N-glycosylation site tagging suggests a three transmembrane domain topology for the glutamate receptor GluR1

Neuron, Vol. 13, 1331-1343,December,1994,Copyright © 1994by Cell Press

N-Glycosylation Site Tagging Suggests a Three Transmembrane Domain Topology for the Glutamate Receptor GluR1 Michael Hollmann,* Cornelia Maron, and Stephen Heinemann Molecular Neurobiology Laboratory The Salk Institute 10010 North Torrey Pines Road La Jolla, California 92037

Summary We investigated the transmembrane topology of the glutamate receptor GluR1 by introducing N-glycosylation sites as reporter sites for an extracellular location of the respective site. Our data show that the N-terminus is extracellular, whereas the C-terminus is intracellular. Most importantly, we found only three transmembrane domains (designated TMD A, TMD B, and TMD C), which correspond to the previously proposed TMDs I, III, and IV, respectively. Contrary to earlier models, the putative channel-lining hydrophobic domain TMD II does not span the membrane, but either lies in close proximity to the intracellular face of the plasma membrane or loops into the membrane without traversing it. Furthermore, the region between TMDs III and IV, in previous models believed to be intracellular, is an entirely extracellular domain. Introduction Prior to the cloning of ionotropic glutamate receptors (GluRs), ligand-gated ion channels such as nicotinic acetylcholine receptors (nAChRs), y-aminobutyric acid receptors, glycine receptors, and GluRs were thought to belong to a closely related superfamily of membrane proteins exemplified by the nAChR (Barnard et al., 1987). For the nAChR the available experimental data suggest extracellular N- and C-termini, four hydrophobic membrane-spanning domains (or transmembrane domains [-rMDs] I-IV)-of which TMD II forms part of the ion channel-and three loops (L1, L2, and L3) that connect the TMDs. L3, the largest of the loops, is located between TMDs III and IV and is intracellular (Claudio et al., 1983; Guy and Hucho, 1987; Devillers-Thiery et al., 1993; Karlin, 1993; Unwin, 1993; see Figure 1A, model 2). Sequence data from cloned GluRs (Hollmann et al., 1989; Boulter et al., 1990; Kein~nen et al., 1990; Moriyoshi et al., 1991), however, showed that important features conserved among all other members of the superfamily are not retained in GluRs. These differences include the absence of the proposed ligandgated ion channel signature sequence (Barnard et al., 1987) in the N-terminus; the observation that L3 is the most highly conserved domain in GluRs but the most *Present address: Glutamate Receptor Laboratory, Max-PlanckInstitute for ExperimentalMedicine, Hermann-Rein-Str.3, D-37075 G6ttingen, Germany.E-mail:[email protected].

