Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans

G Model ANTAGE-4652; No. of Pages 8

ARTICLE IN PRESS International Journal of Antimicrobial Agents xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

International Journal of Antimicrobial Agents journal homepage: http://www.elsevier.com/locate/ijantimicag

Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans Ying Wang a , Jin-Yan Liu b , Ce Shi a , Wen-Jing Li a , Yue Zhao a , Lan Yan c,∗∗ , Ming-Jie Xiang a,b,∗ a

Department of Laboratory Medicine, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, 197 Ruijin No. 2 Road, Shanghai 200025, China Department of Laboratory Medicine, Ruijin Hospital Luwan Branch, Shanghai Jiao Tong University School of Medicine, Shanghai, China c Center for New Drug Research, School of Pharmacy, Second Military Medical University, 325 Guohe Road, Shanghai 200433, China b

a r t i c l e

i n f o

Article history: Received 20 May 2015 Accepted 3 August 2015 Keywords: Candida albicans Transcription factor Mrr2p Fluconazole resistance Mutation

a b s t r a c t The Candida albicans zinc cluster proteins are a family of transcription factors (TFs) that play essential roles in the development of antifungal drug resistance. Gain-of-function mutations in several TFs, such as Tac1p, Mrr1p and Upc2p, have been previously well documented in azole-resistant clinical C. albicans isolates. Mrr2p (multidrug resistance regulator 2) is a novel TF controlling expression of the ABC transporter gene CDR1 and mediating fluconazole resistance. In this study, the relationship between naturally occurring mutations in MRR2 and fluconazole resistance in clinical C. albicans isolates was investigated. Among a group of 20 fluconazole-resistant clinical C. albicans and 10 fluconazole-susceptible C. albicans, 12 fluconazole-resistant isolates overexpressed CDR1 by at least two-fold compared with the fluconazolesusceptible isolates. Of these 12 resistant isolates, three (C7, C9, C15) contained 11 identical missense mutations, 6 of which occurred only in the azole-resistant isolates. The contribution of these mutations to CDR1 overexpression and therefore to fluconazole resistance was further verified by generating recombinant strains containing the mutated MRR2 gene. The mutated MRR2 alleles from isolate C9 contributed to an almost six-fold increase in CDR1 expression and an eight-fold increase in fluconazole resistance; the missense mutations S466L and T470N resulted in an increase in CDR1 expression of more than twofold and a four-fold increase in fluconazole resistance. In contrast, the other four missense mutations conferred only two- to four-fold increases in fluconazole resistance, with no significant increase in CDR1 expression. These findings provide some insight into the mechanism by which MRR2 regulates C. albicans multidrug resistance. © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

1. Introduction Candida albicans is a major opportunistic pathogen among humans and is especially virulent in immunocompromised patients, causing mucosal and systemic candidiasis. Candidiasis is frequently treated with the antifungal agent fluconazole and other azole drugs, which inhibit lanosterol 14␣-demethylase, a key enzyme in the biosynthesis of ergosterol in the fungal membrane [1]. However, with widespread and long-term use of these agents,

∗ Corresponding author at: Department of Laboratory Medicine, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, 197 Ruijin No. 2 Road, Shanghai 200025, China. Tel.: +86 21 6386 7643; fax: +86 21 6386 7643. ∗∗ Corresponding author. Tel.: +86 21 8187 1359; fax: +86 21 8187 1275. E-mail addresses: [email protected] (L. Yan), [email protected] (M.-J. Xiang).

treatment failure has become a serious problem due to the emergence of fluconazole-resistant clinical isolates [2,3]. Several mechanisms that contribute to fluconazole resistance in C. albicans have been elucidated, including increased drug efflux and mutations or overexpression of the ERG11 gene, which encodes lanosterol 14␣-demethylase [4–6]. Point mutations in ERG11 contribute to decreased binding affinity of azoles for their target enzyme Erg11p and increased azole resistance. Another common mechanism of azole resistance is overexpression of the multidrug efflux transporters encoded by the ATP-binding cassette (ABC) transporters CDR1 (Candida drug resistance 1) and CDR2 or the major facilitator efflux pump MDR1 (multidrug resistance 1) [7,8]. Upregulation of multidrug efflux transporters leads to enhanced efflux of azoles and therefore results in reduced drug accumulation and increased drug resistance. In recent years, a family of transcription factors (TFs) known as zinc cluster proteins (also known as Zn2 -Cys6 TFs) has attracted

http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001 0924-8579/© 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Please cite this article in press as: Wang Y, et al. Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans. Int J Antimicrob Agents (2015), http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001

G Model ANTAGE-4652; No. of Pages 8

ARTICLE IN PRESS Y. Wang et al. / International Journal of Antimicrobial Agents xxx (2015) xxx–xxx

