highlighted the importance of the DAZ-gene family, consisting of the DAZ (deleted in azoospermia), DAZL (deleted in azoospermia-like) and BOULE (also known as BOLL) genes, for normal spermatogenesis. The four DAZ genes are located in two clusters in the AZFc region on the Y chromosome (3, 4). Deletions of (part of) AZFc result in oligozoospermia or azoospermia and represent the most frequently found genetic cause of impaired spermatogenesis (3, 5, 6). Similarly, disruption of the dazl gene in Xenopus and mouse leads to loss of germ cells and complete absence of gamete production, suggesting that DAZL is essential for the differentiation of germ cells (7, 8). The role of human DAZL, located on chromosome 3, in spermatogenesis however, remains unclear; one study showed an association with impaired spermatogenesis while in another study no relevant mutations in subfertile men were found (9, 10).
One-hundred fifty-six men with idiopathic azoospermia (n ⫽ 40) or severe oligozoospermia (n ⫽ 116), defined as a total sperm count (TC) of less than 20 x 106 in two consecutive semen samples were included as patients. Two-hundred fourteen men with normospermia, defined as a total sperm count of more than 40 x 106 with a progressive motility and normal morphology of at least 40% in two consecutive semen samples were included as controls. Semen analyses were performed according to WHO guidelines (14). Patients with a history of orchitis, surgery of the vasa deferentia, bilateral orchidectomy, chemo- or radiotherapy, obstructive azoospermia, bilateral cryptorchidism, numerical or structural chromosomal abnormalities and Y-chromosome deletions were excluded.
Received May 3, 2004; revised and accepted July 14, 2004. Reprint requests: Henrike Westerveld, M.D., Center for Reproductive Medicine, Department of Obstetrics and Gynaecology, Academic Medical Center, Meibergdreef 9, H4-205, 1105 AZ Amsterdam, The Netherlands, FAX:⫹31-20-6963489; E-mail: g.h.westerveld@amc. uva.nl).
We performed mutation screening in our patient group using an automated Denaturing High-Performance Liquid Chromatography (WAVE®) according to conditions recommended by the manufacturer (Transgenomic). With the aid of Primer3, we designed 10 pairs of primers for amplification of all coding exons and intron/exon boundaries of
0015-0282/05/$30.00 doi:10.1016/j.fertnstert.2004.10.013
Fertility and Sterility姞 Vol. 83, No. 2, February 2005 Copyright ©2005 American Society for Reproductive Medicine, Published by Elsevier Inc.
513
TABLE 1 Primers. Exon
Primer sequence
2
Fa: ATTATACCCAGTGCAAAAAGTGTAAAAG Rb: GCAAATATGTTATTTTATAGTTGCACAAAG Fa: GCATGAGAATTATTCATCTTTTATCAAC Rb: AAACCTAGTCATCCAATGAAAATAGAGT Fa: GTGAATGATTCTTCTAAGATTCCCA Rb: CCCGAAAAGATTAGTTTCAAATACA Fa: AAATTCTTTCTAACTAGTTTTTCCTTATTG Rb: AAATAACTTTATTAGATGAAAGAAACATGA Fa: AATATCTGTGACATTCAATTTTTACCATAG Rb: TAATTTGGTTGATGTGTGTTATTATTTGTA Fa: TATTTTAAAGGCTTCTGCCTAATTT Rb: TGAAAGTTAGCTAAGAAAGGACTAA Fa: ATAATCAGAATGGGTTTTTATTTTC Rb: AAACTTTAGTATTCATGCAGTCATC Fa: TTTGGTTTAACAGAAATAACTAATCA Rb: GAAGAGATTTGAATAAATCAACAAA Fa: AATATTTAGAATTAATAGATGAAAGGTGACA Rb: ATATGATGGAAGAAAAACAAAGTAAAAAGT Fa: ATTCAGTCTTCCTGATCTATATTTTCTCTT Rb: AGGTATTAACTAACACTAAGTTTCACAACG
3 4 5 6 7 8 9 10 11 a b
Product size 284 bp 221 bp 281 bp 280 bp 385 bp 182 bp 169 bp 325 bp 202 bp 190 bp
Forward primer. Reverse primer.
Westerveld. Human BOULE gene mutations and spermatogenesis. Fertil Steril 2005.
