- Email: [email protected]
Mycoplasma pneumoniae pneumonia following assisted ventilation
Mycoplasma pneumoniae Pneumonia following Assisted Ventilation Jean Paul Casalta, MD, Philippe Piquet, MD, M a r c Alazia, MD, Catherine Guidon-Attali, MD, Michel Drancourt, MD, PhD, Didier Raoult, MD, PhD, Marseille, France
BACKGROUND:Mycoplasma pneumoniae pneumonia is regarded as a communityacquired pneumonia, rarely requiring hospitalization, with sporadic cases or limited outbreaks occurring after close contacts with an infected patient. Few reports mention M pneumoniae pneumonia acquired during hospitalization. PATIENTSAND METHODS:M pneumoniae was diagnosed in patients who developed pneumonia following perioperative and postoperative assisted ventilation by the isolation of M pneumoniae from bronchial washing, the detection of M pneumoniae DNA from bronchial washing, and serologic testing for the presence of specific immunoglobulin M (IgM) antibodies. RESULTS: Four patients were diagnosed as having M pneumoniae pneumonia following mechanical ventilation over a ll/2-year period. They were men, older than 50 years, and were hospitalized for vascular surgery. They developed febrile hypoxemia and intersticial pneumonia. Isolation of M pneumoniae and detection of M pneumoniae DNA were positive in 1 case; specific IgM antibodies were present in 4 cases. CONCLUSIONS:These observations allow the description of a new clinical entity and highlight the role of M pneumoniae as an agent of nosocomial infections. This diagnosis should be considered in any patient with precocious postassisted ventilation febrile hypoxemia and diffuse interstitial pneumonia, and empiric treatment protocols may include M pneumoniae in their spectrum. Am J Med. 1996;101:165169.
From the Laboratoirede Bacteriologie(JPC,MD, DR),.Servicede Chirurgie Vasculaire(PP),and Servicede Reanimation(MA,CGA),HOpitatde La Timone,Marseille,France. Thiswork was madepartiallypossiblethanksto ProgrammeHospitalier de RechercheClinique,AssistancePubliquea Marseille,1993. Requestsfor reprintsshouldbe addressedto Pr. DidierRaoult,Laboratoire de Bacteriologie,HSpitalde La Timone,BoulevardJeanMoulin, 13385 MarseilleCedex5, France. ManuscriptsubmittedJuly 7, 1995 and acceptedin revisedform May 9, 1996.
©1996byExcerptaMedica,Inc. Allrightsreserved.
Ycoplasma pneumoniae is a strictly h u m a n athogen causing acute u p p e r and lower respiratory tract infections.~ Other clinical manifestations that have b e e n associated with M pneumoniae include central nervous system infection, myocarditis and pericarditis, myringitis, otitis media, and ery t h e m a multiforme. P n e u m o n i a is one of the m a j o r clinical forms of M pneumoniae infection. It is normally a mild, community-acquired disease although s o m e cases are severe enough to require hospitalization. A recent study '~ reported that 4.9% of 1,300 patients with community-acquired p n e u m o n i a requiring hospitalization had M pneumoniae infection. More than 10% of these patients required assisted ventilation. Admission to an intensive care unit for ventilatory support during the course of severe M pneumoniae p n e u m o n i a has b e e n reported. 3 Transmission by aerosol from close contact with an infected patient results in sporadic cases or limited outbreaks a m o n g school-age children or within families. A s y m p t o m a t i c carriage of M pneumoniae has been reported. ~ A recent study s h o w e d that 4.6% to 13.5% of healthy Scandinavians w e r e positive for the p r e s e n c e of M pneumoniae on throat culture. '~ M pneumoniae was confirmed twice ~'~ and s u s p e c t e d once s as an agent of nosocomial infection, but none of the three reports highlighted this aspect. In this report, we present as a new clinical entity 4 patients with nosocomial M pneumoniae p n e u m o n i a following postoperative assisted ventilation.
PATIENTS AND METHODS P a t i e n t 1. A 53-yearoold man underwent femoral
arte~5~ bypass surgery on D e c e m b e r 2, 1992, under general anesthesia. His medical history included tob a c c o smoking, chronic alcoholism, previous aortobifemoral bypass surgery in 1987, f e m o r o f e m o r a l bypass surgery in 1990, and right p n e u m e c t o m y for lung c a r c i n o m a in 1990. Preoperative PaO2 was 100 m m Hg and PaCO2 35 m m Hg. The patient w a s hospit~]ized in our intensive care unit on D e c e m b e r 5, 1992, with a t e m p e r a t u r e of 38°C and respiratory distress. Leucocyte count was 13.4 × 109/L, PaO2 w a s 73 m m Hg, and PaCO2 w a s 39 m m Hg u n d e r supplemental oxygen. Chest r o e n t o g r a m disclosed extensive opacification of the left lung. Culture of bronchial washing yielded Pseudomonas aeruginosa, and t r e a t m e n t with ceftazidime plus ciprofloxacin
0002-9343/96/$15.00 165 PIIS0002-9343(96)00125-8
NOSOCOMIAL M PNEUMONIAEPNEUMONIA/CASALTA ET AL
TABLE Clinical and Microbiological Findings in 4 Patients with Mycoplasmapneumoniaefollowing Mechanical Ventilation Patient Number 3
Clinical Features
1
2
Age Sex
53 Male Femoral artery bypass 4.5 Yes Yes
53 Male Aorto-femoral artery bypass 5.5 Yes Yes
Femoral bypass 5 No Yes
Interstitial pneumopathy Spiramycin Death Yes Yes Yes
63 Male Coronaryartery bypass 5 Yes Yes Interstitial pneumopathy and atelectasis Amoxicillin-clavulanate Recovery No No Yes
Interstitial pneumopathy Erythromycin Recovery No No Yes