2

interest since they are unique to fungi and are essential regulators of fungal metabolism. Through controlling the expression of genes involved in drug resistance, the Zn2 -Cys6 TFs have central roles in C. albicans multidrug resistance. Several TFs have been well documented, especially their gain-of-function (GOF) mutations, which are closely linked with azole resistance. Tac1p (transcriptional activator of CDR genes) is a zinc cluster protein encoded by TAC1 that controls the expression of CDR1 and CDR2 through binding to the drug response element, which is present in the promoter region of both CDR genes, in response to certain toxic chemicals [7,9]. GOF mutations in Tac1p, such as N997D, T225A, N972D, A736V, R693K and G980E, which cause constitutive activity of Tac1p and, consequently, overexpression of both CDR genes, are a frequent cause of fluconazole resistance in clinical C. albicans isolates [7,10,11]. MDR1 can be regulated by a Zn2 -Cys6 TF designated Mrr1p (multidrug resistance regulator 1). Mutations in MRR1 resulting in P683S or G997V are strongly related to fluconazole resistance in clinical isolates of C. albicans [12]. Dunkel et al. identified four mutational hot-spots located in Mrr1p containing 13 mutations that are the main cause of MDR1-mediated drug resistance in C. albicans [8]. Previous studies have shown that GOF mutations in Upc2p, which is a Zn2 -Cys6 TF regulating the expression of ERG11 and other ergosterol biosynthesis genes, cause overexpression of ERG11 and decrease fluconazole susceptibility [13,14]. Mrr2p, encoded by MRR2 (also known as ZCF34 or orf19.6182), is another Zn2 -Cys6 TF that has a well conserved motif CX2 CX6 CX5–12 CX2 CX6–8 C in its DNA-binding domain [15]. MRR2 is involved in the regulation of multidrug resistance by controlling expression of CDR1, a gene that can be detected in fluconazole-susceptible isolates, but with higher activity in some fluconazole-resistant isolates [4]. Deletion of MRR2 from the wildtype strain reduces CDR1 expression in the absence or presence of the inducing chemicals, whilst artificially activated MRR2 in the C. albicans wild-type strain SC5314 results in overexpression of CDR1 and increased fluconazole resistance. Expression of the hyperactive MRR2 in the CDR1/ mutants results in abolition of fluconazole resistance. Therefore, MRR2 is required for basal and chemically

induced CDR1 expression. DNA microarray studies have revealed that hyperactive MRR2 expression results in upregulation of 32 genes, which are enriched for the GO (gene ontology) process term ‘fluconazole transport’ [15]. Moreover, MRR2 is required for full TAC1-mediated fluconazole resistance, whilst hyperactive MRR2 acts independently on TAC1 in the upregulation of CDR1 expression and mediation of fluconazole resistance [15]. This finding prompted us to investigate the contribution of naturally occurring mutations in MRR2 alleles to fluconazole resistance. 2. Materials and methods 2.1. Strains and growth conditions The C. albicans strains used in this study are listed in Table 1. All strains were stored as frozen stocks in 15% glycerol at −80 ◦ C and were routinely grown in YPD medium (1% yeast extract, 2% peptone and 2% glucose) at 30 ◦ C. To prepare solid medium, 1.5% agar was added. For selection of His+ , Leu+ or Arg+ transformants, cells were plated on corresponding Synthetic Dropout Media plates lacking histidine, leucine or arginine at 30 ◦ C for 2 days. Escherichia coli DH5␣ was used for propagation of plasmids, and DMT Chemically Competent cells (TransGen Biotech, Beijing, China) were used to generate site-directed mutation strains. These strains were grown in Luria–Bertani (LB) broth or on LB plates supplemented with 100 ␮g/mL ampicillin or 50 ␮g/mL kanamycin as required. 2.2. Plasmid construction The plasmids used in this study are listed in Table 2. All plasmids were identified by DNA sequencing. The primary primers used in this study are listed in Table 3. To express the wild-type MRR2 from the ADH1 promoter, the full-length of MRR2 was amplified with the primers MRR2-F/R and was inserted into pCPC20 (the general structure of pCPC20 is shown in Supplementary Fig. S1) [16] using ClonExpressTM II One-step Cloning Kit (Vazyme Biotech, Nanjing, China) to obtain pWY21. Primers CP19/28 were used to amplify

Table 1 Candida albicans strains used in this study. Strain

Parental strain

ATCC 90028 N/A Clinical isolates N/A C1–20 N/A C21–29 Constructed strains SC5314 SN152 WYS37

SN152

WYS20

WYS37

WYS21

WYS37

WYS22

WYS37

WYS23

WYS37

WYS24

WYS37

WYS25

WYS37

WYS26

WYS37

WYS27

WYS37

WYS28

WYS37

Relevant characteristics or genotype

Reference or source

Candida albicans ATCC strain

ATCC

Fluconazole-resistant Fluconazole-susceptible

– –

ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-PAP ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-MRR2SC5314 -PAP ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-MRR2C9 -PAP ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-MRR2H358N -PAP ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-MRR2E439K -PAP ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-MRR2S466L -PAP ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-MRR2A468G -PAP ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-MRR2S469T -PAP ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4 mrr2::CmLEU2/mrr2::CdHIS1 ADE2/ade2:: ADH1p-MRR2T470N -PAP

[17] This study This study This study This study This study This study This study This study This study This study

N/A, not applicable.

Please cite this article in press as: Wang Y, et al. Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans. Int J Antimicrob Agents (2015), http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001

G Model

ARTICLE IN PRESS

ANTAGE-4652; No. of Pages 8

Y. Wang et al. / International Journal of Antimicrobial Agents xxx (2015) xxx–xxx

3

Table 2 Plasmids used in this study. Plasmid

Description

Source

pSN40 pSN52 pCPC20

Candida maltosa LEU2 (CmLEU2), KanaR in the pCR-BluntII TOPO Candida dubliniensis HIS1 (CdHIS1), KanaR in the pCR-BluntII TOPO Candida albicans vector containing ADH1 promoter and Loxp-CdARG4-Loxp (PAP) maker for integration at ADE2 locus 2.13-kb C. albicans wild-type MRR2 from ADH1 promoter in pCPC20 2.13-kb MRR2 of C. albicans clinical isolate C9 from ADH1 promoter in pCPC20 MRR2H358N derived from pWY21 MRR2E439K derived from pWY21 MRR2S466L derived from pWY21 MRR2A468G derived from pWY21 MRR2S469T derived from pWY21 MRR2T470N derived from pWY21

