N-acetylcysteine improves the growth performance and intestinal function in the heat-stressed broilers

Animal Feed Science and Technology 220 (2016) 83–92

Contents lists available at ScienceDirect

Animal Feed Science and Technology journal homepage: www.elsevier.com/locate/anifeedsci

N-acetylcysteine improves the growth performance and intestinal function in the heat-stressed broilers Dan Yi a , Yongqing Hou a , Linglin Tan a , Man Liao a , Jiaqian Xie a , Lei Wang a , Binying Ding a,∗ , Ying Yang b , Joshua Gong a,c a Hubei Key Laboratory of Animal Nutrition and Feed Science, Hubei Collaborative Innovation Center for Animal Nutrition and Feed Safety, Wuhan Polytechnic University, Wuhan 430023, China b State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing, 100193, China c Guelph Research and Development Centre, Agriculture and Agri-Food Canada, Guelph, Ontario, N1G 5C9, Canada

a r t i c l e

i n f o

Article history: Received 29 April 2016 Received in revised form 26 July 2016 Accepted 28 July 2016 Keywords: N-acetylcysteine Intestinal function Broiler Heat stress

a b s t r a c t This study was carried out to investigate the effects of N-acetylcysteine (NAC) on growth performance and intestinal function of heat-stressed broilers. A total of two hundred 1d-old Cobb male chicks were allocated to 1 of 4 treatments, with 5 replicated pens per treatment and 10 birds per pen. The experiment consisted of 4 treatments in a 2 × 2 factorial arrangements with two diets (basal diet or 1 g/kg NAC diet) and two temperatures (thermoneutral or heat stress). From day 8–35 of age, broilers were raised at thermoneutral (26 ± 1 ◦ C) or exposed to cyclic heat stress (36 ± 1 ◦ C from 0800 to 1800 and 26 ± 1 ◦ C from 1800 to 0800). The results showed that heat stress reduced ADFI, ADG, plasma concentrations of triiodothyronine (T3 ) and thyroxine (T4 ), intestinal villus height (VH), ratio of VH to crypt depth (CD), intestinal mucosal ATP level, adenylate energy charge (AEC), activities of alkaline phosphatase (AKP), antioxidative and digestive enzymes, and mRNA level for Bcl2, whereas increased the feed/gain, mortality rate, plasma corticosterone level, intestinal CD, intestinal mucosal AMP and malondialdehyde (MDA) levels, and mRNA levels of heat shock protein (HSP70), caspase-3, AMP-activated protein kinase (AMPK), heme-oxigenase (HMOX), and xanthine oxidoreductase (XOR). Dietary supplementation with NAC decreased the feed/gain, mortality rate, plasma corticosterone level, MDA concentration and intestinal mucosal mRNA levels of HSP70, AMPK and HMOX, while elevated the ratio of VH to CD, ATP, catalase (CAT) and trypsine activity in the small intestine of heat-stressed broilers. Taken together, these results suggest that dietary supplementation of 1 g/kg NAC could improve growth performance and intestinal function of broilers exposed to heat stress. © 2016 Elsevier B.V. All rights reserved.

Abbreviations: ADFI, average daily feed intake; ADG, average daily gain; ADP, adenosine diphosphate; AEC, adenylate energy charge; AKP, activities of alkaline phosphatase; AMP, adenosine monophosphate; AMPK, AMP-activated protein kinase; ATP, adenosine triphosphate; CAT, catalase; CD, crypt depth; HMOX, heme-oxigenase; HSP70, heat shock protein; MDA, malondialdehyde; NAC, N-acetylcysteine; T3 , triiodothyronine; T4 , thyroxine; TAN, total adenine nucleotide; VH, intestinal villus height; XOR, xanthine oxidoreductase. ∗ Corresponding author. Hubei Key Laboratory of Animal Nutrition and Feed Science, Wuhan Polytechnic University, Wuhan 430023, China. E-mail address: [email protected] (B. Ding). http://dx.doi.org/10.1016/j.anifeedsci.2016.07.014 0377-8401/© 2016 Elsevier B.V. All rights reserved.

84

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

1. Introduction Animal farming, particular poultry production, is facing the challenge of global warming. Hyperpyrexia condition causes high mortality and growth depression of poultry and consequently results in huge economic losses (Loyau et al., 2015). Due to lack of sweat glands, birds under thermal stress spend less time feeding, more time drinking and panting, as well as more time flapping wings, less time moving or walking, and more time resting for dissipating heat (Lara and Rostagno, 2013). In addition, the physiological and metabolic responses such as modifications of blood parameters, plasma hormone concentrations, oxidative stress and meat acidity were also reported in poultry challenged with high temperature (Loyau et al., 2015). Specifically, heat stress can induce intestinal dysfunction showing the impaired intestinal morphology (Mitchell and Carlisle, 1992; Lambert et al., 2002), increased intestinal permeability (Quinteiro-Filho et al., 2010; AI-Fataftah and Abdelqader, 2014), decreased absorptive function (Ruan and Niu, 2001), and enhanced oxidative and immune injury (Bouchama and Knochel, 2002; AI-Fataftah and Abdelqader 2014). To date, in addition to temperature-reducing equipments, nutritional manipulation techniques, such as increasing diet nutrient concentration, maintaining amino acids balance and dietary electrolyte balance (Ahmad et al., 2008), and supplementing vitamin C, selenium, chromium (Rao et al., 2016), betaine (Sayed and Downing, 2011), probiotics (AI-Fataftah and Abdelqader, 2014), or plant extract (Song et al., 2013, 2014), are increasingly developed and used in poultry to enhance their capacity against high temperature environment. Based on our previous studies on N-acetylcysteine (NAC) (Hou et al., 2012, 2013; Yi et al., 2014, 2016a), we suppose that NAC may exert beneficial effects on growth performance and capacity against heat stress of broilers. NAC is a precursor of l-cysteine, and can be rapidly metabolized by the small intestine to produce reduced glutathione (GSH) (Wu et al., 2004). Indeed, NAC can not be detected in animals without supplementation. By providing sulfhydryl groups, NAC was reported to play critical roles in the rodents and pigs, including detoxification and protecting cells and cellular components against oxidative stress (Wu et al., 2004). Our previous study also showed that dietary NAC could increase average daily gain and attenuate the intestinal injury in piglets induced by lipopolysaccharide (Hou et al., 2012, 2013). However, up to now, there is only one study by Valdivia et al. (2001) on the application of NAC in poultry production. They found that NAC attenuated negative effects on growth performance, liver function, and biochemical parameters induced by aflatoxin B1 in broiler chickens (Valdivia et al., 2001). In order to clarify the efficacy of NAC application in poultry production, further study are warranted to investigate the effects of NAC on growth performance and intestine function of broilers under heat stress.