variable domain in other ligand-gated ion channels, while the reverse is true for the N-terminus (Boulter et al., 1990); and the observation that the hydropathy plots of GluRs showed five rather than four hydrophobic domains, any of which are candidate TMDs (Hollmann and Heinemann, 1994). In addition, there is no significant primary structure homology between GluRs and the other ligand-gated channels. GluRs are nearly twice the size (-100 kDa) of other ligand-gated ion channels, although a few exceptions exist, e.g., the kainate binding proteins at only - 5 2 kDa (Gregor et al., 1989; Wada et al., 1989). Despite these differences, the four TMD topology model of the nAChR has been adopted as a working model for GluRs. The precise assignment of the four TMDs is uncertain, and three different models (see Figure 1A) were originally proposed (Hollmann et al., 1989; Kein~inen et al., 1990; Hume et al., 1991; for a review, see Hollmann and Heinernann, 1994). Later, these models were challenged by immunocytochemical evidence indicating that the C-terminus is intracellular (Petralia and Wenthold, 1992; Molnar et al., 1993,1994; Baude et al., 1994) and by recent biochemical evidence which shows that the C-terminus of the N-methyi-Daspartate (NMDA) receptor is phosphorylated, consistent with an intracellular location (Tingley et al., 1993). The recently observed location of a native N-glycosylation site in the kainate receptor subunit, GluR6, suggests that at least part of the L3 domain is extracellular rather than intracellular as proposed earlier (Roche et al., 1994; Taverna et al., 1994). We selected the a-amino-3-hydroxy-5-methylisoxazole-4 propionic acid (AMPA) subunit GluR1 to reexamine the question of membrane topology of the GluRs. We constructed a series of mutants of GluR1 by introducing N-glycosylation consensus sequences (NXS/T; Hart et al., 1978) at different sites along the entire length of the protein and analyzed these mutant receptors for glycosylation at the engineered sites in a Xenopus laevis oocyte expression system. Owing to the strict compartmentalization of N-glycosylating enzymes (Hirschberg and Snider, 1987; Abeijon and H irschberg, 1992), glycosylation can occur only at sites located at the l u menal face of the endoplasmic reticulure, which coincides with the extracellular face of the receptor. Thus, glycosylation at any given site can be taken as proof of the extracellular localization of that site. This approach has been used previously, e.g., for topology studies of the N-terminal domain of nAChRs (Chavez and Hall, 1991) and of H+,K÷-ATPase (Bamberg and Sachs, 1994). Our data are consistent with a model for GluR1 in which the N-terminus is extracellular while the C-terminus is intracellular. In addition, our data suggest that GluR1 has only three TMDs, which we propose to call TMD A, TMD B, and TMD C, to avoid confusion with previous models that employ various numbering

Neuron

1332

significant implications for structure-function studies designed to localize the ligand binding and phosphorylation sites and to identify regions involved in receptor desensitization. In particular, the data on GluR modulation by phosphorylation at the putative intracellular domain L3 (McGlade-McCulloh et al., 1993; Moss et al., 1993; Raymond et al., 1993; Wang et al., 1993; Wright et al., 1993) must be reinterpreted. Finally, our experiments show that the topology of membrane proteins can be studied in an in vivo translation system in which it is possible to test the functionality of the protein under study.

A extracellul intracellu

model 1

model2

model3

medel4

model5a

~15b

Results Removal of Native N-Glycosylation

~

B

IG' uR, I I

I •

I ll'~ ~

II Jill I-I I=I l=f

i_ fhpl or~ZI

-

I

e.l i~ll°l

I

I ILl1 11-211

I.~I L3

I I

I

I ~'terminusl

Figure 1. Schematic Representation of the Topology Models Proposed for GluR1 to Date and of the Domain Structure of GluR1with the RelativePositionsof Nativeaswell as Engineered N-GlycosylationSites (A) The positionsof the five hydrophobic domainssuggestedto represent TMDs are shown for all models.The oval dot in the third hydrophobic domain indicatesthe Q/R editing site (Sommer et aL, 1991).Model 1 is from Hollmann et al. (1989),model 2 from Kein~nen et al. (1990), model 3 from Dingledine et al. (1992),and model 4 from Seeburg (1993);models5a and 5b are derived from the data presented in this paper. (B) Bar diagram of GluR1 depicting the principle domains according to model 2 in (A) as N-terminus, C-terminus, TMD I through TMD IV, and L1 through L3 CrMD-connecting loops 1, 2, and 3). H1 indicatesthe first of the five hydrophobic domains shown in (A), and "flip/flop" designatesthe region of alternate splicing of AMPA receptors(Sommeret al., 1990).Dots 1, 2, and 3 within L3 indicate the position of three sites reported to be phosphorylated by CaMKII(GluR1),tyrosinekinase(GluR1),and PKA(GluR6),respectively.N-glycosylationsitesare shownabove the sequencebar. Sites NG1-NG6 (round pinheads)are native glycosylation sites (for amino acid positions, see Experimental Procedures), whereas EG1-EG22 (square pinheads) have been introduced by mutagenesis(for positions,seeTable 1). The one to four legs of the pinheads indicateclustering of one to four sitesin someof the mutants(seeTable1). Closedpinheads,sites found to be glycosylated;open pinheads, sites that were not glycosylated.