BOULE (Table 1), using the available genomic sequence information on the web (NM_033030). PCR was carried out in a total volume of 25 l and contained 25 ng DNA, 1x buffer (Roche, cat n° 1699105), 0.2 mM dNTPs, 8 pmol forward and reverse primer, 2 mM MgCl2 and 0.5 U Taq polymerase. We used a Touchdown PCR program with a temperature range of 62–50°C with a 2°C decrement per cycle and 1 cycle increment per temperature step and a final amplification for 20 cycles at 94°C for 30 s, 50°C for 30 s and 72°C for 30 s with a final extension at 72°C for 5 min. Whenever a variant was found, we sequenced this fragment with the same primers as used for PCR amplification on an automated ABI Prism 3100 Genetic Analyser (Applied Biosystems). For each variant detected, we subsequently designed a restriction fragment length polymorphism assay to evaluate the frequency of these variants in our controls. We applied the ESEfinder (Exonic Splicing Enhancer) program (http://exon.cshl.org/ESE) to determine the effect of apparently silent, exonic variants on splicing activity. Similarly, to evaluate the effect of intronic variants on the branch site sequence, thereby affecting splicing activity, we used the NetGene2 program (www.cbs.dtu.dk/services/ NetGene2). 514
Westerveld et al.
Correspondence
We identified only two variants through screening of all coding and splice site sequences of the BOULE gene of 156 patients. One variant was found in exon 2 and one in intron 4. The C 3 A nucleotide change in exon 2 at the cDNA sequence position 336 led to a serine in tyrosine substitution (S9Y). This missense mutation, found in two patients and one control, is not located in an RNA binding motif nor does it affect splice sites, according to ESEfinder analyses. The intronic variant changed a T into a C at position minus 19 in intron 4 and occurred in one patient only. This variant does not change any of the conserved nucleotides of the branch site of intron 4, according to NetGene2 analyses. Our data thus show a low variability in the BOULE gene of subfertile men, thereby confirming previous findings of the high degree of conservation of the gene both within and between species (12). However, although previous animal studies have shown that BOULE is an important gene for normal spermatogenesis, we could not find any relevant mutations in our patient group. One of the two variants found was a missense mutation (S9Y). This mutation is most likely a rare polymorphism and cannot be responsible for the impaired spermatogenesis phenotype for the following reasons. First, the S9Y mutation occurred in both patients and controls. Second, Vol. 83, No. 2, February 2005
the mutation is not located in a known functional domain and does not alter splicing. Finally, the serine into tyrosine substitution does not change the polarity of the amino acid. The second variant, a C 3 A transition in intron 4, was found in one patient only. Since this variant is located in an intron and does not affect the predicted consensus sequence at the branch site of the intron, it also does not seem to have any functional consequences. To date, few researchers have been able to find infertility causing genetic aberrations in humans, despite the overwhelming number of well described candidate genes in animal studies. Nevertheless, at present, mutation screening of candidate genes in men with spermatogenic failure represents the only option to investigate the genetic basis of impaired spermatogenesis in humans. In doing so we have eliminated mutations in BOULE as a major cause of impaired spermatogenesis. G. Henrike Westerveld, M.D.a Sjoerd Repping, Ph.D.a Nico J. Leschot M.D., Ph.D.b Fulco van der Veen M.D., Ph.D.a M. Paola Lombardi Ph.D.a,b a Center for Reproductive Medicine, Department of Obstetrics and Gynaecology, and b Department of Clinical Genetics, Academic Medical Center, Amsterdam, The Netherlands REFERENCES 1. Matzuk MM, Lamb DJ. Genetic dissection of mammalian fertility pathways. Nat Cell Biol 2002;4(Suppl):s41–s49. 2. Hirsh A. Male subfertility. BMJ 2003;327:669 –72.