[17] [17] [16]

pWY21 pWY22 pWY23 pWY24 pWY25 pWY26 pWY27 pWY28

the plasmid backbone of pCPC20. The sequence of the cloned MRR2 gene was identical to the genomic sequence of C. albicans wild-type strain SC5314 (orf19.6182). DNA fragments containing the MRR2 open reading frame (ORF) from clinical C. albicans resistant isolate C9 (Table 4) were also cloned into pCPC20 to obtain pWY22 for expression of the mutated MRR2 alleles. Plasmids containing the point mutations MRR2H358N , MRR2E439K , MRR2S466L , MRR2A468G , MRR2S469T and MRR2T470N were constructed using site-directed mutagenesis to generate pWY23, pWY24, pWY25, pWY26, pWY27 and pWY28, respectively, from plasmid pWY21; the primers used are listed in Table 3 and Supplementary Table S1. Supplementary Fig. S1 and Table S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j. ijantimicag.2015.08.001.

This study This study This study This study This study This study This study This study

2.3. Candida albicans strain generation Candida albicans strains were transformed using the classical lithium acetate transfection method. The MRR2/ mutant WYS37 was derived from the parental strain SN152 using PCR-based homologous recombination according to the method described by Noble and Johnson [17]. The plasmids pSN40 and pSN52 containing auxotrophic markers for histidine and leucine, respectively, were used. The deletion was verified by diagnostic PCR amplification of the sequences flanking the introduced auxotrophic marker. To express the wild-type and the mutated MRR2 gene in MRR2/ mutants, the inserts amplified from pCPC20, pWY21, pWY22, pWY23, pWY24, pWY25, pWY26, pWY27 and pWY28 with primers CP22/CP23 were introduced into WYS37 at the endogenous ADE2 gene loci, generating strains WYS20, WYS21, WYS22, WYS23, WYS24, WYS25, WYS26, WYS27 and WYS28, respectively. Strain WYS20 was used to control for the influence of the plasmid backbone.

Table 3 Primers used in this study. Name

Sequences (5 → 3 )a

MRR2-F/R

AGGTAATCATTGTCAATGACCAAACGTGATCGTACA CAATGGCACTACAGCGGGTTTACGAGATTTTGAGGA GCTGTAGTGCCATTGCATTGTTCACCACAAATGTTTCT TGACAATGATTACCTATGGTAGCGATGCACGGT TTGGACGCAGCCAAATCAC TGAGTTCAAATGGCACACCAA CGAAACTTCTGCCATCCTCAAT AGTAGAAACCAAACTCCAAGCC TAGGTCCCTTGAATAAGTAGAGCG TGATCCCCATCATAGACGAAAC AGCACGGAGTGTGTCGTAGGAA GCAGAAGCGAGGGAACTTGAAA TTCAGATTCCCTTTCAGC GCAATTTATCCACTACGG CTTTAGGTTCATACGGTG TTGTGTGGCAAACAGGAC AATACCAACGATGTCACT ATTAGCCAAGATTTCCAC ACCATCCTCAATTACCAG GTCATCTTCTTGCTTACA TACATTGGCGAAAACAACCCCAAGCAACAGCATTTGCG GCTTGGGGTTGTTTTCGCCAATGTACTCTGGGTCTCGA TCAAAAACTTCCAAAGACACACCCTTGGAAACCGTGCT CCAAGGGTGTGTCTTTGGAAGTTTTTGAATTGATCTCGAC GCCACCATTGATTTAGAAGCTAGTACTGTGTTCTACAACG CAGTACTAGCTTCTAAATCAATGGTGGCAAGAAAGGCTTG TTGATTCCGAAGGTAGTACTGTGTTCTACAACGATTTGG AACACAGTACTACCTTCGGAATCAATGGTGGCAAGAAA ATTCCGAAGCTACTACTGTGTTCTACAACGATTTGGTC TAGAACACAGTAGTAGCTTCGGAATCAATGGTGGCAAG CCGAAGCTAGTAATGTGTTCTACAACGATTTGGTCATT TTGTAGAACACATTACTAGCTTCGGAATCAATGGTGGC

CP19/28 CP22/23 MRR2-1F/R MRR2-2F/R MRR2-3F/R TAC1-1F/R TAC1-2F/R TAC1-3F/R TAC1-4F/R H358N-F/R E439K-F/R S466L-F/R A468G-F/R S469T-F/R T470N-F/R

a Underlined bases are the overlapping sequences that were used for seamless cloning; boldface type represents the mutations introduced into the primers for site-directed mutagenesis.

2.4. MRR2 and TAC1 amplification and sequencing Candida albicans genomic DNA was extracted as described previously [18]. The extracted DNA was used as template for amplification of the full-length MRR2 and TAC1 genes. The primers MRR2-1F/R, MRR2-2F/R and MRR2-3F/R (Table 3) were used for MRR2 amplification and sequencing. The primers TAC1-1F/R, TAC1-2F/R, TAC1-3F/R and TAC1-4F/R were used for TAC1 amplification and sequencing. Sequencing was performed by BioSune Biotech (Shanghai, China).