2. Material and methods 2.1. Birds, diets, and experimental design The animal protocol used in the present study was approved by the Animal Care and Use Committee of Hubei Province, China. Two hundred healthy one-day-old male Cobb chicks (46.2 ± 0.4 g; from a commercial source) were housed in stainlesssteel cages in a temperature-controlled room with relative humidity of 60% and a 24-h photoperiod (Li et al., 2015). The experiment consisted of 4 treatment groups in a 2 × 2 factorial arrangements with two diets (basal diet or 1 g/kg NAC diet) and two temperatures (thermoneutral or heat stress). Birds were randomly divided into 4 treatment groups, each of which included 5 replicates with 10 broiler chickens per replicate. The thermoneutral and heat treatment were divided into separate rooms (Song et al., 2014). The basal diet was a maize- and soybean meal-based diet (Table 1) and was formulated to meet National Research Council (NRC, 1994)-recommended requirements for all nutrients, whereas NAC diet was prepared by basal diet supplemented with 1 g/kg NAC (Cat. A7250, Sigma Chemical, Inc.). Hou et al. (2012) reported that 0.5 g/kg NAC in diet (about 20 mg/kg BW, daily) improved the intestinal function of lipopolysaccharide-challenged piglets. Given the depression of feed intake caused by heat stress in broilers, we increased the NAC level (1 g/kg, about 60 mg/kg BW, daily) in diet to ensure that adequate NAC can be absorbed by chicks. In addition, Valdivia et al. (2001) reported that the high level of NAC (800 mg/kg BW, daily) in diet was safe and did not change the production parameters of broilers. For preparation of NAC diet, NAC and other minor ingredients (sodium chloride, lysine, methionine, and vitamin-mineral premix) were accurately weighted and then hand-mixed (Teo and Tan, 2007). The mixture were then divided into 4 portions and blended in a small mixer with soybean meal using the quartering technique (AI-Fataftah and Abdelqader, 2014). Finally, the resulting mixture was added to the basal diet and mixed for 5 min. Because the supplementation of 1 g/kg NAC resulted in only an increase of 0.0084% nitrogen, we deemed it not necessary to use a non-essential amino acid as an isonitrogenous control. The dietary contents of crude protein and total phosphorus were determined according to the Weende method of the feed proximate analysis as described by Henneberg and Stohmann, (1864). The levels of methionione, cystine, lysine, threonine, and tryptophan in the basal diet were determined by automatic amino acids analyser (S433D, Sykam GmbH, Eresing, Germany). All chicks were given ad libitum access to feed and water. From day 1–7 of age, all chicks were raised at 32 ± 1 ◦ C. However, from day 8–35 of age, two groups, including one basal diet group and one NAC-diet group, were exposed to 36 ± 1 ◦ C (from 0800 to 1800) and 26 ± 1 ◦ C (from 1800 to 0800) as cyclic heat stress groups. The other two groups (one basal diet group and one NAC-diet group) were raised at 30 ± 1 ◦ C (from day 8–14 of age) and 26 ± 1 ◦ C (from day 15–35 of age) as thermoneutral groups. Average daily gain (ADG), average daily feed intake (ADFI), and feed to gain ratio were calculated. Mortality was recorded by daily visual observation.

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

85

Table 1 Ingredients and chemical composition of the basal diet (air-dried basis). Item Ingredients (g/kg) Maize Soybean meal (440 g/kg CP) Corn gluten meal (600 g/kg CP) Soybean oil Dicalcium phosphate Limestone Sodium chloride L-Lysine hydrochloride DL-Methionine Vitamin-mineral Premixa Nutritional Composition Metabolizable energy (MJ/kg)b Crude protein (g/kg)c Methionine (g/kg)c Methionine + Cysteine (g/kg)c Lysine (g/kg)c Threonine (g/kg)c Tryptophan (g/kg)c Calcium (g/kg)b Total phosphorus (g/kg) c Non-phytate phosphorus (g/kg)b

1–3 wk

4–5 wk

593 287 50.0 19.4 18.8 11.9 3.6 3.7 2.6 10.0

621 253 50.0 29.9 17.9 11.7 3.1 2.1 1.3 10.0

12.33 205 5.9 9.2 12.0 7.9 2.3 10.0 6.8 4.7

12.75 190 4.4 7.6 10.0 7.3 2.1 9.5 6.5 4.5

a Supplied per kg diet: Mn 75 mg, Zn 40 mg, Fe 80 mg, Cu 10 mg, iodine 0.3 mg, selenium 0.2 mg, retinol acetate 24 mg, DL-␣-tocopheryl acetate 20 mg, cholecalciferol 0.034 mg, menadione 1 mg, thiamine 1.1 mg, riboflavin 3 mg, folic acid 1.2 mg, calcium pantothenate 5.5 mg, nicotinamide 30 mg, pyridoxine 2 mg, cobalamin 0.015 mg, biotin 0.2 mg, choline chloride 900 mg. b Calculated value. c Analysed value.

2.2. Sample collection On day 36 of age, 10 broilers per group (2 per replicate) were randomly selected and blood was drawn from left wing vein after 8-h of feed deprivation. Whole blood was used to collect the serum for triiodothyronine (T3 ), thyroxine (T4 ), and corticosterone assays. After sampling of blood, birds were euthanized and their abdomens were opened immediately. The small intestine was dissected and placed on a chilled stainless steel tray. The 3- and 5-cm segments were cut at midjejunum. The 3-cm segments were gently flushed with cold physiological saline, and then fixed in 4% paraformaldehyde over night at 4 ◦ C for histological examination (Li et al., 2015). The digesta of 5-cm segments were removed in 10 mL tubes for measurements of digestive enzymes, and the segments were further opened longitudinally and flushed the residual digesta with cold physiological saline for collecting mucosa. Jejunal mucosa were collected by scraping with a sterile glass microscope slide, rapidly frozen in liquid nitrogen, and then stored at −80 ◦ C until analysis. All samples were collected within 10 min after killing of the animals (Li et al., 2015).

2.3. Serum hormones determination Serum T3 (Cat. T140510), T4 (Cat. T140511), and corticosterone (Cat. T140513) levels were determined by commercially available 125 I RIA kits (Beijing North Institute of Biological Technology, Beijing, China). The detection limit for corticosterone was 2.5 ng/ml, and the coefficients of variation (CV) for intra- and inter-assays were less than 10% and 15%, respectively. The detection limits for T3 and T4 analyses were 0.1 ng/ml and 5 ng/ml, respectively. The coefficients of variation for intra- and inter-assays were less than 15% and 10% for T3 , and less than 15% and 10% for T4 , respectively.