systems. These three TMDs correspond to TMDs I, III, and IV, respectively, of the most widely discussed previous model (Figure 1A, model 2). We conclude that the hydrophobic domain formerly called TMD II and thought to form part of the ion channel (Hume et al., 1991; Verdoom et al., 1991; Burnashev et al., 1992; Dingledine et al., 1992; Blaschke et al., 1993) does not span the membrane. These findings have

Sites

GluR1 has six native N-glycosylation sites designated NG1 through NG6 at amino acids 45, 231,239, 345, 383, and 388, respectively, which are all located in the putative extracellular N-terminus. Although the receptor has previously been shown to be N-glycosylated and to contain - 8 kDa of N-linked carbohydrate (Rogers et al., 1991; Blackstone et al., 1992; Hullebroeck and Hampson, 1992), it was not clear whether all or only a subset of the six potential sites are used. Therefore, each site was removed independently by mutating the asparagine (N) of the consensus sequence NxsEr to a serine. The mutant constructs, designated GluR1-ANG1 through GluR1-ANG6, were expressed in Xenopus oocytes. All 6 mutants form functional receptors activated by the agonist kainate (100 I~M), with peak currents ranging from 30%-360% of native GluR1 (data not shown). A crude protein fraction obtained from these oocytes was separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), blotted onto nitrocellulose filters, and probed with an antibody directed against a peptide consisting of the 13 C-terminal amino acids of GluR1 (see Experimental Procedures; Figures 2A and 2B). As can be seen in Figure 2C, removal of any one of the six glycosylation sites causes an apparent decrease in the molecular weight of the resulting GluR1 protein, indicating that all six sites are glycosylated. The shifts in molecular weight are not equivalent for the 6 mutants, indicating some variability in the size of the carbohydrate side chains attached to the different sites. It is possible that removing a single glycosylation site causes a structural change in the receptor or alters glycosylation at the remaining sites, which would complicate the interpretation of shifts in the mobility of the protein. To circumvent th is problem, we engineered 6 GluR1 mutants such that five sites were removed by mutagenesis, while only a single native N-glycosylation site was retained. Only the mutant with site NG4 remaining produced a functional receptor ( - 1 % of the wild-type response); however, all 6 mutants were expressed and directed the synthesis of protein. To analyze their molecular weights and to detect any shifts caused by glycosylation, two control preparations were used: one control

Transmembrane Topology of GluR1 1333

B

A

was a mutant GluR1 with all six native sites removed, designated GluR1-ANG, w h i c h is nonfunctional; the other control was the respective mutant clone expressed in oocytes in the presence of tunicamycin, a blocker of N-glycosylation (see Experimental Procedures). Both of these controls generate a non-N-glycosylated protein with the predicted molecular weight of 99.8 kDa. The tu nicamycin control offers the advantage that mobility changes caused by the engineered amino acids rather than actual glycosylation do not complicate the analysis. When analyzed by SDS-PAGE, the 6 mutant GluR1 receptors w i t h only a single glycosylation site remaining (designated GluR1-NG1 t h r o u g h GluR1-NG6) migrated at higher molecular weights than the respective controls (see Figure 2D), demonstrating that each of the sites is actually glycosylated. This confirms that the first 388 amino acids of GluR1 (up to the site of NG6) are extracellular.

-99.8

1

2

3

4

56

78

91011121314151617181920

1

2

D

C

- 99.8

+ 1 2

3 4 5 6

7 8 9 10 1 1 1 2 1 3

NG1

.