2.5. Drug susceptibility testing Fluconazole susceptibility of the isolates was evaluated by the broth microdilution reference method according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [19]. Candida albicans ATCC 90028 and Candia krusei ATCC 6258 were used as controls. Strains were incubated in 96-well plates containing serial two-fold dilutions of fluconazole ranging from 128 ␮g/mL to 0.125 ␮g/mL. The minimum inhibitory concentration (MIC) was defined as the drug concentration required to inhibit 80% of cell growth in the control well (without fluconazole). Drug susceptibility testing was also performed by spotting cells on solid YPD plates containing 5 ␮g/mL fluconazole. Candida albicans cells were grown overnight on YPD plates and were diluted in saline to 1 × 107 cells/mL. Serial ten-fold dilutions were prepared and samples (2 ␮L) of each dilution were spotted onto YPD plates with or without fluconazole. The cultures were incubated for 48 h at 30 ◦ C.

Please cite this article in press as: Wang Y, et al. Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans. Int J Antimicrob Agents (2015), http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001

G Model

ARTICLE IN PRESS

ANTAGE-4652; No. of Pages 8

Y. Wang et al. / International Journal of Antimicrobial Agents xxx (2015) xxx–xxx

4

Table 4 Results of in vitro fluconazole susceptibility testing and MRR2 sequence analysis for three clinical isolates of Candida albicans. Strain

Site of isolation

ATCC 90028

–

C7

Skin

C9

Mid-stream urine

C15

Skin

MICFLZ (␮g/mL) 0.25 64

Nucleotide changes in MRR2 resulting in amino acid changes

Amino acid changes in Mrr2pa

A247G* , T428C* , G429A* , C430G* , A433G* , G494A* , T1352C, T1438C T428C, G429A, C430G, A433G, C1072A, G1315A, T1352C, C1397T, C1398A, C1403G, G1406C, C1409A, T1438C

T83A, L143P, L144V, T145A, S165N, V451A, S480P L143P, L144V, T145A, H358N, E439K, V451A, S466L, A468G, S469T, T470N, S480P L143P, L144V, T145A, H358N, E439K, V451A, S466L, A468G, S469T, T470N, S480P L143P, L144V, T145A, H358N, E439K, V451A, S466L, A468G, S469T, T470N, S480P

128

T428C, G429A, C430G, A433G, C1072A, G1315A, T1352C, C1397T, C1398A, C1403G, G1406C, C1409A, T1438C

32

T428C, G429A, C430G, A433G, C1072A, G1315A, T1352C, C1397T, C1398A, C1403G, G1406C, C1409A, T1438C

MIC, minimum inhibitory concentration. * Nucleotide changes are heterozygous. a Amino acid changes appearing only in fluconazole-resistant isolate are shown in boldface type.

2.6. Quantitative real-time reverse transcription PCR (qRT-PCR) RNA was isolated using a Yeast RNAiso Kit (TaKaRa, Tokyo, Japan) in accordance with the manufacturer’s instructions. Firststrand cDNA was synthesised from 1 ␮g of total RNA in a 20 ␮L reaction mixture using the PrimeScriptTM RT Reagent Kit with gDNA Eraser (TaKaRa). qRT-PCR was performed for independent amplification of 18S rRNA and genes to be quantified from the same cDNA template using a 7300 Real-Time PCR System (Applied Biosystems, Shanghai, China), with SYBR Premix Ex Taq (Tli RNaseH Plus) (TaKaRa). Triplicate technical replicates were included. PCR cycling conditions were 95 ◦ C for 5 min, followed by 40 cycles of 95 ◦ C for 5 s and 60 ◦ C for 31 s. Dissociation curves were generated at the end of each PCR cycle to verify amplification of a single product. The change in SYBR Green dye fluorescence in every cycle was monitored and the cycle threshold (CT ) above the background was calculated. The CT value of 18S rRNA was subtracted from the detected genes to obtain a CT value. The CT value of a calibrator was subtracted from the CT value of each sample to obtain CT . The gene expression level relative to the calibrator was calculated as 2−CT . 2.7. Multilocus sequence typing (MLST) of Candida albicans isolates The MLST method was performed as described by Bougnoux et al. [20]. Oligonucleotide primers were used for seven gene fragments (AAT1a, ACC1, ADP1, MPIb, SYA1, VPS13 and ZWF1b). The PCR products were purified and sequenced by BioSune Biotech. The allelic profiles and the diploid sequence types (DSTs) of the seven gene sequences were obtained from the C. albicans MLST sequence type database (http://pubmlst.org/calbicans/) and were then analysed using the eBURST package to determine the MLST clonal clusters.

as an MIC ≥ 16 ␮g/mL. Of the 29 clinical isolates, 20 were classified as fluconazole-resistant and the remaining 9 isolates were fluconazole-susceptible (Fig. 1). CDR1 expression was then measured in all isolates and it was found that 12 resistant isolates expressed CDR1 at levels at least two-fold greater than those expressed by the susceptible group (Fig. 2A). DNA sequence analysis of the MRR2 ORFs in the 12 isolates overexpressing CDR1 and the 10 fluconazole-susceptible isolates revealed an absence of missense mutations in most of the isolates, with the exception of C. albicans strain ATCC 90028 and three clinical fluconazole-resistant isolates (C7, C9 and C15). Of the remaining 18 clinical isolates, 16 had a C462T mutation resulting in no amino acid changes, whilst 2 isolates did not contain any mutations (Supplementary Table S2). Supplementary Table S2 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ijantimicag.2015. 08.001. Two polymorphic MRR2 alleles were found in the susceptible C. albicans ATCC 90028 isolate as some mutations were heterozygous. Compared with C. albicans strain SC5314, strain ATCC 90028 had 11 nucleotide substitutions, 8 of which were missense mutations resulting in seven amino acid changes (Table 4). It is noteworthy that six of the eight missense mutations were heterozygous. Only one MRR2 allele was obtained from the three resistant isolates because all mutations were homozygous. These corresponded to four missense mutations (T428C, G429A, C430G and A433G) that were heterozygous in C. albicans strain ATCC 90028. Interestingly, all nucleotide substitutions appeared together consistently in the three resistant isolates, with all containing the same 13 missense mutations resulting in 11 amino acid changes. Among these changes, six (H358N, E439K, S466L, A468G, S469T and T470N) were present only in fluconazole-resistant isolates, three (L143P, L144V and T145A) were homozygous in resistant isolates while they were heterozygous in susceptible isolates, and the remaining two missense mutations (V451A and S480P) were homozygous both in resistant and susceptible isolates.