2.4. Intestinal morphology The 3-cm jejunal samples were dehydrated and embedded in paraffin, and then sectioned into 4-␮m slices, which were then stained with hematoxylin and eosin. Jejunal morphology was examined using a light microscope with a computerassisted morphometric system (BioScan Optimetric, BioScan Inc., Edmonds, WA, USA.). The villus height (VH) was measured from the villus tip to the valley between individual villus. The crypt depth (CD) was measured from the valley between individual villus to the basolateral membrane. The 10 longest and straightest villi and associated crypts were measured from each segment (Xu et al., 2003; Li et al., 2015).

86

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

2.5. Jejunal energy status Concentrations of ATP, ADP, and AMP in jejunal mucosal samples were analysed by HPLC according to our previous study (Yi et al., 2014). Briefly, frozen mucosal samples (0.1 ∼ 0.2 g) were homogenized with cold perchloric acid and centrifuged. The supernatant (1 mL) was then neutralised with potassium carbonate on ice, and the solution was centrifuged to collect the supernatant, which was stored at −80 ◦ C until analysis. The chromatographic system consisted of the Waters Breeze HPLC system (Waters Corporation, Milford, MA, USA), including 1525 binary HPLC pumps, a 2487 Dual-␭ Absorbance Detector, a 717 plus autosampler and Breeze system software, and a chromatographic column (Waters XBridge C18; 5 ␮m, 4.6 mm × 150 mm). The mobile phase (50 mM-K2 HPO4 -KH2 PO4 buffer solution and methanol; 77: 23, v/v; pH 7.0) was filtered through a 0.45 ␮m filter membrane and degassed 15 min before use. The detection wavelength was 260 nm, the column temperature was 35 ◦ C and the pump flow rate was 1.0 mL/min. The frozen sample was filtered through a 0.20 ␮m filter membrane after being thawed at 22 ◦ C, and the injection volume was 20 ␮L. Peaks were identified by their retention times using authentic standards (Sigma Chemical, Inc.). Total adenine nucleotide (TAN) and adenylate energy charges (AEC) were calculated according to the following equation (Yi et al., 2014; Li et al., 2015). TAN = ATP + ADP + AMP, while AEC = (ATP + 0.5 ADP)/(ATP + ADP + AMP).

2.6. Jejunal oxidative and antioxidative parameters Frozen mucosal samples (∼0.1 g) were powdered under liquid nitrogen, homogenized with cold physiological saline, and then centrifuged to collect the supernatant for analysis. The concentrations of malondialdehyde (MDA, Cat. A003-1) and hydrogen peroxide (H2 O2 , Cat. A064-1) and the activities of catalase (CAT, Cat. A007-1), glutathione peroxidase (GSH-Px, Cat. A005), and superoxidase (SOD, Cat. A001-1) were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) following the instructions of the manufacturer. Total protein concentrations were determined using the Coomassie Brilliant Blue G-250 reagent with BSA as a standard.

2.7. Jejunal alkaline phosphatase (AKP) and digestive enzyme activity The activity of AKP was determined according to the assay kit’s instructions, obtained from Nanjing Jiancheng Bioengineering Institute (Cat. A059-1, Nanjing, China) (Hao et al., 2012). For determination of mucosa AKP activity, mucosal samples were diluted with saline and homogenized. The homogenate was then centrifuged to collect the supernatants for AKP determination. One unit of AKP activity was defined as the production of 1 mg of nitrophenol per gram of jejunal mucosal protein (Hao et al., 2012). For determination of trypsine and lipase, jejunal digesta was homogenized with saline and centrifuged to collect the supernatant. Lipase (Cat. A080-2) and trypsine (Cat. A054) activities in jejunal digesta were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) (Hu and Guo, 2008).

2.8. Jejunal mRNA levels for genes associated with intestinal growth, oxidation and energy metabolism A qRT-PCR method was used to determine the mRNA level for genes including B-cell lymphoma-2 (Bcl-2), caspase-3, AMP-activated protein kinase (AMPK), adenine nucleotide translocator (ANT), peroxisome proliferator-activated receptor ␥ coactivator-1␣ (PGC-1␣), cytochrome oxidase III (COXIII), heat shock protein (HSP70), hypoxia-inducible factor 1, subunit alpha (HIF-1␣), heme-oxigenase (HMOX), and xanthine oxidoreductase (XOR). Total RNA of mucosal samples was extracted and purified with the TRIzol Reagent (Invitrogen, Carlsbad, CA) according to our previous studies (Yi et al., 2016b). Total RNA was quantified using the NanoDrop® ND-2000 UV–vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA) at an OD of 260 nm. The purity of RNA was assessed by determining OD260/OD280 ratios. All of the samples had an OD260/OD280 ratio above 1.8, corresponding to 90–100% pure nucleic acids. Meanwhile, RNA integrity in each sample was determined using 1% denatured agarose gel electrophoresis. RNA was used for RT-PCR analysis when it had a 28 S/18 S rRNA ratio ≥1.8 (Hou et al., 2013). Total RNA was reverse-transcribed using a PrimeScript® RT reagent kit (Cat. DRR047A) with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instruction. cDNA was synthesized and stored at −20 ◦ C until use. To amplify cDNA fragments, primer pairs (Table 2) were used for RT-PCR. To minimise amplification of potentially contaminating genomic DNA, the primers were designed to span introns and intron-exon boundaries. The RT-PCR was performed using the SYBR® Premix Ex TaqTM (Cat. RR420A, Takara, Dalian, China) on an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA). The specificity of the RT-PCR reactions was assessed by analyzing the melting curves of the products and size verification of the amplicons (Meurens et al., 2009). The delta delta cycle threshold (CT ) method was used to analyse the relative expression of the target gene (Fu et al., 2010). To ensure the sensitivity and accuracy of the results obtained by RT-PCR, data were normalised geometrically averaging of two internal reference genes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hypoxanthine phosphoribosyltransferase 1 (HPRT1) (Nygard et al., 2007; Ojano-Dirain et al., 2007).