Fertility and Sterility姞
3. Kuroda-Kawaguchi T, Skaletsky H, Brown LG, Minx PJ, Cordum HS, Waterston RH et al. The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet 2001;29:279 – 86. 4. Saxena R, de Vries JW, Repping S, Alagappan RK, Skaletsky H, Brown LG et al. Four DAZ genes in two clusters found in the AZFc region of the human Y chromosome. Genomics 2000;67:256 – 67. 5. Repping S, Skaletsky H, Brown L, Van Daalen SK, Korver CM, Pyntikova T et al. Polymorphism for a 1.6-Mb deletion of the human Y chromosome persists through balance between recurrent mutation and haploid selection. Nat Genet 2003;35:247–51. 6. Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F et al. Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet 1996;5:933– 43. 7. Houston DW, King ML. A critical role for Xdazl, a germ plasmlocalized RNA, in the differentiation of primordial germ cells in Xenopus. Development 2000;127:447–56. 8. Ruggiu M, Speed R, Taggart M, McKay SJ, Kilanowski F, Saunders P et al. The mouse Dazla gene encodes a cytoplasmic protein essential for gametogenesis. Nature 1997;389:73–7. 9. Teng YN, Lin YM, Lin YH, Tsao SY, Hsu CC, Lin SJ et al. Association of a single-nucleotide polymorphism of the deleted-inazoospermia-like gene with susceptibility to spermatogenic failure. J Clin Endocrinol Metab 2002;87:5258 – 64. 10. Van Golde RJ, Tuerlings JH, Kremer JA, Braat DD, Schoute F, Hoefsloot LH. DAZLA: an important candidate gene in male subfertility? J Assist Reprod Genet 2001;18:395–9. 11. Eberhart CG, Maines JZ, Wasserman SA. Meiotic cell cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature 1996;381:783–5. 12. Xu EY, Lee DF, Klebes A, Turek PJ, Kornberg TB, Reijo Pera RA. Human BOULE gene rescues meiotic defects in infertile flies. Hum Mol Genet 2003;12:169 –75. 13. Xu EY, Moore FL, Pera RA. A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans. Proc Natl Acad Sci U S A 2001;98:7414 –9. 14. World Health Organization. WHO laboratory manual for the examination of human semen and sperm-cervical mucus interaction. 3rd ed. Cambridge, UK: Cambridge University Press; 1992.
515
It is generally assumed that genetic factors play an important role in the pathophysiology of impaired spermatogenesis. However, while the BOULE gene is required for normal germ cell development in several species; mutations in the human BOULE gene do not seem to be a cause of impaired spermatogenesis in men with severe oligozoospermia or azoospermia. Subfertility, defined as the inability to conceive after one year of unprotected intercourse, affects 10-15% of couples. In ⬃50% this is due to impaired spermatogenesis. Although frequently suggested, evidence of a genetic aetiology of impaired spermatogenesis is scarce (1). To date, the generally accepted causes are numerical and structural chromosomal abnormalities and Y-chromosome deletions. However, these genetic abnormalities explain only ⬃15% of the cases of impaired spermatogenesis. Thus, in the majority of cases, subfertility due to spermatogenic failure remains idiopathic in nature (1, 2).
Studies in Drosophila have shown that boule is essential for spermatogenesis, because loss of function of this gene results in azoospermia due to meiotic arrest (11). Furthermore, it has been shown that the human BOULE gene, located on chromosome 2, can rescue meiotic defects in infertile flies, illustrating the conserved function of this gene throughout species (12). BOULE is exclusively expressed in secondary spermatocytes and round spermatids (13). In contrast to DAZ and DAZL, the role of BOULE in human impaired spermatogenesis has never been thoroughly investigated. The aim of the present study was therefore to determine whether mutations in this gene can explain the severe oligozoospermia or azoospermia phenotypes in humans. We included male partners of subfertile couples who were referred to the Center for Reproductive Medicine of the Academic Medical Center, Amsterdam, consecutively from January 1998 until March 2003 for this study. Written informed consent was obtained from all participants. This study was approved by the Institutional Review Board of the Academic Medical Center.
Several studies have highlighted the importance of the DAZ-gene family, consisting of the DAZ (deleted in azoospermia), DAZL (deleted in azoospermia-like) and BOULE (also known as BOLL) genes, for normal spermatogenesis. The four DAZ genes are located in two clusters in the AZFc region on the Y chromosome (3, 4). Deletions of (part of) AZFc result in oligozoospermia or azoospermia and represent the most frequently found genetic cause of impaired spermatogenesis (3, 5, 6). Similarly, disruption of the dazl gene in Xenopus and mouse leads to loss of germ cells and complete absence of gamete production, suggesting that DAZL is essential for the differentiation of germ cells (7, 8). The role of human DAZL, located on chromosome 3, in spermatogenesis however, remains unclear; one study showed an association with impaired spermatogenesis while in another study no relevant mutations in subfertile men were found (9, 10).
One-hundred fifty-six men with idiopathic azoospermia (n ⫽ 40) or severe oligozoospermia (n ⫽ 116), defined as a total sperm count (TC) of less than 20 x 106 in two consecutive semen samples were included as patients. Two-hundred fourteen men with normospermia, defined as a total sperm count of more than 40 x 106 with a progressive motility and normal morphology of at least 40% in two consecutive semen samples were included as controls. Semen analyses were performed according to WHO guidelines (14). Patients with a history of orchitis, surgery of the vasa deferentia, bilateral orchidectomy, chemo- or radiotherapy, obstructive azoospermia, bilateral cryptorchidism, numerical or structural chromosomal abnormalities and Y-chromosome deletions were excluded.