3. Results 3.1. CDR1-overexpressing clinical Candida albicans isolates contain mutations in MRR2

3.2. CDR1 or CDR2 overexpression detected in 17 clinical Candida albicans isolates, some of which contain gain-of-function mutations in TAC1

To identify the possible MRR2 GOF mutations, a collection of 29 clinical C. albicans isolates from five hospitals in Shanghai, China, as well as C. albicans ATCC 90028 was obtained. The isolates were identified using morphological analysis on CHROMagarTM Candida chromogenic medium (CHROMagar, Paris, France) and carbohydrate assimilation tests (API 20C; bioMérieux, Paris, France). Fluconazole susceptibility was evaluated using the broth microdilution reference method [19]. Fluconazole resistance was defined

CDR1 and CDR2 belong to the ABC transporter family and can be regulated by TAC1. These genes are highly homologous in C. albicans; therefore, CDR2 expression in all the clinical isolates was quantified. Sixteen resistant isolates expressed CDR2 at levels more than two-fold higher than the susceptible isolates (including C7 and C9 but not C15) (Fig. 2B). The TAC1 genes were sequenced in all clinical isolates identified with CDR1 or CDR2 overexpression. The results revealed the GOF mutations A736V or R693K [11] in

Please cite this article in press as: Wang Y, et al. Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans. Int J Antimicrob Agents (2015), http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001

G Model ANTAGE-4652; No. of Pages 8

ARTICLE IN PRESS Y. Wang et al. / International Journal of Antimicrobial Agents xxx (2015) xxx–xxx

5

Fig. 1. Minimum inhibitory concentrations (MICs) of fluconazole for 29 clinical Candida albicans isolates, C. albicans ATCC 90028 and Candida krusei ATCC 6258. Strains C1–C20 were fluconazole-resistant (black bars) with MICs ≥ 16 ␮g/mL and strains C21–C29 were fluconazole-susceptible (dark grey bars) with MICs of 0.125–2 ␮g/mL. The C. albicans quality control strain ATCC 90028 (light grey bar) had an MIC of 0.25 ␮g/mL and C. krusei ATCC 6258 (light grey bar) had an MIC of 32 ␮g/mL.

eight isolates as well as identifying two new mutations R482C and H741D (Supplementary Table S2). 3.3. MRR2 mutations cause decreased fluconazole susceptibility and constitutive overexpression of CDR1 but not CDR2 To verify that the identical MRR2 missense mutations in the three different C. albicans isolates are responsible for fluconazole resistance, the mutated MRR2 alleles from strain C9 were introduced into a derivative of C. albicans wild-type strain SN152 from which the endogenous MRR2 alleles had been deleted

(strain MRR2C9 or WYS22; Table 1). In addition, C. albicans strain WYS37 expressing the wild-type MRR2 allele (strain MRR2SC5314 or WYS21) and the empty vector without the MRR2 allele (strain MRR2empty vector or WYS20) also expressed from the ADH1 promoter were used for comparison. To assess the contribution of each of the six missense mutations found only in fluconazole-resistant isolates, strains with each of the six point mutations (strains WYS23H358N , WYS24E439K , WYS25S466L , WYS26A468G , WYS27S469T and WYS28T470N ) were constructed by site-directed mutagenesis of the wild-type MRR2 allele. The fluconazole susceptibility of these transformants was tested using the broth microdilution

Fig. 2. Fold changes in the expression levels of (A) CDR1 and (B) CDR2 in fluconazole-resistant (n = 20; C1–C20) and fluconazole-susceptible (n = 9; C21–C29; light grey bars) strains of Candida albicans relative to the average values of fluconazole-susceptible strains. Fluconazole-resistant strains exhibiting greater than two-fold CDR1 or CDR2 overexpression compared with the average value of the fluconazole-susceptible group are shown as black bars; the remaining fluconazole-resistant strains are shown as dark grey bars. Each sample was processed in triplicate. Error bars show the standard deviation of the mean.

Please cite this article in press as: Wang Y, et al. Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans. Int J Antimicrob Agents (2015), http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001

G Model ANTAGE-4652; No. of Pages 8 6

ARTICLE IN PRESS Y. Wang et al. / International Journal of Antimicrobial Agents xxx (2015) xxx–xxx

Fig. 3. Fluconazole susceptibility of Candida albicans strains expressing a mutated MRR2 gene. Spotting assays were performed with serial ten-fold dilutions of overnight cultures on YPD (yeast extract–peptone–glucose) medium with or without 5 ␮g/mL fluconazole. Plates were incubated for 48 h at 30 ◦ C. Minimum inhibitory concentrations (MICs) of fluconazole were determined using the broth microdilution method according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [19].