+

NG2

-

+

+

+

+

NG3

NG4

NG5

NG6

Figure 2. N-Glycosylation at Native Sites in GluR1 as Assayed by Gel Mobility Shift (A) Time course of expression of GluR1 in oocytes in the absence (lanes 3-10) or presence (lanes 11-18) of tunicamycin (20 ng per oocyte). Lanes3-10 and 11-18 represent days 1-8 and 12, respectively, after injection of GluR1 RNA. Tunicamycin was injected 1 day before RNA injection. Lanes I and 2 show control oocytes with and without tunicamycin, respectively, which were not injected with GluR1 RNA. Oocytes in lane 19 were injected with tunicamycin 1 day after GluR1 RNA injection and prepared for analysis 3 days after RNA injection; note the production of some glycosylated GluR1. Oocytes in lane 20 were injected with tunicamycin and GluR1 RNA simultaneously and prepared for analysis 3 days after injection; note the absence of any glycosylated GluR1. The equivalent of 1 oocyte was loaded per lane. Proteins were separated by SDS-PAGE on a 40 cm long, 7.5% gel and blotted, and GluR1 was visualized with a polyclonal antibody directed against the C-terminus of GluR1 (seeExperimental Procedures). (B) GluR1 (lane 1) and GluR1-ANG (lane 2) separated by SDSPAGE on an 11 cm long, 7.5% gel, blotted and visualized as in (A). Note sharper bands but greatly reduced separation of glycosylated and unglycosylated forms when compared with the 40 cm gel used in (A). (C) Comparison of mobilities of GluR1 and the 6 mutants GluR1ANG1 through GluR1-ANG6,each lacking a single native N-glycosylation site, NG1-NG6. Lanes1, 3, 5, 7, 9, and 11 represent Glu R1ANG1 through GluR1-ANG6, respectively, while lanes 2, 4, 6, 8, 10, and 12 in between show wild-type GluR1 controls. Lane 13 represents the mutant GluR1-ANG, which lacks all six native N-glycosylation sites. SDS-PAGEwas performed as in (A). Note that all mutants show a shift relative to the native receptor. (D) Comparison of mobilities of GluR1 and the 6 mutants GluR1NG1 through GluR1-NG6,each lacking five of the six native N-glycosylation sites, NG1-NG6. The mutants were expressed in oocytes in the absence (-) and in the presence (+) of tunicamycin. SDS-PAGE was performed as in (A), except that GluR1-NG4, GluR1-NGS, and GluR1-NG6 were immunoprecipitated from 5 oocytes prior to application to the gel (see Experimental Procedures). Note that all mutants show a shift relative to the unglycosylated tunicamycin control.

Introduction of Engineered Reporter N-Glycosylation Sites To analyze the topology downstream of amino acicI 388, we used site-directed mutagenesis to engineer N-glycosylation consensus sites (designated EG) into G l u R l , w h i c h w o u l d serve as reporter sites (see Experimental Procedures). Since some glycosylation sites may not be used (Kronquist and Lennarz, 1978), we usually clustered several sites (2-4) w i t h i n a narrow region (3-13 amino acids; see Figure 1B; Table 1) to maximize the chance that at least one of the sites w o u l d become glycosylated. In each case GluR1ANG, the mutant receptor w i t h no native glycosylation sites, was used as parent construct to create mutants GluR1-ANG-EG1 through GluR1-ANG-EG22 (Table 1). Using GluR1-ANG ensu red that any glycosylation detected in the EG mutants w o u l d be due to the engineered reporter sites. As a control, each mutant was also expressed in oocytes in the presence of tunicamycin. Since the parent construct GluR1-ANG is nonfunctional, EG site mutations introduced into GluR1-ANG cannot be tested for function. Therefore, all EG site mutations were also inserted into wild-type GluR1, generating mutants GluR1-EG1 through GluR1EG22, w h i c h cou Id then be tested for function. I n principle, the mutants GluR1-EG1 through GluR1-EG22 might be used for the gel shift assays just as the mutants GluR1-ANG-EG1 t h r o u g h GluR1-ANG-EG22. However, o w i n g to glycosylation at the six native sites, any additional glycosylation at engineered sites w o u l d be difficult to detect. Since receptor function might be affected either by the mutation itself (i.e., the changed amino acid sequence) or by the carbohydrate side chain attached to the mutated site, mutants GluR1-EG1 through GluR1-EG22 were expressed under two conditions, in normal oocytes as well as in tunicamycin-injected oocytes. If glycosylation rather than the changed amino acids of the mutant affected receptor function, then expression in the presence of an inhibitor of glycosylation should restore function. Tunicamycin-injected