Interstitial pneumoniae Erythromycin Recovery Yes No Yes
42
20
30
30
Type of surgery Duration of surgery (hours) Fever > 38.5 C Hypoxemia
Treatment Outcome Isolation of M pneumoniae Amplification of M pneumoniaeDNA Positive IgM serology Time from onset of interstitial pneumoniae until diagnosis of M. pneumoniae(days)
was started. His clinical status worsened despite appropriate treatment against Aspergillus spp, En-
terococcus fecalis, and Pseudomonas aeruginosa successively recovered from bronchial washings throughout the 2-month course of hospitalization in the intensive care unit. There was no evidence of a new or recurrent lung cancer. A serological and bacteriological diagnosis of M pneumoniae pneumonia was made on December 31, 1992, on the basis of a positive anti-M pneumoniae immunoglobulin M (IgM) serology, an~plification of M pneumoniae DNA, and isolation of M pneumoniae from a bronchial washing ( T a b l e ) . The patient was then treated with sph-amycine adipate, 4.5 million units per day, but died 2 weeks later. Autopsy was not performed. P a t i e n t 2. This 63-year-old man underwent triple coronary bypass surgery on March 26, 1993, under general anesthesia. His medical history included tobacco smoking, non-insulin-dependent diabetes mellitus, and myocardial infarction in 1992. Recent unstable angina pectoris led to coronary angioplasty. Extubation was performed 12 hours postsurgery but a temperature of 38.8°C, respiratory distress with interstitial pneumonia and right basal atelectasis developed on March 27, 1993. The patient was admitted to our intensive care unit on March 29, 1993, and assisted ventilation and empirical treatement with amoxicillin plus clavulanic acid was started. Leucocyte count was 17.3 x 10'/L, PaO.2 67 mm Hg and PaCO~ 47 mm Hg despite assisted ventilation with an FiO.~ of 60% and PEEP of 10 cm H.~O. The patient's clinical status initially worsened, but he eventually recovered and left the intensive care unit on day 20. All bacteriological and virological investigations re166
August1996 The American Journal of Medicine~ Volume 101
4
76 Male
mained negative with the exception of positive IgM serology for M pneumoniae using capture-ELISA on March 30, 1993. Culture and polymerase chain reaction (PCR) amplification of bronchioloalveolar washing remained negative for M pneumoniae (Table). P a t i e n t 3. A 53-year-old man underwent aortobifemoral bypass surgery on April 13, 1993, under general anesthesia. His medical history included tobacco smoking, chronic alcoholism, diabetes mellitus, myocardial infarction in 1974, and moderate renal insufficiency. He developed a fever (temperature 39°C) and hypoxemia at the end of a 5-hour operative time and was adnutted to our intensive care unit. An attempt at extubation failed on April 14, 1993, and the patient remained febrile (39°C) and hypoxemic. Leucocyte count was 16.5 x 10'9/L with 90% polymorphonuclear cells. Empiric treatment with an~oxicillin plus clavulanic acid was started while mechanical ventilation was continued. Chest radiographs remained normal and bronchial washings sterile, and the hypoxemia eventually resolved after the antibiotic treatment was changed to ceftazidime combined with pefloxacin plus metronidazole. A catheter-related coagulase-negative Staphylococcus septicemia was treated with vancomycin plus fusidic acid, but the patient's temperature rose again to 38°C, and bilateral interstitial pneumonia was noted on May 12, 1993. M pneumoniae pneumonia was diagnosed on the basis of seroconversion for M pneumoniae and the presence of specific IgM antibodies, and antibiotic treatment with erythromycin, 2 g per day was started. Two days later he was afebrile, and he eventually recovered. The
NOSOCOMIAL M PNEUMONIAEPNEUMONIA/CASALTA ET AL
results of the investigations are presented in the Table. P a t i e n t 4. A 76-year-old man underwent resection of a femoral aneurism on July 20, 1994, under general anesthesia. His medical history included tobacco smoking, aortobifemoral bypass surgery in 1979, sympathectomy in 1985, myocardial infarction in 1990 with left ventricular failure (ejection fraction of 50%), arterial hypertension, mild restrictive respiratory insufficiency, and renal insufficiency (creatinine, 275 m m o l / L ) . He was admitted to our intensive care unit immediately after surgery. Extubation failed, and assisted ventilation was performed after tracheotomy on July 23, 1994. The patient developed Staphylococcus aureus pneumonia and catheter-related coagulase-negative Staphylococcus septicemia on July 24, 1994. Removal of the catheter and treatment with vancomycin plus fosfomycin resolved both infections but a second pneumonia with left basal lobe atelectasis developed on August 15, 1994. A bronchial washing culture yielded broad-spectrum betalactamase-producing KlebsieUa pneumoniae, and treatment with imipenem plus gentamicin was initiated. Bilateral interstitial pneumonia developed on August 20, 1994. A diagnosis of M pneumoniae pneumonia was confirmed by seroconversion and the presence of specific antibodies using the ELISA technique on August 24, 1994. Erythromycin, 2 g per day was added to the imipenem and gentamicin, and was changed to doxycycline, 200 mg per day, after 48 hours because a cutaneous rash developed. The patient eventually left the intensive care unit.
PCR products were analyzed on a 0.8% agarose gel after ethidium bromide staining.