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

87

Table 2 Sequences of the primers used for quantitative PCR analysis. Genes

Forward

Reverse

References

HSP70 Bcl-2 Caspase-3 AMPK␣1 ANT PGC-1␣ COXIII HIF-1␣ HMOX XOR GAPDH HPRT1

AGCGTAACACCACCATTCC GATGACCGAGTACCTGAACC GGAACACGCCAGGAAACTTG AAGGTTGGCAAGCATGAGTT TGTGGCTGGTGTGGTTTCCTA CCAAAGGACACGCTCTAGATCA AGGATTCATTTTCACAGCCCTACAAG CACCATTACCATACTTCAGCAG CTTGGCACAAGGAGTGTTAAC GTGTCGGTGTACAGGATACAGAC TGAAAGTCGGAGTCAACGGATT CGTTGCTGTCTCTACTTAAGCAG

TGGCTCCCACCCTATCTC CAGGAGAAATCGAACAAAGGC TCTGCCACTCTGCGATTTACA TTCTGGGCCTGCATATAACC GCGTCCTGACTGCATCATCA TCTCGATCGGGAATATGGAGAA AGACGCTGTCAGCGATTGAGA CTTCACATCATCCACACGTTC CATCCTGCTTGTCCTCTCAC CCTTACTATGACAGCATCCAGTG CCACTTGGACTTTGCCAGAGA GATATCCCACACTTCGAGGAG

Yu and Bao, 2008 Huang et al., 2013 Sporer et al., 2011 Proszkowiec-Weglarz et al., 2006 Ojano-Dirain et al., 2007 Ojano-Dirain et al., 2007 Ojano-Dirain et al., 2007 Osselaere et al., 2013 Osselaere et al., 2013 Osselaere et al., 2013 Ojano-Dirain et al., 2007 Osselaere et al., 2013

HSP70: heat shock protein 70; Bcl-2: B-cell lymphoma-2; AMPK: AMP-activated protein kinase; ANT: adenine nucleotide translocator; PGC-1␣: peroxisome proliferator-activated receptor ␥ coactivator-1␣; COXIII: cytochrome oxidase III; HIF-1␣: hypoxia-inducible factor 1, subunit alpha; HMOX: heme-oxigenase; XOR: xanthine oxidoreductase; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; HPRT1: hypoxanthine phosphoribosyltransferase 1. Table 3 Effects of NAC on growth performance of broilers (from day 1–35 of the age). Thermoneutral

ADFI (g/d) ADG (g/d) Feed/gain

Heat stress

SEM

Basal diet

NAC

Basal diet

NAC

63.6 37.0 1.72b

69.7 40.1 1.74b

45.0 24.6 1.83a

47.4 26.8 1.76b

2.56 1.62 0.013

P-value Temperature

Diet

Interaction

<0.001 <0.001 0.013

0.043 0.053 0.126

0.354 0.747 0.014

a,b means with different letters in the same row differ significantly at P < 0.05. ADFI: average daily feed intake; ADG: average daily gain.

2.9. Statistical analysis Results were expressed as mean values with pooled SEM. The data were analysed using the General Linear Model procedure in SPSS17.0 (SPSS Inc., Chicago, IL, USA) in a 2 × 2 factorial arrangement with diet and temperature as the main effects. Mortality data were subjected to arcsine square root transformation before analysis (Loetscher et al., 2013). The differences among treatments were evaluated by the least significant difference Bonferroni’s multiple comparisons test. Probability values ≤0.05 were taken to indicate significance. 3. Results 3.1. Effect of NAC on the growth performance of broilers The growth performance of broilers was summarised in Table 3. Broilers exposed to the heat stress had lower (P < 0.05) ADFI and ADG than broilers under thermoneutral condition. NAC supplementation increased the ADFI (P < 0.05) and ADG (P = 0.053) of broilers in comparison with the basal diet group. Moreover, a significant temperature × diet interaction was observed in feed/gain (Table 3), showing that broilers exposed to heat stress and fed with NAC diet exhibited lower (P < 0.05) feed/gain than those fed the basal diet and exposed to the same heat stress condition. Additionally, under the thermoneutral condition, NAC supplementation did not affect the broilers mortality rate (4% vs. 4%). However, under heat stress, broilers receiving NAC diet exhibited lower mortality rate than those receiving basal diet from the day 1–35 of the age (6% vs. 12%). 3.2. Effect of NAC on the serum hormones of broilers As shown in Table 4, serum concentration of corticosterone was elevated (P < 0.05), while levels of T3 and T4 were decreased (P < 0.05) in broilers under heat stress than broilers under thermoneutral condition. Supplementation of NAC had no effects on the levels of T3 and T4 in broilers compared with the basal diet group. However, broilers fed with NAC diet exhibited lower (P < 0.05) concentration of corticosterone than broilers fed with the basal diet. 3.3. Effect of NAC on the jejunal intestinal morphology of broilers The data of jejunal morphology of broilers were presented in Table 4. Heat stress induced a reduction (P < 0.05) in the ratio of VH to CD and an increase in jejunal crypt depth of broilers in comparison with the thermoneutral group. However, dietary supplementation of NAC increased (P < 0.05) the ratio of VH to CD in broilers than those in the basal diet group. Additionally,

88

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

Table 4 Effects of NAC on serum hormone and jejunal morphology and digestive enzyme activity in broilers. Thermoneutral

Serum hormone T3 (ng/ml) T4 (ng/ml) Corticosterone (ng/ml) Jejunal morphology Villus height (␮m) Crypt depth (␮m) VH/CD Jejunal digestive enzyme AKP (U/g prot) Lipase (U/g prot) Trypsine (U/g prot)

Heat stress

SEM

Basal diet

NAC

Basal diet

NAC

1.33 35.7 18.1

1.47 35.6 16.3

0.50 21.6 28.7

0.51 25.5 20.8

947a 194 4.77

880a 181 5.02

687b 221 3.03

172 4.13 4.20

166 4.00 4.48

126 2.96 2.05

P-value Temperature

Diet

Interaction

0.09 1.49 1.31

<0.001 <0.001 0.001

0.293 0.239 0.017

0.359 0.219 0.114

790ab 210 3.83

28.01 6.49 0.18

<0.001 0.031 <0.001

0.696 0.353 0.038

0.074 0.930 0.250

146 3.32 3.05

5.66 0.15 0.22

0.001 0.001 <0.001

0.271 0.642 0.032

0.103 0.349 0.214

Temperature

Diet

Interaction

a,b means with different letters in the same row differ significantly at P < 0.05. T3 : triiodothyronine; T4 : thyroxine; VH: villus heigh; CD: crypt depth; AKP: alkaline phosphatase.

Table 5 Effects of NAC on jejunal energy status and oxidation and antioxidation related parameters in broilers. Thermoneutral Basal diet

Heat stress NAC

Energy status 47.0 53.6 ATP (␮g/g) ADP (␮g/g) 118 121 157b 181ab AMP (␮g/g) TAN (␮g/g) 325 362 AEC 0.34 0.33 Oxidation and antioxidation related parameters CAT (U/mg prot) 1.52 1.91 89.0 85.7 SOD (U/mg prot) GSH-Px (U/mg prot) 8.18 8.14 0.68b 0.73b MDA (nmol/mg prot) H2 O2 (mmol/g prot) 10.67 8.72

SEM

P-value

Basal diet

NAC

37.6 115 205a 344 0.28

44.0 136 180ab 366 0.30

1.74 3.71 5.82 9.72 0.008

0.005 0.390 0.033 0.746 0.023

0.029 0.105 0.969 0.084 0.715

0.858 0.214 0.032 0.872 0.876

1.07 74.6 6.42 1.06a 10.03

1.40 80.6 7.28 0.81ab 9.49

0.08 1.95 0.28 0.04 0.37

0.001 0.011 0.018 0.002 0.933

0.008 0.698 0.435 0.149 0.100

0.828 0.208 0.401 0.029 0.344

a,b means with different letters in the same row differ significantly at P < 0.05. ATP: adenosine triphosphate; ADP: adenosine diphosphate; AMP: adenosine monophosphate; TAN: total adenine nucleotide; AEC: adenylate energy charges; CAT: catalase; SOD: superoxidase; GSH-Px: glutathione peroxidase; MDA: malonaldehyde; H2 O2 : hydrogen peroxide. TAN = ATP + ADP + AMP, AEC = (ATP + 0.5 ADP)/(ATP + ADP + AMP)

there was a significant trend (P = 0.074) of temperature × diet interaction in villus height, indicating that supplementation of NAC mitigated the decrease of jejunal villus height in heat-stressed broilers.