Fig. 4. Fold changes in the expression levels of (A) CDR1 and (B) CDR2 in the laboratory-constructed Candida albicans strains containing mutated MRR2 genes relative to the average values of C. albicans wild-type strain SN152. Three strains (black bars) exhibited two-fold CDR1 overexpression compared with strain SN152. Each sample was processed in triplicate. Error bars show the standard deviation of the mean.

reference method and by spotting assay (Fig. 3). As previously reported, the MRR2/ mutants exhibited increased fluconazole susceptibility, and re-introduction of the original wild-type MRR2 allele expressed from the ADH1 promoter did not confer increased resistance to fluconazole [15]. However, all mutated MRR2 alleles conferred increased resistance to fluconazole. In particular, strain MRR2C9 containing the mutated MRR2 allele derived from C9 conferred an eight-fold increase in resistance to fluconazole with MICs ranging from 0.5 ␮g/mL to 4 ␮g/mL.qRT-PCR analysis of the CDR1 expression levels in the strains described previously was used as a complementary approach to explore the effects of MRR2 mutations on CDR1 overexpression. CDR2 expression was also analysed in these strains, although clinical isolate C15 was known not to overexpress CDR2. As shown in Fig. 4B, none of the mutated MRR2 alleles conferred obvious changes compared with SN152, indicating that MRR2 does not activate the CDR2 promoter; this is consistent with previous research [15]. However, the mutated MRR2 alleles from C9, MRR2S466L and MRR2T470N resulted in at least a two-fold increase in CDR1 expression compared with the wildtype MRR2 allele of C. albicans SN152 (Fig. 4A). The remaining MRR2 alleles containing site-directed mutations, including H358N,

E439K, A468G and S469T, resulted in only slight increases in CDR1 expression. It is noteworthy that the mutated MRR2 allele from C9 resulted in almost six-fold CDR1 overexpression. These results demonstrated the presence of MRR2 missense mutations in the fluconazole-resistant clinical isolate C9 (or C7, C15), which resulted in constitutive expression of the transcription factor and caused CDR1 overexpression. The missense mutations S466L and T470N were responsible for CDR1 overexpression, whilst the other four missense mutations were dispensable. 3.4. The three clinical isolates C7, C9 and C15 are closely related in terms of molecular epidemiology MLST analysis was conducted to investigate the epidemiological relationship between the three isolates containing identical MRR2 mutations. The results showed that C9 belongs to DST 1831 (Table 5), whilst the other two isolates have new DSTs. However, eBURST analysis showed that only one or two different housekeeping genes were common among the three isolates, belonging to one clonal complex, indicating a close relationship in terms of molecular epidemiology.

Please cite this article in press as: Wang Y, et al. Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans. Int J Antimicrob Agents (2015), http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001

G Model

ARTICLE IN PRESS

ANTAGE-4652; No. of Pages 8

Y. Wang et al. / International Journal of Antimicrobial Agents xxx (2015) xxx–xxx

7

Table 5 Details of three Candida albicans clinical isolates tested by MLST. Strain

AAT1a

ACC1

ADP1

MPIb

SYA1

VSP13

ZWF1b

DST

C7 C9 C15

59 59 59

17 17 8

21 21 21

2 2 2

80 80 80

108 205 108

15 15 15

New1 1831 New2

MLST, multilocus sequence typing; DST, diploid sequence type.

4. Discussion In the present study, we established for the first time a link between mutations in transcription factor Mrr2p and constitutive overexpression of the multidrug efflux transporter CDR1, which is responsible for antifungal azole resistance. Since it was first reported by Sanglard et al. [21], many studies have shown that the major mechanism of azole resistance in clinical C. albicans isolates is based on the persistent overexpression of multidrug efflux pumps. It is well documented that missense mutations in trans-regulatory factors such as Tac1p and Mrr1p are responsible for the constitutive upregulation of genes encoding multidrug efflux pumps in drug-resistant C. albicans [7,8]. Among the rare reports of function of MRR2, most indicate that MRR2 is required for yeast cell adherence to silicone substrates, with MRR2 mutants displaying decreased colonisation in mouse kidneys [22–25]. In 2013, Schillig and Morschhäuser [15] reported that the zinc cluster transcription factor Mrr2p is involved in regulation of multidrug resistance by controlling CDR1 expression; however, all of these studies were based on C. albicans wild-type reference strain SC5314, with no investigation of clinical C. albicans resistant isolates. Nevertheless, it was concluded that Mrr2p is a significant trans-regulatory factor involved in C. albicans drug resistance and that, similar to Mrr1p, Tac1p and Upc2p, naturally occurring mutations in Mrr2p may be a cause of fluconazole resistance in clinical resistant isolates [15]. Building on previous research, we aimed to confirm that the naturally occurring mutations in Mrr2p are responsible for fluconazole resistance. Among the clinical isolates screened, only three contained mutations, although all were identical missense mutations, indicating that these mutations contribute to fluconazole resistance. To investigate this hypothesis, we cloned and expressed the mutated MRR2 allele from one of the three resistant isolates in a derivative of the drug-susceptible C. albicans strain SN152 from which the endogenous MRR2 allele had been deleted. This resulted in almost six-fold CDR1 overexpression and an eight-fold increase in the MIC of fluconazole compared with the wild-type SN152 strain. This confirms that constitutive CDR1 upregulation in fluconazole-resistant clinical C. albicans isolates is indeed linked to the mutations in MRR2. In accordance with previous reports [15], the MRR2/ mutants exhibited increased fluconazole susceptibility and slightly decreased CDR1 expression in the current study. This is due to the requirement of MRR2 for basal CDR1 expression. Complementation with the original wild-type MRR2 allele expressed from the ADH1 promoter did not confer increased resistance to fluconazole, which is also consistent with the findings of Schillig and Morschhäuser [15]. Compared with the C. albicans wild-type strain SN152, the mutated MRR2 allele from C9 contained 13 homozygous missense mutations resulting in 11 amino acid changes in Mrr2p, including 6 amino acid changes (H358N, E439K, S466L, A468G, S469T and T470N) that were identified only in C. albicans fluconazole-resistant clinical isolates in this study. To assess the contribution of each of these mutations to fluconazole resistance, mutated strains of C. albicans were generated containing single point mutations corresponding to the six amino acid changes described. All six mutated MRR2 alleles conferred increases (two- to four-fold) in the MIC of