Serologic Studies The detection of IgM antibodies specific to M p n e u moniae was performed by using the IgM immunocapture method and the commercial Mp Test (Incstar Corporation, Stillwater, Minnesota). Diluted controls (low, medium, high) and serum samples diluted 1:50 in 3% nonfat dry milk were added in triplicate to the wells of a microtiter plate previously coated with antibodies to human IgM, and incubated for 30 minutes at 37°C. After three washes, alkaline phosphatase-labelled M pneumoniae P1 adhesin was added for 30 minutes. Paranitrophenylphosphate was used as substrate, and the optical density (OD) was measured at 405 nm. The mean OD values of IgM medium positive and negative controls were calculated, and the cut-off value was obtained by the following formula: OD-negative serum + OD-positive serum divided by 2. The presence of antibodies was determined by relating the specinlen's OD to the cut-off value: specimen OD equal to or above the cut-off value plus 10% was considered as positive, OD below the cut-off value minus 10% as negative. The sensitivity and the specificity of this test were of 100% when compared with complement fixation test (reference test; D. Raoult, unpubfished data).
RESULTS The clinical and diagnosis characteristics of the 4 patients with M pneumoniae pneumonia are presented in the Table.
Isolation Procedure For isolation of M pneumoniae from bronchial washing, the sample was inoculated onto SP4-medium agar and into SP4-glucose broth (International Mycoplasma SA, Toulon, France) and was incubated for 21 days at 37°C in an anaerobic environment. Colonies of M pneumoniae were detected by color change of the SP4-glucose broth and by microscopic examination of the agar surface for the presence of homogeneous colonies. The identification was then confirmed by DNA anlplification (see below).
Amplification of M pneumoniae DNA Amplification of M pneumoniae DNA in clinical samples and in agar-grown colonies was performed according to Skakni et alY Briefly, DNA was prepared by boiling the sanlple in the presence of 5% Chelex 100 (BioRad, Hercules, California) as previously reported.I° Prepared DNA served as the template for PCR-ampfification using the primers MP51:5' GAAGCTTATGGTACAGGTTGG 3 ' and MP5-2:5' ATTACCATCCTTGTFGTAAGG 3' and the experimental conditions previously reported. 'q The
Isolation of
Mycoplasma pneumoniae
M pneumoniae was isolated from the bronchial washing of patient n u m b e r 1, but not from the bronchial washing of patient 2. No sample was cultured for the p r e s e n c e of M pneumoniae for patients 3 and 4. Amplification of
Mycoplasma pneumoniae D N A
Mpneumoniae DNA was amplified from the bronchial washing obtained from patient 1, but not from patient 2. No sample for DNA amplification was available for patients 3 and 4. Serology of
Mycoplasma pneumoniae
Imnmnoglobulin M antibodies specific for Mpneumoniae were detected in the serum of each patient using the capture-ELISA technique. Three serum samples were obtained 29 days, 34 days, and 40 days after surgery in patient 1: Breakpoint OD was 0.352 and sample ODs were 0.538, 0.358, and 0.368, respectively; and the three samples tested positive. Two serum samples were obtained 20 days and 30 August 1996 The American Journal of Medicine~ Volume 101
167
NOSOCOMIAL M PNEUMONIAE PNEUMONIA/CASALTA ET AL
days after surgery in patient 2: Breakpoint OD was 0.421 and sanlple OD was 0.959 for sample 1; and breakpoint OD was 0.296 and sample OD was 0.867 for sample 2. Three s e r u m samples were obtained 3 days, 30 days, and 37 days after surgery in patient 3: Breakpoint OD was 0.312, and sample ODs of, respectively, 0.275, >2, and 1.8 showed seroconversion. Two serum sanaples were obtained 20 days and 35 days after surgery for patient 4: Breakpoint OD of 0.340 and sample ODs of 0.310 and >2, respectively, showed a seroconversion.
COMMENTS Mycoplasma pneumoniae infections are primarily regarded as community-acquired infections. ~ Three reports, however, mention the occurrence of M pneumoniae p n e u m o n i a as a nosocolnial infection. On the basis of positive results of conmlercial DNA/ RNA hybridization tests on throat swabs, an outb r e a k of M pneumoniae infections including pneumonia and mild u p p e r respiratory tract diseases was traced to an orderly anaong the staff of an e m e r g e n c y d e p a r t m e n t in F i n i a n d . 6 One case of nosocomial M pneumoniae p n e u m o n i a has been reported on the basis of positive IgM serology in an adult, 7 and possible nosocomial infections have been reported a m o n g 3 pediatric patients, s Those reports, however, did not emphasize the concept ofMycoplasma pneumoniae as an agent of nosocomial infections. In this paper, we present 4 patients w h o developed nosocomial M pneumoniae p n e u m o n i a after postoperative assisted ventilation. The diagnosis was confirmed by the direct demonstration of the pathogen (culture plus genomic anlplification) and serology in 1 case and by serology alone in 3 cases, ineluding seroconversion in 2 patients. The specificity of this serologic test is 100%, and 50 patients prospectively tested in our intensive care unit were negative. This test is indicative of a recent infection. The 4 patients were not likely to have acquired M pneumoniae from an infected person during the hospitalization. Indeed, they were diagnosed over a 18month period, they were operated on by three different surgeons from two different teams, in two different operating rooms, and there was no k n o w n outbreak of M pneumoniae infection in our hospital during this time. The patients had no respiratory s y m p t o m s prior to admission to the hospital. Therefore, M pneumoniae p n e u m o n i a in these 4 patients was more likely to be endogenous. Reactivation of m y c o p l a s m a l infection has never been reported, but a s y m p t o m a t i c throat carriage of M pnvumoniae has been d o c u m e n t e d 4'5 and a 50% infectious dose as low as one colony-forming unit was d e m o n s t r a t e d after aerosol challenge in h u m a n volunteers.~ Also, experimental exposure to oxidants has b e e n s h o w n to de168