Neuron 1334

Table 1. Glycosylationand Functional Properties of GluR1 Mutants with Engineered N-GlycosylationConsensusSites

Mutant EG1 EG2 EG3 EG4 EG5 EG5x

EG6 EG6a EG6b

EG7 EG8 EG9 EG10 EG10a EG10b EGll EG12

EG12a

Mutations Introduced N409S R416S P451N M459T P474N D486N F491N G495N Q504N V510N Q504N V510N KSO1Q KS02Q KS05Q K507Q G531N L538N G531N 1_538N

R541N W547N D557N Q558N D562N F567S F570N L573S W574N F570N L573S D586N S591N A617-r F619N M625N 1629N A617T

Function (% WT)

Function after Tunicamycin (% WT)

Location of Sites

Glycosylation

N-terminus

Yes

0

1.5

N-terminus

Yes

0

1.1

N-terminus (in H1 domain) N-terminus

Yes Yes

0 0

2.0 0

N-terminus

No

840.5

582.9

N-term i nus

Yes

291.8

NT

TMD I

No

0

0

Middle of TMD I C-terminal end of TMD I

No No

55.0 15.5

NT 10.4

L1

No

112.5

84.5

L1

No

88.4

26.2

L1, at mouth of TMD II Middle of TMD II

No No

0 0

0 0

Middle of TMD II Middle of TMD II L2

No No No

NT NT 28.2

NT NT 28.4

L3

Yes

0

0

L3

No

10.2

4.2 (continued)

oocytes do not glycosylate GluR1 for a period of at least 12 days after a single injection of 20 ng of tunicamycin (Figure 2A), while translation of the RNA is only marginally impaired. Tunicamycin does not prevent the synthesis of functional GluR1, contrary to some reports that intact N-glycosylation is essential for functionality of all GluRs (Musshoff et al., 1992). Oocytes expressing Glu R1 protein without any detectable glycosylation as judged by SDS-PAGE (Figure 2A, lanes 11-18) express functional GluRs, although maximal currents are usually decreased by 40%-50% (see also Sumikawa et al., 1988). The reduction in maximal current may be due to decreased expression of GluR1, since tunicamycin is known to be a weak inhibitor of protein synthesis (Duksin and Mahoney, 1982). The finding that GluR1-ANG, which is nonglycosylated owing to removal of glycosylation sites, is nonfunctional while native GluR1 expressed in tunicamycininjected oocytes, which is nonglycosylated owing to

inhibition of glycosylation, is functional shows that the cumulative amino acid changes introduced to remove the six native N-glycosylation sites abolish receptor function. Figure 3 shows the gel mobility shift analysis for the mutants, and Figure 6 and Table I summarize the data obtained with this approach. Of the 5 mutants introduced into the putative N-terminal domain, EG1-EG4 were glycosylated, proving the extracellular localization of this entire segment. Interestingly, EG3 was glycosylated despite its localization in the middle of a hydrophobic region (H1 in Figure 1B), which was designated TMD I in the first topology model proposed for GluR1 (Hollmann et al., 1989). Glycosylation at this site proves that domain H1 is not a TMD. EG5 was not glycosylated; however, the absence of glycosylation does not disprove an extracellular localization, as it may simply be a consequence of steric hindrance (Kronquist and Lennarz, 1978; Hart et al., 1978; Aubert