3.4. Effect of NAC on the energy status in the jejunal mucosa of broilers The energy status in the jejunal mucosa of broilers was shown in Table 5. Heat stress decreased (P < 0.05) the concentrations of ATP and AEC, while increased (P < 0.05) the level of AMP in the jejunal mucosa of broilers compared with broilers in the thermoneutral group. However, supplementation of NAC increased the ATP level (P < 0.05) and TAN content (P = 0.84) in jejunum of broilers than those in the basal diet group. Additionally, there was an interaction (P < 0.05) between diet and temperature in jejunal AMP concentration (Table 5). It was shown that dietary supplement of NAC inhibited the increase of jejunal AMP in heat-stressed broilers.

3.5. Effect of NAC on the antioxidative capacity in the jejunum of broilers Heat stress affected the intestinal antioxidative capacity of broilers (Table 5). Heat stress induced the reduction (P < 0.05) in activities of antioxidative enzymes, such as CAT, SOD, and GSH-Px in the jejunum of broilers as compared with broilers in the thermoneutral group. However, dietary supplementation with NAC increased (P < 0.05) the activity of CAT in the jejunum of broilers as compared with broilers fed the basal diet. Additionally, there was a significant temperature × diet interaction for MDA concentration in the jejunum, showing that dietary NAC inhibited the elevation of MDA level in heat-stressed broilers.

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

89

Table 6 Effects of NAC on gene expressions in jejunum of broilers. Thermoneutral

HSP70 Bcl-2 Caspase-3 AMPK ANT PGC-1␣ COXIII HIF-1␣ HMOX XOR

Heat stress

SEM

Basal diet

NAC

Basal diet

NAC

1.00b 1.00 1.00 1.00b 1.00 1.00 1.00 1.00 1.00b 1.00b

0.58c 1.13 0.89 0.85b 1.17 0.98 1.03 1.01 1.07b 1.15ab

1.62a 0.83 1.30 1.39a 1.16 1.00 0.94 1.02 1.57a 1.57a

0.97b 1.00 1.19 0.95b 1.21 0.90 1.00 1.17 1.24b 1.25ab

0.08 0.04 0.06 0.06 0.04 0.04 0.02 0.05 0.05 0.08

P-value Temperature

Diet

Interaction

<0.001 0.053 0.006 0.006 0.176 0.631 0.366 0.359 <0.001 0.021

<0.001 0.048 0.283 0.001 0.148 0.412 0.314 0.401 0.039 0.549

0.043 0.764 0.978 0.083 0.413 0.607 0.747 0.491 0.002 0.097

a,b,c means with different letters in the same row differ significantly at P < 0.05. HSP70: heat shock protein 70; Bcl-2: B-cell lymphoma-2; AMPK: AMP-activated protein kinase; ANT: adenine nucleotide translocator; PGC-1␣: peroxisome proliferator-activated receptor ␥ coactivator-1␣; COXIII: cytochrome oxidase III; HIF-1␣: hypoxia-inducible factor 1, subunit alpha; HMOX: heme-oxigenase; XOR: xanthine oxidoreductas.

3.6. Effect of NAC on the jejunal AKP and digestive enzyme of broilers As indicated in Table 4, broilers in the heat stress group showed lower (P < 0.05) activities of AKP, lipase and trypsine in the jejunum than those in the thermoneutral group. However, supplementation of NAC increased (P < 0.05) the activity of trypsine in the jejunum of broilers in comparison with the basal diet group. 3.7. Effect of NAC on the mRNA levels in the jejunum of broilers Relative mRNA levels of genes associated with intestinal development, energy metabolism, and oxidation were shown in Table 6. Heat stress induced the downregulation (P = 0.053) of Bcl-2 expression and the upregulation (P < 0.05) of caspase-3 in the jejunal mucosa of broilers in comparison with the broilers under the thermoneutral zone. However, dietary supplementation of NAC increased (P < 0.05) the Bcl-2 mRNA abundance in broilers than those in the basal diet group. In addition, there were significant interactions (P < 0.05) between diet and temperature in mRNA levels for HSP70 and HMOX (Table 6). It was shown that broilers exposed to heat stress and fed with NAC diet exhibited lower mRNA levels of HSP70 and HMOX than broilers fed the basal diet under the same condition. Similarly, there was a significant trend of temperature × diet interactions in mRNA levels for AMPK (P = 0.083) and XOR (P < 0.097), indicating that dietary NAC decreased the AMPK abundance and mitigated the increase of XOR mRNA levels in the jejunum of broilers under heat stress. 4. Discussion Our results showed that heat stress induced adverse effects on growth performance and intestinal function of broilers, which was consistent with the previous studies (Garriga et al., 2006; Quinteiro-Filho et al., 2010; Sohail et al., 2010; Song et al., 2013; AI-Fataftah and Abdelqader, 2014). To resist the heat stress in poultry production, nutritional manipulations are suggested to apply in animal feeding, such as increasing dietary fat and vitamin C contents (Rao et al., 2016), and maintaining dietary amino acid and electrolyte balance (Ahmad et al., 2008). Given the beneficial effects of NAC (0.5 g/kg) on piglet growth and intestinal function (Hou et al., 2012, 2013; Yi et al., 2016b), herein we investigated the effect of NAC on alleviating the growth depression and intestine dysfunction induced by heat stress in broilers, which could provide a new nutritional strategy in protecting birds against hyperpyrexia condition. It is well known that high temperature condition increases the hypothalamic-pituitary-adrenal (HPA) axis activity and thus increases the corticosterone level (Lara and Rostagno, 2013; Loyau et al., 2015) with a concomitant decrease in the concentrations of T3 and T4 in poultry (Sohail et al., 2010). These endocrinological changes caused by chronic heat stress could reduce growth performance and redistribute the nutrient metabolism toward lipid lipogenesis and proteolysis (Geraert et al., 1996; Lin et al., 2004, 2006). Specifically, the increased corticosterone was reported to act feedback on the hypothalamic feeding control nuclei that regulated food intake and satisfaction, determining a reduction in food consumption and animal’s body weight gain (Quinteiro-Filho et al., 2010). In the present study, dietary NAC reduced the feed/gain and mortality rate of broilers compared to broilers fed with basal diet under the heat stress, while increased the broilers’ ADFI in the thermoneutral group (Table 3), indicating that NAC potentially alleviated the growth depression of broilers reared in the hyperthermia environment. Moreover, NAC decreased the plasma corticosterone despite no significant elevations of plasma T3 and T4 of heat-stressed broilers (Table 4). Though NAC are reported to transport across the blood-brain barrier (Samuni et al., 2013), it is still unclear how NAC affects the HPA activity and thus inhibits the increase of corticosterone level. Similarly, our previous study also demonstrated that NAC attenuated the increase in the cortisol concentrations induced by lipopolysaccharide challenge in piglets (Hou et al., 2013). Furthermore, another indicator of heat or oxidative stress, HSP70 in the intestine of heat-stressed broilers, was also downregulated by dietary NAC supplementation in comparison with broilers fed with basal