August1996 The American Journal of Medicine® Volume 101
crease intrapulmonary killing of Mpneumonis 1~and to potentiate Ureaplasma urealyticum p n e u m o n i a in mice. ~2 We therefore hypothesized that M pneumoniae was present in the throat of the 4 patients at the time of admission and that perioperative and postoperative mechanical ventilation inoculated the bacteria into the lower respiratory tract of these patients. All 4 patients were m e n older than 50 years who developed M pneumoniae p n e u m o n i a after they underwent vascular surgery, either femoral artery (3 patients) or coronary artery surgery (1 patient). Nine percent of patients in our intensive care unit are admitted after such surgery ( P <0.001; relative risk of 11.08). The 4 patients developed febrile hyp o x e m i a and diffuse interstitial p n e u m o n i a within the first 3 days of mechanical ventilation (3 patients), complicated by atelectasis (2 patients). Diagnosis relied upon the demonstration of seroconversion (2 patients), the p r e s e n c e of specific IgM antibodies (4 patients), and direct diagnosis by culture and PCR amplification of M pneumoniae in a bronchial washing (1 patient). This infection resulted in death for 1 patient. The relative c o n t r i b u t i o n of M pneumoniae infection to the clinical c o u r s e of t h e s e p a t i e n t s is not unique, since o t h e r n o s o c o m i a l b a c t e r i a w e r e g r o w n in the b r o n c h i a l w a s h i n g s at the time M pneumoniae infection w a s d o c u m e n t e d in 3 of the 4 patients, and M pneumoniae m a y be a c o f a c t o r in the c o n s t i t u t i o n of p n e u m o n i a in t h e s e patients. Many n a t u r a l l y - o c c u r r i n g r e s p i r a t o r y d i s e a s e s in a n i m a l s are c h a r a c t e r i z e d by initial colonization of the l o w e r r e s p i r a t o r y t r a c t by m y c o p l a s m a foll o w e d by o t h e r pathogens.~:3 N o s o c o m i a l p n e u m o nia d e v e l o p s in 20% to 25% of p a t i e n t s requiring a s s i s t e d ventilation. In the s t u d y by T o r r e s et al~4 of 78 e p i s o d e s of n o s o c o m i a l p n e u m o n i a in 322 patients requiring m e c h a n i c a l ventilation, 42 (53%) w e r e of u n k n o w n etiology. Mycoplasma pneumoniae m a y explain s o m e of the n o s o c o m i a l pneum o n i a s of u n k n o w n etiology and m a y be considered in the differential diagnosis of s u c h patients. We h a v e b e g u n a p r o s p e c t i v e s t u d y to a s s e s s the role of M pneumoniae as an etiological a g e n t of n o s o c o m i a l p n e u m o n i a in p a t i e n t s with m e c h a n i cal ventilation.
ACKNOWLEDGMENTS The authors are indebted to T. J. Marrie for expert review of the manuscript.
REFERENCES 1. Baurn SG. Mycoplasmapneumoniaeand atypical pneumonia. In: Mandell GL, Bennett JE, Dolin R, eds. Mandell, Douglasand Bennett's Principlesand Practice of Infectious Diseases. 4th ed. New York: Churchill Livingstone, 1995;17041713.
NOSOCOMIAL M PNEUMONIAE PNEUMONIA/CASALTA ET AL
2. Marrie TJ. Mycoplasma pneumoniae pneumonia requiring hospitalization, with emphasis on infection in the elderly. Arch InternMed. 1993;153:488-494. 3. Potgieter PD, Hammond JMJ. Etiology and diagnosis of pneumonia requiring ICU admission. Chest. 1992;101:199-203. 4. Williams WC, Williamson HA Jr, LeFevre ML. The prevalence of Mycoplasma pneumoniae in ambulatory patients with nonstreptococcal sore throat. Faro Med. 1991;23:117-121. 5. Gnarpe J, Lundback A, Sundelof B, Gnarpe H. Prevalence of Mycoplasma pneumoniae in subjectively healthy individuals. Scand J Infect Dis. 1992;24:161-164. 6. Kleemola M, Jokinen C. Outbreak of Mycoplasma pneumoniae infection among hospital personnel studied by a nucleic acid hybridization test. J Hosp Infect. 1992;21:213-221. 7. Louie M, Dyck B, Parker S, et al. Nosocomial pneumonia in a Canadian tertiary care center: a prospective surveillance study. Infect Control Hosp Epk demiol. 1991;12:356-363. 8. Goldwater PN, Martin AJ, Ryan B, et al. A survey of nosocomial respiratory viral infections in a children's hospital: occult respiratory infections in patients
admitted during an epidemic season. Infect Control Hosp Epidemiol. 1991;12:231-238. 9. Skakni L, Sardet A, Just J, et al. Detection of Mycoplasmapneumoniae in clinical samples from pediatric patients by polymerase chain reaction. J Clin Microbiol. 1992;30:2638-2643. 10. Stein A, Raoult D. A simple method for amplification of DNA from paraffinembedded tissues. Nucleic Acids Res. 1992;20:5237-5238. 11. Davis JK, Davidson MK, Schoeb TR, Lindsey JR. Decreased intTapulmonary killing of Mycoplasmapneumonisafter short-term exposure to NO2 is associated with damaged alveolar macrophages. Am Rev RespirDis. 1992;145:406-411. 12. Crouse DT, Cassell GH, Waites KB, et al. Hyperoxia potentiates Ureaplasma ureaiy'dcumpneumonia in newborn mice. Infect/mmun.1990;58:3487-3493. 13. Cassell JH, Clyde WA Jr, Davis JK. Mycoplasmal repiratory infections. In: RF Whitcomb, JG Tully, eds. Mycoplasmas.Mycoplasmalpathogenicity. Vol 4. New York: Academic Press; 1985:65-106. 14. Torres A, Aznar R, Gatell JM, et al. Incidence, risk, and prognosis factors of nosocomial pneumonia in mechanically ventilated patients. Am Rev Respir Dis. 1990;142:523-528.