Received May 3, 2004; revised and accepted July 14, 2004. Reprint requests: Henrike Westerveld, M.D., Center for Reproductive Medicine, Department of Obstetrics and Gynaecology, Academic Medical Center, Meibergdreef 9, H4-205, 1105 AZ Amsterdam, The Netherlands, FAX:⫹31-20-6963489; E-mail: g.h.westerveld@amc. uva.nl).
We performed mutation screening in our patient group using an automated Denaturing High-Performance Liquid Chromatography (WAVE®) according to conditions recommended by the manufacturer (Transgenomic). With the aid of Primer3, we designed 10 pairs of primers for amplification of all coding exons and intron/exon boundaries of
0015-0282/05/$30.00 doi:10.1016/j.fertnstert.2004.10.013
Fertility and Sterility姞 Vol. 83, No. 2, February 2005 Copyright ©2005 American Society for Reproductive Medicine, Published by Elsevier Inc.
513
TABLE 1 Primers. Exon
Primer sequence
2
Fa: ATTATACCCAGTGCAAAAAGTGTAAAAG Rb: GCAAATATGTTATTTTATAGTTGCACAAAG Fa: GCATGAGAATTATTCATCTTTTATCAAC Rb: AAACCTAGTCATCCAATGAAAATAGAGT Fa: GTGAATGATTCTTCTAAGATTCCCA Rb: CCCGAAAAGATTAGTTTCAAATACA Fa: AAATTCTTTCTAACTAGTTTTTCCTTATTG Rb: AAATAACTTTATTAGATGAAAGAAACATGA Fa: AATATCTGTGACATTCAATTTTTACCATAG Rb: TAATTTGGTTGATGTGTGTTATTATTTGTA Fa: TATTTTAAAGGCTTCTGCCTAATTT Rb: TGAAAGTTAGCTAAGAAAGGACTAA Fa: ATAATCAGAATGGGTTTTTATTTTC Rb: AAACTTTAGTATTCATGCAGTCATC Fa: TTTGGTTTAACAGAAATAACTAATCA Rb: GAAGAGATTTGAATAAATCAACAAA Fa: AATATTTAGAATTAATAGATGAAAGGTGACA Rb: ATATGATGGAAGAAAAACAAAGTAAAAAGT Fa: ATTCAGTCTTCCTGATCTATATTTTCTCTT Rb: AGGTATTAACTAACACTAAGTTTCACAACG
3 4 5 6 7 8 9 10 11 a b
Product size 284 bp 221 bp 281 bp 280 bp 385 bp 182 bp 169 bp 325 bp 202 bp 190 bp
Forward primer. Reverse primer.
Westerveld. Human BOULE gene mutations and spermatogenesis. Fertil Steril 2005.
BOULE (Table 1), using the available genomic sequence information on the web (NM_033030). PCR was carried out in a total volume of 25 l and contained 25 ng DNA, 1x buffer (Roche, cat n° 1699105), 0.2 mM dNTPs, 8 pmol forward and reverse primer, 2 mM MgCl2 and 0.5 U Taq polymerase. We used a Touchdown PCR program with a temperature range of 62–50°C with a 2°C decrement per cycle and 1 cycle increment per temperature step and a final amplification for 20 cycles at 94°C for 30 s, 50°C for 30 s and 72°C for 30 s with a final extension at 72°C for 5 min. Whenever a variant was found, we sequenced this fragment with the same primers as used for PCR amplification on an automated ABI Prism 3100 Genetic Analyser (Applied Biosystems). For each variant detected, we subsequently designed a restriction fragment length polymorphism assay to evaluate the frequency of these variants in our controls. We applied the ESEfinder (Exonic Splicing Enhancer) program (http://exon.cshl.org/ESE) to determine the effect of apparently silent, exonic variants on splicing activity. Similarly, to evaluate the effect of intronic variants on the branch site sequence, thereby affecting splicing activity, we used the NetGene2 program (www.cbs.dtu.dk/services/ NetGene2). 514
Westerveld et al.