fluconazole. However, only the MRR2T470N and MRR2S466L alleles conferred increases in CDR1 expression exceeding two-fold, whilst the CDR1 expression of the remaining four single-point mutated MRR2 alleles was less than two-fold greater than that expressed by SN152, with MRR2A468G and MRR2S469T expression remaining basically unchanged. Based on this phenomenon, we speculated that the effect of the mutations expressed independently was small. However, when all six mutations exist in a single isolate, Mrr2p is highly activated because of the interaction between the six mutations, which are located in close proximity. In addition, three amino acid changes (L143P, L144V and T145A) were heterozygous in fluconazole-susceptible strains and homozygous in fluconazole-resistant isolates. Previous reports have clearly documented that loss of heterozygosity (LOH) in TAC1 and MRR1 are important causes of antifungal resistance in C. albicans [7,8,10]. It can be speculated that LOH in C. albicans strains containing MRR2 mutations also contribute to fluconazole resistance and constitutive CDR1 overexpression, although the exact mechanism remains to be clarified. It is striking that the identical MRR2 mutations were found in three different isolates; therefore, MLST analysis was performed to verify the epidemiological relationship between the three isolates. The results revealed that the three isolates are closely related in terms of molecular epidemiology, which indicates that mutations in MRR2 alleles are not common and could also explain why only three isolates containing mutations in MRR2 were identified in this study. The TAC1 genes in 17 clinical isolates were sequenced to investigate why most of the fluconazole-resistant clinical isolates overexpressed CDR1 or CDR2, whilst MRR2 mutations were identified in only 3 strains. The results showed six isolates containing the A736V mutation and two containing R693K in TAC1. Two new mutations (R482C and H741D) were identified in one (C17) and two (C10 and C13) isolates, respectively (Supplementary Table S2). Both strains C10 and C13 overexpressed CDR2, indicating that the newly identified H741D mutation is a GOF mutation (Fig. 2B), although further investigations are required to verify this hypothesis. The clinical isolates C4, C5, C7, C11 and C18, which overexpress CDR1 or CDR2, have no GOF mutations in MRR2 and TAC1; thus, it is possible that other TFs (such as NDT80) activate the CDR1 or CDR2 promoters. The ABC transporter CDR1 is regulated not only by Mrr2p but also by Tac1p and Ndt80p [26]. It has been proposed that Ndt80p is involved in the transcriptional regulation of Mrr1p, Tac1p and Upc2p target genes [27], although Sasse et al. [28] held the opposite view. This emphasises the existence of the regulatory network of TFs that mediate C. albicans resistance. Schillig and Morschhäuser recently reported that MRR2 is required for full Tac1p-mediated fluconazole resistance, even though hyperactive Tac1p confers higher fluconazole resistance (12.5 ␮g/mL) than hyperactive Mrr2p (3.13 ␮g/mL) [15]. It can be speculated that Mrr2p is comparatively weaker than Tac1p in regulating CDR1 expression and mediating antifungal resistance. This may also explain why many more studies have explored the role of Tac1p in regulating C. albicans resistance, and mutations in TAC1 have been found in many azole-resistant clinical isolates. Nevertheless, as a novel transcriptional regulator involved in C. albicans drug resistance, Mrr2p requires further

Please cite this article in press as: Wang Y, et al. Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans. Int J Antimicrob Agents (2015), http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001

G Model ANTAGE-4652; No. of Pages 8

ARTICLE IN PRESS Y. Wang et al. / International Journal of Antimicrobial Agents xxx (2015) xxx–xxx

8

investigation to fully elucidate the mechanism of drug resistance in C. albicans. Acknowledgments The authors thank the Center for New Drug Research, School of Pharmacy at the Second Military Medical University (Shanghai, China) for kindly providing strain SN152 and plasmids pSN40 and pSN52. The authors also thank Peng Chang at the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China) for providing plasmid pCPC20. Funding This work was financed by grants from the Program of Shanghai Key Specialty [#ZK2012A21], Natural Science Foundation of China [#81470158] and the Program of Shanghai Natural Science Foundation [#15ZR1426900]. Competing interests None declared. Ethical approval Not required. References [1] Kontoyiannis DP, Lewis RE. Antifungal drug resistance of pathogenic fungi. Lancet 2002;359:1135–44. [2] Cowen LE, Steinbach WJ. Stress, drugs, and evolution: the role of cellular signaling in fungal drug resistance. Eukaryot Cell 2008;7:747–64. [3] Alcazar-Fuoli L, Mellado E. Current status of antifungal resistance and its impact on clinical practice. Br J Haematol 2014;166:471–84. [4] Coste AT, Karababa M, Ischer F, Bille J, Sanglard D. TAC1, transcriptional activator of CDR genes, is a new transcription factor involved in the regulation of Candida albicans ABC transporters CDR1 and CDR2. Eukaryot Cell 2004;3:1639–52. [5] Sasse C, Schillig R, Reimund A, Merk J, Morschhäuser J. Inducible and constitutive activation of two polymorphic promoter alleles of the Candida albicans multidrug efflux pump MDR1. Antimicrob Agents Chemother 2012;56:4490–4. [6] Morio F, Loge C, Besse B, Hennequin C, Le Pape P. Screening for amino acid substitutions in the Candida albicans Erg11 protein of azole-susceptible and azole-resistant clinical isolates: new substitutions and a review of the literature. Diagn Microbiol Infect Dis 2010;66:373–84. [7] Coste A, Turner V, Ischer F, Morschhäuser J, Forche A, Selmecki A, et al. A mutation in Tac1p, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans. Genetics 2006;172:2139–56. [8] Dunkel N, Blass J, Rogers PD, Morschhäuser J. Mutations in the multi-drug resistance regulator MRR1, followed by loss of heterozygosity, are the main cause of MDR1 overexpression in fluconazole-resistant Candida albicans strains. Mol Microbiol 2008;69:827–40.