August 1996 The American Journal of Medicine® Volume 101
169
BACKGROUND:Mycoplasma pneumoniae pneumonia is regarded as a communityacquired pneumonia, rarely requiring hospitalization, with sporadic cases or limited outbreaks occurring after close contacts with an infected patient. Few reports mention M pneumoniae pneumonia acquired during hospitalization. PATIENTSAND METHODS:M pneumoniae was diagnosed in patients who developed pneumonia following perioperative and postoperative assisted ventilation by the isolation of M pneumoniae from bronchial washing, the detection of M pneumoniae DNA from bronchial washing, and serologic testing for the presence of specific immunoglobulin M (IgM) antibodies. RESULTS: Four patients were diagnosed as having M pneumoniae pneumonia following mechanical ventilation over a ll/2-year period. They were men, older than 50 years, and were hospitalized for vascular surgery. They developed febrile hypoxemia and intersticial pneumonia. Isolation of M pneumoniae and detection of M pneumoniae DNA were positive in 1 case; specific IgM antibodies were present in 4 cases. CONCLUSIONS:These observations allow the description of a new clinical entity and highlight the role of M pneumoniae as an agent of nosocomial infections. This diagnosis should be considered in any patient with precocious postassisted ventilation febrile hypoxemia and diffuse interstitial pneumonia, and empiric treatment protocols may include M pneumoniae in their spectrum. Am J Med. 1996;101:165169.
From the Laboratoirede Bacteriologie(JPC,MD, DR),.Servicede Chirurgie Vasculaire(PP),and Servicede Reanimation(MA,CGA),HOpitatde La Timone,Marseille,France. Thiswork was madepartiallypossiblethanksto ProgrammeHospitalier de RechercheClinique,AssistancePubliquea Marseille,1993. Requestsfor reprintsshouldbe addressedto Pr. DidierRaoult,Laboratoire de Bacteriologie,HSpitalde La Timone,BoulevardJeanMoulin, 13385 MarseilleCedex5, France. ManuscriptsubmittedJuly 7, 1995 and acceptedin revisedform May 9, 1996.
©1996byExcerptaMedica,Inc. Allrightsreserved.
Ycoplasma pneumoniae is a strictly h u m a n athogen causing acute u p p e r and lower respiratory tract infections.~ Other clinical manifestations that have b e e n associated with M pneumoniae include central nervous system infection, myocarditis and pericarditis, myringitis, otitis media, and ery t h e m a multiforme. P n e u m o n i a is one of the m a j o r clinical forms of M pneumoniae infection. It is normally a mild, community-acquired disease although s o m e cases are severe enough to require hospitalization. A recent study '~ reported that 4.9% of 1,300 patients with community-acquired p n e u m o n i a requiring hospitalization had M pneumoniae infection. More than 10% of these patients required assisted ventilation. Admission to an intensive care unit for ventilatory support during the course of severe M pneumoniae p n e u m o n i a has b e e n reported. 3 Transmission by aerosol from close contact with an infected patient results in sporadic cases or limited outbreaks a m o n g school-age children or within families. A s y m p t o m a t i c carriage of M pneumoniae has been reported. ~ A recent study s h o w e d that 4.6% to 13.5% of healthy Scandinavians w e r e positive for the p r e s e n c e of M pneumoniae on throat culture. '~ M pneumoniae was confirmed twice ~'~ and s u s p e c t e d once s as an agent of nosocomial infection, but none of the three reports highlighted this aspect. In this report, we present as a new clinical entity 4 patients with nosocomial M pneumoniae p n e u m o n i a following postoperative assisted ventilation.
PATIENTS AND METHODS P a t i e n t 1. A 53-yearoold man underwent femoral
arte~5~ bypass surgery on D e c e m b e r 2, 1992, under general anesthesia. His medical history included tob a c c o smoking, chronic alcoholism, previous aortobifemoral bypass surgery in 1987, f e m o r o f e m o r a l bypass surgery in 1990, and right p n e u m e c t o m y for lung c a r c i n o m a in 1990. Preoperative PaO2 was 100 m m Hg and PaCO2 35 m m Hg. The patient w a s hospit~]ized in our intensive care unit on D e c e m b e r 5, 1992, with a t e m p e r a t u r e of 38°C and respiratory distress. Leucocyte count was 13.4 × 109/L, PaO2 w a s 73 m m Hg, and PaCO2 w a s 39 m m Hg u n d e r supplemental oxygen. Chest r o e n t o g r a m disclosed extensive opacification of the left lung. Culture of bronchial washing yielded Pseudomonas aeruginosa, and t r e a t m e n t with ceftazidime plus ciprofloxacin
0002-9343/96/$15.00 165 PIIS0002-9343(96)00125-8
NOSOCOMIAL M PNEUMONIAEPNEUMONIA/CASALTA ET AL
TABLE Clinical and Microbiological Findings in 4 Patients with Mycoplasmapneumoniaefollowing Mechanical Ventilation Patient Number 3
Clinical Features
1
2
Age Sex
53 Male Femoral artery bypass 4.5 Yes Yes
53 Male Aorto-femoral artery bypass 5.5 Yes Yes
Femoral bypass 5 No Yes
Interstitial pneumopathy Spiramycin Death Yes Yes Yes
63 Male Coronaryartery bypass 5 Yes Yes Interstitial pneumopathy and atelectasis Amoxicillin-clavulanate Recovery No No Yes
Interstitial pneumopathy Erythromycin Recovery No No Yes
Interstitial pneumoniae Erythromycin Recovery Yes No Yes
42
20
30
30
Type of surgery Duration of surgery (hours) Fever > 38.5 C Hypoxemia
Treatment Outcome Isolation of M pneumoniae Amplification of M pneumoniaeDNA Positive IgM serology Time from onset of interstitial pneumoniae until diagnosis of M. pneumoniae(days)
was started. His clinical status worsened despite appropriate treatment against Aspergillus spp, En-