90

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

diet (Table 6). Therefore, dietary NAC supplementation could relieve heat stress and thus mitigated the growth depression of broilers under heat stress partially via reducing the corticosterone level. Another putative mechanism responsible for the NAC’s action on heat stress may involve the improvement of intestinal function, such as intestinal morphology, energy status, antioxidative capacity, and intestinal digestion. A large body of evidence showed that heat exposure can cause intestinal dysfunction (Mitchell and Carlisle, 1992; Quinteiro-Filho et al., 2010; AI-Fataftah and Abdelqader, 2014). Findings of study by Lambert et al. (2002) showed that heat stress could impair intestinal morphology by damaging the intestinal epithelial cells and increasing villus tips sloughing rate. Heat stress also impaired intestinal villus-crypt system and decreased villus height and villus surface area (AI-Fataftah and Abdelqader, 2014). There are some explanations for harmful effects of heat stress on broilers’ intestines. One is that chronic hot conditions induces intestinal inflammatory response and oxidative stress that generates pro-inflammatory cytokines and reactive oxygen species (ROS), and thus results in intestinal injury (Bouchama and Knochel, 2002; AI-Fataftah and Abdelqader, 2014). However, our results indicated that dietary NAC could attenuate the adverse effect of heat stress on intestinal morphology (Table 4). Given the antioxidative and anti-inflammatory effects of NAC on animals (Hou et al., 2013; Samuni et al., 2013; Yi et al., 2014), we suggest that NAC’s improvement on intestinal morphology of heat-stressed broilers may be attributed to enhancing intestinal immune function and antioxidative capacity. Additionally, NAC also regulated the expression of Bcl-2, a biomarker of enterocyte proliferation, and thus it is reasonable to suggest that enterocyte growth may be involved in NAC’s action on intestinal integrity. In addition to damaging intestinal morphology, heat stress also altered the intestinal absorption function by affecting the activities of digestive enzymes, such as trypsine, lipase, and amylase. However, results are not consistent on the alterations of digestive enzymes by different stress. Hu and Guo (2008) found that corticosterone treatment increased the activities of intestinal digestive enzymes in broilers, which was similar with the study of Pinheiro et al. (2004) using a feed restriction model. On the contrary, Ruan and Niu (2001) reported that total proteolytic enzyme, lipase, and amylase activity were decreased in heat-stressed broilers. The divergence among these studies may be attributed to the stress model and duration. Our results, which indicated the activities of trypsine and lipase were decreased in the jejunum of broilers after 4 weeks of cyclic heat exposure (Table 4), are in line with the results of Ruan and Niu (2001). Moreover, dietary NAC supplementation increased the activity of trypsine, whereas did not affect activities of the lipase and AKP in broilers under heat stress. To our best knowledge, the current study is the first report regarding the beneficial effects of NAC on intestinal enzyme activities. The possible explanation for increased trypsine activity may be due to the improvement of intestinal morphology and integrity by NAC supplementation. Furthermore, heat stress was shown to cause an increase in oxidative stress and an imbalance in antioxidant status (Lara and Rostagno, 2013). It is known that the excessive ROS and related peroxides induced by heat stress can cause intestinal oxidative injury, including lipid oxidation and oxidative damage to protein and DNA (AI-Fataftah and Abdelqader, 2014; Mujahid et al., 2007). However, tissues and cells possess defence mechanisms to detoxify ROS by radical scavengers, such as SOD, CAT, and GSH-Px (Wu et al., 2004). These antioxidant enzymes can cooperatively convert ROS into water and O2 . In the present study, the activities of SOD, CAT, and GSH-Px in the jejunum were substantially lower in broilers under heat stress, indicating that oxidative stress occurred in the intestine. This result was also substantiated by the evidence that the concentration of MDA, an indirect parameter of lipid peroxidation and overproduction of ROS, was increased in the jejunum of broilers in the heat stress group than broilers in the thermoneutral group. The other convincing evidence was that heat stress also induced the upregulation of HMOX and XOR (Table 6), which are a sensitive marker of oxidative injury and an enzyme associated with the synthesis of ROS, respectively (Osselaere et al., 2013). It is noteworthy that dietary NAC supplementation increased the activity of CAT, reduced mRNA level for HMOX, and inhibited the increases of MDA concentration and XOR mRNA level in the jejunum of broilers under heat stress. NAC was reported to not only directly react with oxidants and protect cell from oxidative damage, but also indirectly exert antioxidative effects by increasing the synthesis of glutathione (Hou et al., 2013). Thus, NAC can protect the intestine from oxidative damage by sparing antioxidative enzymes and possibly by increasing glutathione content and regulating HMOX and XOR expression. The last but important finding of the present study is that dietary NAC supplementation improves intestinal energy status in heat-stressed broilers. Previous studies showed that stressors could cause mitochondrial dysfunction and impairs energy metabolism in tissues (Hou et al., 2011; Kikusato and Toyomizu, 2013). Our results also showed that heat stress induced the reduction of ATP content and elevation of AMP content in the jejunum (Table 5). Given that the energy charge of the adenyl pool is considered as a more sensitive index of the energy state in a tissue than the level of a single nucleotide (Hou et al., 2011), we measured the energy charge in the jejunum and observed that jejunal AEC was decreased in the heatstressed broilers. Additionally, mRNA for genes associated with energy metabolism, such as AMPK, PGC-1␣, ANT, and COXIII were also determined. AMPK is an energy sensor and is upregulated as elevating ratio of AMP/ATP. PGC-1␣ can upregulate mitochondrial transcription factor A, whereas ANT is reported to exert a key metabolic control over mitochondrial energy production, and COXIII is responsible for modulating proton pumping and electron transport through the redox centers (Ojano-Dirain et al., 2007). In the present study, NAC supplementation increased the concentrations of ATP and TAN, whereas inhibited the increases of AMP level and AMPK mRNA abundance in the jejunum of heat-stressed broilers, indicating that NAC could modulate the adenine nucleotide pool via regulating AMPK expression. Alternatively, NAC could act as an antioxidant by scavenging enterocyte ROS induced by heat stress and inhibit the enzyme complexes of mitochondrial electron transport