[9] de Micheli M, Bille J, Schueller C, Sanglard D. A common drug-responsive element mediates the upregulation of the Candida albicans ABC transporters CDR1 and CDR2, two genes involved in antifungal drug resistance. Mol Microbiol 2002;43:1197–214. [10] Coste A, Selmecki A, Forche A, Diogo D, Bougnoux ME, d’Enfert C, et al. Genotypic evolution of azole resistance mechanisms in sequential Candida albicans isolates. Eukaryot Cell 2007;6:1889–904. [11] Coste AT, Crittin J, Bauser C, Rohde B, Sanglard D. Functional analysis of cisand trans-acting elements of the Candida albicans CDR2 promoter with a novel promoter reporter system. Eukaryot Cell 2009;8:1250–67. [12] Morschhäuser J, Barker KS, Liu TT, Blaß-Warmuth J, Homayouni R, Rogers PD. The transcription factor Mrr1p controls expression of the MDR1 efflux pump and mediates multidrug resistance in Candida albicans. PLoS Pathog 2007;3:e164. [13] Heilmann CJ, Schneider S, Barker KS, Rogers PD, Morschhäuser J. An A643T mutation in the transcription factor Upc2p causes constitutive ERG11 upregulation and increased fluconazole resistance in Candida albicans. Antimicrob Agents Chemother 2010;54:353–9. [14] Dunkel N, Liu TT, Barker KS, Homayouni R, Morschhäuser J, Rogers PD. A gainof-function mutation in the transcription factor Upc2p causes upregulation of ergosterol biosynthesis genes and increased fluconazole resistance in a clinical Candida albicans isolate. Eukaryot Cell 2008;7:1180–90. [15] Schillig R, Morschhäuser J. Analysis of a fungus-specific transcription factor family, the Candida albicans zinc cluster proteins, by artificial activation. Mol Microbiol 2013;89:1003–17. [16] Chang P, Fan X, Chen J. Function and subcellular localization of Gcn5, a histone acetyltransferase in Candida albicans. Fungal Genet Biol 2015;81:132–41. [17] Noble SM, Johnson AD. Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryot Cell 2005;4:298–309. [18] Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res 1991;19:6823–31. [19] Clinical and Laboratory Standards Institute. Reference method for broth dilution antifungal susceptibility testing of yeasts; approved standard—third edition. Document M27-A3. Wayne, PA: CLSI; 2008. [20] Bougnoux ME, Tavanti A, Bouchier C, Gow NAR, Magnier A, Davidson AD, et al. Collaborative consensus for optimized multilocus sequence typing of Candida albicans. J Clin Microbiol 2003;41:5265–6. [21] Sanglard D, Kuchler K, Ischer F, Pagani JL, Monod M, Bille J. Mechanisms of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve specific multidrug transporters. Antimicrob Agents Chemother 1995;39:2378–86. [22] Finkel JS, Xu W, Huang D, Hill EM, Desai JV, Woolford CA, et al. Portrait of Candida albicans adherence regulators. PLoS Pathog 2012;8:e1002525. [23] Fox EP, Nobile CJ. A sticky situation: untangling the transcriptional network controlling biofilm development in Candida albicans. Transcription 2012;3:315–22. [24] Puri S, Lai WK, Rizzo JM, Buck MJ, Edgerton M. Iron-responsive chromatin remodelling and MAPK signalling enhance adhesion in Candida albicans. Mol Microbiol 2014;93:291–305. [25] Vandeputte P, Ischer F, Sanglard D, Coste AT. In vivo systematic analysis of Candida albicans Zn2 -Cys6 transcription factors mutants for mice organ colonization. PLoS ONE 2011;6:e26962. [26] Chen CG, Yang YL, Shih HI, Su CL, Lo HJ. CaNdt80 is involved in drug resistance in Candida albicans by regulating CDR1. Antimicrob Agents Chemother 2004;48:4505–12. [27] Sellam A, Tebbji F, Nantel A. Role of Ndt80p in sterol metabolism regulation and azole resistance in Candida albicans. Eukaryot Cell 2009;8: 1174–83. [28] Sasse C, Schillig R, Dierolf F, Weyler M, Schneider S, Mogavero S, et al. The transcription factor Ndt80 does not contribute to Mrr1-, Tac1-, and Upc2-mediated fluconazole resistance in Candida albicans. PLoS ONE 2011;6: e25623.

Please cite this article in press as: Wang Y, et al. Mutations in transcription factor Mrr2p contribute to fluconazole resistance in clinical isolates of Candida albicans. Int J Antimicrob Agents (2015), http://dx.doi.org/10.1016/j.ijantimicag.2015.08.001