terococcus fecalis, and Pseudomonas aeruginosa successively recovered from bronchial washings throughout the 2-month course of hospitalization in the intensive care unit. There was no evidence of a new or recurrent lung cancer. A serological and bacteriological diagnosis of M pneumoniae pneumonia was made on December 31, 1992, on the basis of a positive anti-M pneumoniae immunoglobulin M (IgM) serology, an~plification of M pneumoniae DNA, and isolation of M pneumoniae from a bronchial washing ( T a b l e ) . The patient was then treated with sph-amycine adipate, 4.5 million units per day, but died 2 weeks later. Autopsy was not performed. P a t i e n t 2. This 63-year-old man underwent triple coronary bypass surgery on March 26, 1993, under general anesthesia. His medical history included tobacco smoking, non-insulin-dependent diabetes mellitus, and myocardial infarction in 1992. Recent unstable angina pectoris led to coronary angioplasty. Extubation was performed 12 hours postsurgery but a temperature of 38.8°C, respiratory distress with interstitial pneumonia and right basal atelectasis developed on March 27, 1993. The patient was admitted to our intensive care unit on March 29, 1993, and assisted ventilation and empirical treatement with amoxicillin plus clavulanic acid was started. Leucocyte count was 17.3 x 10'/L, PaO.2 67 mm Hg and PaCO~ 47 mm Hg despite assisted ventilation with an FiO.~ of 60% and PEEP of 10 cm H.~O. The patient's clinical status initially worsened, but he eventually recovered and left the intensive care unit on day 20. All bacteriological and virological investigations re166
August1996 The American Journal of Medicine~ Volume 101
4
76 Male
mained negative with the exception of positive IgM serology for M pneumoniae using capture-ELISA on March 30, 1993. Culture and polymerase chain reaction (PCR) amplification of bronchioloalveolar washing remained negative for M pneumoniae (Table). P a t i e n t 3. A 53-year-old man underwent aortobifemoral bypass surgery on April 13, 1993, under general anesthesia. His medical history included tobacco smoking, chronic alcoholism, diabetes mellitus, myocardial infarction in 1974, and moderate renal insufficiency. He developed a fever (temperature 39°C) and hypoxemia at the end of a 5-hour operative time and was adnutted to our intensive care unit. An attempt at extubation failed on April 14, 1993, and the patient remained febrile (39°C) and hypoxemic. Leucocyte count was 16.5 x 10'9/L with 90% polymorphonuclear cells. Empiric treatment with an~oxicillin plus clavulanic acid was started while mechanical ventilation was continued. Chest radiographs remained normal and bronchial washings sterile, and the hypoxemia eventually resolved after the antibiotic treatment was changed to ceftazidime combined with pefloxacin plus metronidazole. A catheter-related coagulase-negative Staphylococcus septicemia was treated with vancomycin plus fusidic acid, but the patient's temperature rose again to 38°C, and bilateral interstitial pneumonia was noted on May 12, 1993. M pneumoniae pneumonia was diagnosed on the basis of seroconversion for M pneumoniae and the presence of specific IgM antibodies, and antibiotic treatment with erythromycin, 2 g per day was started. Two days later he was afebrile, and he eventually recovered. The
NOSOCOMIAL M PNEUMONIAEPNEUMONIA/CASALTA ET AL
results of the investigations are presented in the Table. P a t i e n t 4. A 76-year-old man underwent resection of a femoral aneurism on July 20, 1994, under general anesthesia. His medical history included tobacco smoking, aortobifemoral bypass surgery in 1979, sympathectomy in 1985, myocardial infarction in 1990 with left ventricular failure (ejection fraction of 50%), arterial hypertension, mild restrictive respiratory insufficiency, and renal insufficiency (creatinine, 275 m m o l / L ) . He was admitted to our intensive care unit immediately after surgery. Extubation failed, and assisted ventilation was performed after tracheotomy on July 23, 1994. The patient developed Staphylococcus aureus pneumonia and catheter-related coagulase-negative Staphylococcus septicemia on July 24, 1994. Removal of the catheter and treatment with vancomycin plus fosfomycin resolved both infections but a second pneumonia with left basal lobe atelectasis developed on August 15, 1994. A bronchial washing culture yielded broad-spectrum betalactamase-producing KlebsieUa pneumoniae, and treatment with imipenem plus gentamicin was initiated. Bilateral interstitial pneumonia developed on August 20, 1994. A diagnosis of M pneumoniae pneumonia was confirmed by seroconversion and the presence of specific antibodies using the ELISA technique on August 24, 1994. Erythromycin, 2 g per day was added to the imipenem and gentamicin, and was changed to doxycycline, 200 mg per day, after 48 hours because a cutaneous rash developed. The patient eventually left the intensive care unit.
PCR products were analyzed on a 0.8% agarose gel after ethidium bromide staining.
Serologic Studies The detection of IgM antibodies specific to M p n e u moniae was performed by using the IgM immunocapture method and the commercial Mp Test (Incstar Corporation, Stillwater, Minnesota). Diluted controls (low, medium, high) and serum samples diluted 1:50 in 3% nonfat dry milk were added in triplicate to the wells of a microtiter plate previously coated with antibodies to human IgM, and incubated for 30 minutes at 37°C. After three washes, alkaline phosphatase-labelled M pneumoniae P1 adhesin was added for 30 minutes. Paranitrophenylphosphate was used as substrate, and the optical density (OD) was measured at 405 nm. The mean OD values of IgM medium positive and negative controls were calculated, and the cut-off value was obtained by the following formula: OD-negative serum + OD-positive serum divided by 2. The presence of antibodies was determined by relating the specinlen's OD to the cut-off value: specimen OD equal to or above the cut-off value plus 10% was considered as positive, OD below the cut-off value minus 10% as negative. The sensitivity and the specificity of this test were of 100% when compared with complement fixation test (reference test; D. Raoult, unpubfished data).