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

91

chain (Zhang et al., 1990). Therefore, these beneficial effects of NAC on intestinal energy metabolism may also be related to its capacity of scavenging ROS. Conclusions Dietary supplementation of 1 g/kg NAC improved the growth performance, intestinal morphology and absorptive function, maintained intestinal energy metabolism, and mitigated intestinal oxidative stress in the heat-stressed broilers. Improving the intestinal function may be an effective approach to partially attenuate the detrimental effects of heat stress on birds’ health and performance. Conflict of interest The authors declare that they have no conflict of interest. Acknowledgements This work was jointly supported by National Key Technology R&D Program of China (2012BAD39B04) and Hubei Provincial Key Project for Scientific and Technical Innovation (2014ABA022). References AI-Fataftah, A., Abdelqader, A., 2014. Effects of dietary Bacillus subtilis on heat-stressed broilers performance, intestinal morphology and microflora composition. Anim. Feed Sci. Technol. 198, 279–285. Ahmad, T., Khalid, T., Mushtaq, T., Mirza, M.A., Nadeem, A., Babar, M.E., Ahmad, G., 2008. Effect of potassium chloride supplementation in drinking water on broiler performance under heat stress conditions. Poult. Sci. 87, 1276–1280. Bouchama, A., Knochel, J.P., 2002. Heat stroke. N. Engl. J. Med. 346, 1978–1988. Fu, W.J., Stromberg, A.J., Viele, K., Carroll, R.J., Wu, G., 2010. Statistics and bioinformatics in nutritional sciences: analysis of complex data in the era of systems biology. J. Nutr. Biochem. 21, 561–572. Garriga, C., Hunter, R.R., Amat, C., Planas, J.M., Mitchell, M.A., Moretó, M., 2006. Heat stress increases apical glucose transport in the chicken jejunum. Am. J. Physiol. Regul. Integr. Comp. Physiol. 290, R195–201. Geraert, P.A., Padilha, J.C., Guillaumin, S., 1996. Metabolic and endocrine changes induced by chronic heat exposure in broiler chickens: biological and endocrinological variables. Br. J. Nutr. 75, 205–216. Hao, Y., Gu, X.H., Wang, X.L., 2012. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 1. Intestinal structure and digestive function. Poult. Sci. 91, 781–789. Henneberg, W., Stohmann, F., 1864. Beiträge zur begründungeiner rationellen fütterung der wiederkäuer. In: Contributions to Establish a Rational Feeding of Ruminants, 2nd ed. Schwetschtke u. Sohn, Braunschweig. Hou, Y., Yao, K., Wang, L., Ding, B., Fu, D., Liu, Y., Zhu, H., Liu, J., Li, Y., Kang, P., Yin, Y., Wu, G., 2011. Effects of ␣-ketoglutarate on energy status in the intestinal mucosa of weaned piglets chronically challenged with lipopolysaccharide. Br. J. Nutr. 106, 357–363. Hou, Y., Wang, L., Zhang, W., Yang, Z., Ding, B., Zhu, H., Liu, Y., Qiu, Y., Yin, Y., Wu, G., 2012. Protective effects of N-acetylcysteine on intestinal functions of piglets challenged with lipopolysaccharide. Amino Acids 43, 1233–1242. Hou, Y., Wang, L., Yi, D., Ding, B., Yang, Z., Li, J., Chen, X., Qiu, Y., Wu, G., 2013. N-acetylcysteine reduces inflammation in the small intestine by regulating redox, EGF and TLR4 signaling. Amino Acids 45, 513–522. Hu, X., Guo, Y., 2008. Corticosterone administration alters small intestinal morphology and function of broiler chickens. Asian Aust. J. Anim. Sci. 21, 1773–1778. Huang, J., Cui, H., Peng, X., Fang, J., Zuo, Z., Deng, J., Wu, B., 2013. The association between splenocyte apoptosis and alterations of Bax Bcl-2 and caspase-3 mRNA expression, and oxidative stress induced by dietary nickel chloride in broilers. Int. J. Environ. Res. Public. Health. 10, 7310–7326. Kikusato, M., Toyomizu, M., 2013. Crucial role of membrane potential in heat stress-induced overproduction of reactive oxygen species in avian skeletal muscle mitochondria. PLoS. One 8, e64412. Lambert, G.P., Gisolfi, C.V., Berg, D.J., Moseley, P.L., Oberley, L.W., Kregel, K.C., 2002. Selected contribution: hyperthermia-induced intestinal permeabilityand the role of oxidative and nitrosative stress. J. Appl. Physiol. 92, 1750–1761. Lara, L.J., Rostagno, M.H., 2013. Impact of heat stress on poultry production. Animals 3, 356–369. Li, J., Hou, Y., Yi, D., Zhang, J., Wang, L., Qiu, H., Ding, B., Gong, J., 2015. Effects of tributyrin on intestinal energy status, antioxidative capacity and immune response to lipopolysaccharide challenge in broilers. Asian Aust. J. Anim. Sci. 28, 1784–1793. Lin, H., Decuypere, E., Buyse, J., 2004. Oxidative stress induced by corticosterone administration in broiler chickens (Gallus gallus domesticus) 1. Chronic exposure. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 139, 737–744. Lin, H., Sui, S.J., Jiao, H.C., Buyse, J., Decuypere, E., 2006. Impaired development of broiler chickens by stress mimicked by corticosterone exposure. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 143, 400–405. Loetscher, Y., Kreuzer, M., Messikommer, R.E., 2013. Oxidative stability of the meat of broilers supplemented with rosemary leaves, rosehip fruits, chokeberry pomace, and entire nettle: and effects on performance and meat quality. Poult. Sci. 92, 2938–2948. Loyau, T., Bedrani, L., Berri, C., Métayer-Coustard, S., Praud, C., Coustham, V., Mignon-Grasteau, S., Duclos, M.J., Tesseraud, S., Rideau, N., Hennequet-Antier, C., Everaert, N., Yahav, S., Collin, A., 2015. Cyclic variations in incubation conditions induce adaptive responses to later heat exposure in chickens: a review. Animal 9, 76–85. Meurens, F., Berri, M., Auray, G., Melo, S., Levast, B., Virlogeux-Payant, I., Chevaleyre, C., Gerdts, V., Salmon, H., 2009. Early immune response following Salmonella enterica subspecies enterica serovar Typhimurium infection in porcine jejunal gut loops. Vet. Res. 40, 5. Mitchell, M.A., Carlisle, A.J., 1992. The effects of chronic exposure to elevated environmental temperature on intestinal morphology and nutrient absorption in the domestic fowl (Gallus domesticus). Comp. Biochem. Physiol. A Comp. Physiol. 101, 137–142. Mujahid, A., Pumford, N.R., Bottje, W., Nakagawa, K., Miyazawa, T., Akiba, Y., Toyomizu, M., 2007. Mitochondrial oxidative damage in chicken skeletal muscle induced by acute heat stress. J. Poult. Sci. 44, 439–445. Nygard, A.B., Jørgensen, C.B., Cirera, S., Fredholm, M., 2007. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol. 8, 67. Ojano-Dirain, C., Toyomizu, M., Wing, T., Cooper, M., Bottje, W.G., 2007. Gene expression in breast muscle and duodenum from low and high feed efficient broilers. Poult. Sci. 86, 372–381.