Correspondence
We identified only two variants through screening of all coding and splice site sequences of the BOULE gene of 156 patients. One variant was found in exon 2 and one in intron 4. The C 3 A nucleotide change in exon 2 at the cDNA sequence position 336 led to a serine in tyrosine substitution (S9Y). This missense mutation, found in two patients and one control, is not located in an RNA binding motif nor does it affect splice sites, according to ESEfinder analyses. The intronic variant changed a T into a C at position minus 19 in intron 4 and occurred in one patient only. This variant does not change any of the conserved nucleotides of the branch site of intron 4, according to NetGene2 analyses. Our data thus show a low variability in the BOULE gene of subfertile men, thereby confirming previous findings of the high degree of conservation of the gene both within and between species (12). However, although previous animal studies have shown that BOULE is an important gene for normal spermatogenesis, we could not find any relevant mutations in our patient group. One of the two variants found was a missense mutation (S9Y). This mutation is most likely a rare polymorphism and cannot be responsible for the impaired spermatogenesis phenotype for the following reasons. First, the S9Y mutation occurred in both patients and controls. Second, Vol. 83, No. 2, February 2005
the mutation is not located in a known functional domain and does not alter splicing. Finally, the serine into tyrosine substitution does not change the polarity of the amino acid. The second variant, a C 3 A transition in intron 4, was found in one patient only. Since this variant is located in an intron and does not affect the predicted consensus sequence at the branch site of the intron, it also does not seem to have any functional consequences. To date, few researchers have been able to find infertility causing genetic aberrations in humans, despite the overwhelming number of well described candidate genes in animal studies. Nevertheless, at present, mutation screening of candidate genes in men with spermatogenic failure represents the only option to investigate the genetic basis of impaired spermatogenesis in humans. In doing so we have eliminated mutations in BOULE as a major cause of impaired spermatogenesis. G. Henrike Westerveld, M.D.a Sjoerd Repping, Ph.D.a Nico J. Leschot M.D., Ph.D.b Fulco van der Veen M.D., Ph.D.a M. Paola Lombardi Ph.D.a,b a Center for Reproductive Medicine, Department of Obstetrics and Gynaecology, and b Department of Clinical Genetics, Academic Medical Center, Amsterdam, The Netherlands REFERENCES 1. Matzuk MM, Lamb DJ. Genetic dissection of mammalian fertility pathways. Nat Cell Biol 2002;4(Suppl):s41–s49. 2. Hirsh A. Male subfertility. BMJ 2003;327:669 –72.
Fertility and Sterility姞
3. Kuroda-Kawaguchi T, Skaletsky H, Brown LG, Minx PJ, Cordum HS, Waterston RH et al. The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet 2001;29:279 – 86. 4. Saxena R, de Vries JW, Repping S, Alagappan RK, Skaletsky H, Brown LG et al. Four DAZ genes in two clusters found in the AZFc region of the human Y chromosome. Genomics 2000;67:256 – 67. 5. Repping S, Skaletsky H, Brown L, Van Daalen SK, Korver CM, Pyntikova T et al. Polymorphism for a 1.6-Mb deletion of the human Y chromosome persists through balance between recurrent mutation and haploid selection. Nat Genet 2003;35:247–51. 6. Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F et al. Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet 1996;5:933– 43. 7. Houston DW, King ML. A critical role for Xdazl, a germ plasmlocalized RNA, in the differentiation of primordial germ cells in Xenopus. Development 2000;127:447–56. 8. Ruggiu M, Speed R, Taggart M, McKay SJ, Kilanowski F, Saunders P et al. The mouse Dazla gene encodes a cytoplasmic protein essential for gametogenesis. Nature 1997;389:73–7. 9. Teng YN, Lin YM, Lin YH, Tsao SY, Hsu CC, Lin SJ et al. Association of a single-nucleotide polymorphism of the deleted-inazoospermia-like gene with susceptibility to spermatogenic failure. J Clin Endocrinol Metab 2002;87:5258 – 64. 10. Van Golde RJ, Tuerlings JH, Kremer JA, Braat DD, Schoute F, Hoefsloot LH. DAZLA: an important candidate gene in male subfertility? J Assist Reprod Genet 2001;18:395–9. 11. Eberhart CG, Maines JZ, Wasserman SA. Meiotic cell cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature 1996;381:783–5. 12. Xu EY, Lee DF, Klebes A, Turek PJ, Kornberg TB, Reijo Pera RA. Human BOULE gene rescues meiotic defects in infertile flies. Hum Mol Genet 2003;12:169 –75. 13. Xu EY, Moore FL, Pera RA. A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans. Proc Natl Acad Sci U S A 2001;98:7414 –9. 14. World Health Organization. WHO laboratory manual for the examination of human semen and sperm-cervical mucus interaction. 3rd ed. Cambridge, UK: Cambridge University Press; 1992.
515