RESULTS The clinical and diagnosis characteristics of the 4 patients with M pneumoniae pneumonia are presented in the Table.
Isolation Procedure For isolation of M pneumoniae from bronchial washing, the sample was inoculated onto SP4-medium agar and into SP4-glucose broth (International Mycoplasma SA, Toulon, France) and was incubated for 21 days at 37°C in an anaerobic environment. Colonies of M pneumoniae were detected by color change of the SP4-glucose broth and by microscopic examination of the agar surface for the presence of homogeneous colonies. The identification was then confirmed by DNA anlplification (see below).
Amplification of M pneumoniae DNA Amplification of M pneumoniae DNA in clinical samples and in agar-grown colonies was performed according to Skakni et alY Briefly, DNA was prepared by boiling the sanlple in the presence of 5% Chelex 100 (BioRad, Hercules, California) as previously reported.I° Prepared DNA served as the template for PCR-ampfification using the primers MP51:5' GAAGCTTATGGTACAGGTTGG 3 ' and MP5-2:5' ATTACCATCCTTGTFGTAAGG 3' and the experimental conditions previously reported. 'q The
Isolation of
Mycoplasma pneumoniae
M pneumoniae was isolated from the bronchial washing of patient n u m b e r 1, but not from the bronchial washing of patient 2. No sample was cultured for the p r e s e n c e of M pneumoniae for patients 3 and 4. Amplification of
Mycoplasma pneumoniae D N A
Mpneumoniae DNA was amplified from the bronchial washing obtained from patient 1, but not from patient 2. No sample for DNA amplification was available for patients 3 and 4. Serology of
Mycoplasma pneumoniae
Imnmnoglobulin M antibodies specific for Mpneumoniae were detected in the serum of each patient using the capture-ELISA technique. Three serum samples were obtained 29 days, 34 days, and 40 days after surgery in patient 1: Breakpoint OD was 0.352 and sample ODs were 0.538, 0.358, and 0.368, respectively; and the three samples tested positive. Two serum samples were obtained 20 days and 30 August 1996 The American Journal of Medicine~ Volume 101
167
NOSOCOMIAL M PNEUMONIAE PNEUMONIA/CASALTA ET AL
days after surgery in patient 2: Breakpoint OD was 0.421 and sanlple OD was 0.959 for sample 1; and breakpoint OD was 0.296 and sample OD was 0.867 for sample 2. Three s e r u m samples were obtained 3 days, 30 days, and 37 days after surgery in patient 3: Breakpoint OD was 0.312, and sample ODs of, respectively, 0.275, >2, and 1.8 showed seroconversion. Two serum sanaples were obtained 20 days and 35 days after surgery for patient 4: Breakpoint OD of 0.340 and sample ODs of 0.310 and >2, respectively, showed a seroconversion.
COMMENTS Mycoplasma pneumoniae infections are primarily regarded as community-acquired infections. ~ Three reports, however, mention the occurrence of M pneumoniae p n e u m o n i a as a nosocolnial infection. On the basis of positive results of conmlercial DNA/ RNA hybridization tests on throat swabs, an outb r e a k of M pneumoniae infections including pneumonia and mild u p p e r respiratory tract diseases was traced to an orderly anaong the staff of an e m e r g e n c y d e p a r t m e n t in F i n i a n d . 6 One case of nosocomial M pneumoniae p n e u m o n i a has been reported on the basis of positive IgM serology in an adult, 7 and possible nosocomial infections have been reported a m o n g 3 pediatric patients, s Those reports, however, did not emphasize the concept ofMycoplasma pneumoniae as an agent of nosocomial infections. In this paper, we present 4 patients w h o developed nosocomial M pneumoniae p n e u m o n i a after postoperative assisted ventilation. The diagnosis was confirmed by the direct demonstration of the pathogen (culture plus genomic anlplification) and serology in 1 case and by serology alone in 3 cases, ineluding seroconversion in 2 patients. The specificity of this serologic test is 100%, and 50 patients prospectively tested in our intensive care unit were negative. This test is indicative of a recent infection. The 4 patients were not likely to have acquired M pneumoniae from an infected person during the hospitalization. Indeed, they were diagnosed over a 18month period, they were operated on by three different surgeons from two different teams, in two different operating rooms, and there was no k n o w n outbreak of M pneumoniae infection in our hospital during this time. The patients had no respiratory s y m p t o m s prior to admission to the hospital. Therefore, M pneumoniae p n e u m o n i a in these 4 patients was more likely to be endogenous. Reactivation of m y c o p l a s m a l infection has never been reported, but a s y m p t o m a t i c throat carriage of M pnvumoniae has been d o c u m e n t e d 4'5 and a 50% infectious dose as low as one colony-forming unit was d e m o n s t r a t e d after aerosol challenge in h u m a n volunteers.~ Also, experimental exposure to oxidants has b e e n s h o w n to de168
August1996 The American Journal of Medicine® Volume 101