92

D. Yi et al. / Animal Feed Science and Technology 220 (2016) 83–92

Osselaere, A., Santos, R., Hautekiet, V., De Backer, P., Chiers, K., Ducatelle, R., Croubels, S., 2013. Deoxynivalenol impairs hepatic and intestinal gene expression of selected oxidative stress, tight junction and inflammation proteins in broiler chickens, but addition of an adsorbing agent shifts the effects to the distal parts of the small intestine. PLoS. One 8, e69014. Pinheiro, D.F., Cruz, V.C., Sartori, J.R., Vicentini Paulino, M.L., 2004. Effect of early feed restriction and enzyme supplementation on digestive enzyme activities in broilers. Poult. Sci. 83, 1544–1550. Proszkowiec-Weglarz, M., Richards, M.P., Ramachandran, R., McMurtry, J.P., 2006. Characterization of the AMP-activated protein kinase pathway in chickens. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 143, 92–106. Quinteiro-Filho, W.M., Ribeiro, A., Ferraz-de-Paula, V., Pinheiro, M.L., Sakai, M., Sá, L.R., Ferreira, A.J., Palermo-Neto, J., 2010. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 89, 1905–1914. Rao, S.V., Prakash, B., Raju, M.V., Panda, A.K., Kumari, R.K., Reddy, E.P., 2016. Effect of supplementing organic forms of zinc, selenium and chromium on performance, anti-oxidant and immune responses in broiler chicken reared in tropical summer. Biol. Trace. Elem. Res., http://dx.doi.org/10.1007/s12011-015-0587-x. Ruan, H., Niu, D., 2001. Study on hot stress reducing activities of digestive enzymes in broiler intestine. Chin. J. Anim. Sci. 37, 16–17. Samuni, Y., Goldstein, S., Dean, O.M., Berk, M., 2013. The chemistry and biological activities of N-acetylcysteine. Biochim. Biophys. Acta 1830, 4117–4129. Sayed, M.A., Downing, J., 2011. The effects of water replacement by oral rehydration fluids with or without betaine supplementation on performance, acid-base balance, and water retention of heat-stressed broiler chickens. Poult. Sci. 90, 157–167. Sohail, M.U., Ijaz, A., Yousaf, M.S., Ashraf, K., Zaneb, H., Aleem, M., Rehman, H., 2010. Alleviation of cyclic heat stress in broilers by dietary supplementation of mannan-oligosaccharide and Lactobacillus-based probiotic: dynamics of cortisol, thyroid hormones, cholesterol, C-reactive protein, and humoral immunity. Poult. Sci. 89, 1934–1938. Song, J., Jiao, L.F., Xiao, K., Luan, Z.S., Hu, C.H., Shi, B., Zhan, X.A., 2013. Cello-oligosaccharide ameliorates heat stress-induced impairment of intestinal microflora, morphology and barrier integrity in broilers. Anim. Feed. Sci. Technol. 185, 175–181. Song, J., Xiao, K., Ke, Y.L., Jiao, L.F., Hu, C.H., Diao, Q.Y., Shi, B., Zou, X.T., 2014. Effect of a probiotic mixture on intestinal microflora, morphology, and barrier integrity of broilers subjected to heat stress. Poult. Sci. 93, 581–588. Sporer, K.R., Tempelman, R.J., Ernst, C.W., Reed, K.M., Velleman, S.G., Strasburg, G.M., 2011. Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle. BMC Genomics 12, 143. Teo, A.Y., Tan, H.M., 2007. Evaluation of the performance and intestinal gut microflora of broiler fed on corn-soy diets supplemented with Bacillus subtilis PB6, CloSTAT. J. Appl. Poult. Res. 16, 296–303. ˜ M.G., Reyes, Valdivia, A.G., Martínez, A., Damián, F.J., Quezada, T., Ortíz, R., Martínez, C., Llamas, J., Rodríguez, M.L., Yamamoto, L., Jaramillo, F., Loarca-Pina, J.L., 2001. Efficacy of N-acetylcysteine to reduce the effects of aflatoxin B1 intoxication in broiler chickens. Poult. Sci. 80, 727–734. Wu, G., Fang, Y.Z., Yang, S., Lupton, J.R., Turner, N.D., 2004. Glutathione metabolism and its implications for health. J. Nutr. 134, 489–492. Xu, Z.R., Hu, C.H., Xia, M.S., Zhan, X.A., Wang, M.Q., 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 82, 1030–1036. Yi, D., Hou, Y., Wang, L., Ding, B., Yang, Z., Li, J., Long, M., Liu, Y., Wu, G., 2014. Dietary N-acetylcysteine supplementation alleviates liver injury in lipopolysaccharide-challenged piglets. Br. J. Nutr. 111, 46–54. Yi, D., Hou, Y., Wang, L., Long, M., Hu, S., Mei, H., Yan, L., Hu, C.A., Wu, G., 2016a. N-acetylcysteine stimulates protein synthesis in enterocytes independently of glutathione synthesis. Amino Acids 48, 523–533. Yi, D., Hou, Y., Wang, L., Zhao, D., Ding, B., Wu, T., Chen, H., Liu, Y., Kang, P., Wu, G., 2016b. Gene expression profiles in the intestine of lipopolysaccharide-challenged piglets. Front. Biosci. (Landmark Ed) 21, 487–501. Yu, J., Bao, E., 2008. Effect of acute heat stress on heat shock protein 70 and its corresponding mRNA expression in the heart liver, and kidney of broilers. Asian Aust. J. Anim. Sci. 21, 1116–1126. Zhang, Y., Marcillat, O., Giulivi, C., Ernster, L., Davies, K.J., 1990. The oxidative inactivation of mitochondrial electron transport chain components and ATPase. J. Biol. Chem. 265, 16330–16336.