crease intrapulmonary killing of Mpneumonis 1~and to potentiate Ureaplasma urealyticum p n e u m o n i a in mice. ~2 We therefore hypothesized that M pneumoniae was present in the throat of the 4 patients at the time of admission and that perioperative and postoperative mechanical ventilation inoculated the bacteria into the lower respiratory tract of these patients. All 4 patients were m e n older than 50 years who developed M pneumoniae p n e u m o n i a after they underwent vascular surgery, either femoral artery (3 patients) or coronary artery surgery (1 patient). Nine percent of patients in our intensive care unit are admitted after such surgery ( P <0.001; relative risk of 11.08). The 4 patients developed febrile hyp o x e m i a and diffuse interstitial p n e u m o n i a within the first 3 days of mechanical ventilation (3 patients), complicated by atelectasis (2 patients). Diagnosis relied upon the demonstration of seroconversion (2 patients), the p r e s e n c e of specific IgM antibodies (4 patients), and direct diagnosis by culture and PCR amplification of M pneumoniae in a bronchial washing (1 patient). This infection resulted in death for 1 patient. The relative c o n t r i b u t i o n of M pneumoniae infection to the clinical c o u r s e of t h e s e p a t i e n t s is not unique, since o t h e r n o s o c o m i a l b a c t e r i a w e r e g r o w n in the b r o n c h i a l w a s h i n g s at the time M pneumoniae infection w a s d o c u m e n t e d in 3 of the 4 patients, and M pneumoniae m a y be a c o f a c t o r in the c o n s t i t u t i o n of p n e u m o n i a in t h e s e patients. Many n a t u r a l l y - o c c u r r i n g r e s p i r a t o r y d i s e a s e s in a n i m a l s are c h a r a c t e r i z e d by initial colonization of the l o w e r r e s p i r a t o r y t r a c t by m y c o p l a s m a foll o w e d by o t h e r pathogens.~:3 N o s o c o m i a l p n e u m o nia d e v e l o p s in 20% to 25% of p a t i e n t s requiring a s s i s t e d ventilation. In the s t u d y by T o r r e s et al~4 of 78 e p i s o d e s of n o s o c o m i a l p n e u m o n i a in 322 patients requiring m e c h a n i c a l ventilation, 42 (53%) w e r e of u n k n o w n etiology. Mycoplasma pneumoniae m a y explain s o m e of the n o s o c o m i a l pneum o n i a s of u n k n o w n etiology and m a y be considered in the differential diagnosis of s u c h patients. We h a v e b e g u n a p r o s p e c t i v e s t u d y to a s s e s s the role of M pneumoniae as an etiological a g e n t of n o s o c o m i a l p n e u m o n i a in p a t i e n t s with m e c h a n i cal ventilation.
ACKNOWLEDGMENTS The authors are indebted to T. J. Marrie for expert review of the manuscript.
REFERENCES 1. Baurn SG. Mycoplasmapneumoniaeand atypical pneumonia. In: Mandell GL, Bennett JE, Dolin R, eds. Mandell, Douglasand Bennett's Principlesand Practice of Infectious Diseases. 4th ed. New York: Churchill Livingstone, 1995;17041713.
NOSOCOMIAL M PNEUMONIAE PNEUMONIA/CASALTA ET AL
2. Marrie TJ. Mycoplasma pneumoniae pneumonia requiring hospitalization, with emphasis on infection in the elderly. Arch InternMed. 1993;153:488-494. 3. Potgieter PD, Hammond JMJ. Etiology and diagnosis of pneumonia requiring ICU admission. Chest. 1992;101:199-203. 4. Williams WC, Williamson HA Jr, LeFevre ML. The prevalence of Mycoplasma pneumoniae in ambulatory patients with nonstreptococcal sore throat. Faro Med. 1991;23:117-121. 5. Gnarpe J, Lundback A, Sundelof B, Gnarpe H. Prevalence of Mycoplasma pneumoniae in subjectively healthy individuals. Scand J Infect Dis. 1992;24:161-164. 6. Kleemola M, Jokinen C. Outbreak of Mycoplasma pneumoniae infection among hospital personnel studied by a nucleic acid hybridization test. J Hosp Infect. 1992;21:213-221. 7. Louie M, Dyck B, Parker S, et al. Nosocomial pneumonia in a Canadian tertiary care center: a prospective surveillance study. Infect Control Hosp Epk demiol. 1991;12:356-363. 8. Goldwater PN, Martin AJ, Ryan B, et al. A survey of nosocomial respiratory viral infections in a children's hospital: occult respiratory infections in patients
admitted during an epidemic season. Infect Control Hosp Epidemiol. 1991;12:231-238. 9. Skakni L, Sardet A, Just J, et al. Detection of Mycoplasmapneumoniae in clinical samples from pediatric patients by polymerase chain reaction. J Clin Microbiol. 1992;30:2638-2643. 10. Stein A, Raoult D. A simple method for amplification of DNA from paraffinembedded tissues. Nucleic Acids Res. 1992;20:5237-5238. 11. Davis JK, Davidson MK, Schoeb TR, Lindsey JR. Decreased intTapulmonary killing of Mycoplasmapneumonisafter short-term exposure to NO2 is associated with damaged alveolar macrophages. Am Rev RespirDis. 1992;145:406-411. 12. Crouse DT, Cassell GH, Waites KB, et al. Hyperoxia potentiates Ureaplasma ureaiy'dcumpneumonia in newborn mice. Infect/mmun.1990;58:3487-3493. 13. Cassell JH, Clyde WA Jr, Davis JK. Mycoplasmal repiratory infections. In: RF Whitcomb, JG Tully, eds. Mycoplasmas.Mycoplasmalpathogenicity. Vol 4. New York: Academic Press; 1985:65-106. 14. Torres A, Aznar R, Gatell JM, et al. Incidence, risk, and prognosis factors of nosocomial pneumonia in mechanically ventilated patients. Am Rev Respir Dis. 1990;142:523-528.
August 1996 The American Journal of Medicine® Volume 101
169