Transmembrane Topology of GluR1 1335

Table 1. (continued)

Mutant

Mutations Introduced

EG12b EG12c EG13

F619N 1629N Y643N

EG14

M666N M670N R690N L700N D715N M717T L723N D724S 1730N K734N V742S A745S

EG15 EG16 EG17

EG18 EG18a EG18b

EG19 EG20 EG21

EG22

Q752S V742S Q752S

A782N Y812N S816N Q829N A835S R837N T838N C875N

Function after Tunicamycin (% WT)

Location of Sites

Glycosylation

Function (% WT)

L3 L3 L3 (potential tyrosine kinase site) L3

No Yes Yes

NT 0 0

NT 0 0

Yes

0

0

L3

Yes

0

0

L3

Yes

0

14.6

L3

Yes

0

0

L3

Yes

0

2.1

L3 L3

No Yes

3.1 0

1.7 71.4

L3 C-terminus

No No

191.4 43.1

90.1 12.4

C-terminus

No

21.3

18.5

C-terminus

No

165.4

NT

Every single mutation listed creates one N-glycosylation consensus site, except for mutant EG16,for which both mutations listed are required to create one consensussite, and mutant EG5x,for which 4 lysines were changed to glutamines to alter the chargedistribution around the glycosylation site of the parent mutant EG5.Amino acidsare numbered starting with the first residue of the mature protein. In some cases (EG6, EG10, EG12,and EG18),cluster mutations were made as well as mutations of single sites within those clusters (designateda, b, and c). For gel shift assaysof glycosylation, rnutationswere introduced into GluR1-ANG,which lacks nativeglycosylation sites but is nonfunctional, whereasfor the functional assay,mutations were introduced into wild-type GluR1. Functional data represent responses to 100 I~M kainate (of GluR1 wild-type [wt] responses; n = 3) and were measured 3 days after RNA injection. For both the gel shift glycosylation assaysand the functional assays,mutant clones were expressedin normal oocytesaswell as in oocytespreinjected with 20 ng of tunicarnycin 1 day before RNA injection. In the gel shift assays,tunicamycin-injected oocytes served as nonglycosylated controls, while in the functional assay, they were used to test whether ion channel properties could be restored to nonfunctional mutants when glycosylation was inhibited. NT, not tested.

et al., 1981). Since there are 4 lysines in the immediate vicinity of EG5, it is possible that this highly charged e n v i r o n m e n t prevents glycosylating enzymes from reaching site EG5. We therefore mutated the 4 lysines to glutamines (EG5x; see Table 1). The resulting mutant receptor was functional and was glycosylated, establishing an extracellular localization for site EG5. EG6, located w i t h i n the putative T M D I, was not glycosylated, as was to be expected for a site thought to be buried w i t h i n the membrane. EG7, EG8, and EG9, inserted into L1, were not glycosylated, consistent with, but not proving, an intracellular localization. EG10, inserted into TMD II, was not glycosylated, and neither was the mutant EG11 placed in the L2 loop domain. This latter result was unexpected, since the L2 domain was predicted to be extracellular according to the four TMD model. However, as mentioned above, the absence of glycosylation does not necessarily mean an intracellular localization. Mutants EG12-EG19 were made to investigate the localization of domain L3, the long, putatively intracellular

l o o p between TMDs III and IV. All but I, EG19, which is located just in front of T M D IV, were glycosylated. This shows that the entire L3 domain is extracellular. The I mutant not glycosylated, EG19, may be too close to T M D IV to be glycosylated. In fact, depending on the exact extent of TMD IV, which is unknown, EG19 may actually lie within T M D IV. Since N-glycosylation usually does not occur in a-helical regions (Aubert et al., 1981) and close to the membrane (Landolt-Marticorena and Reithmeier, 1994), this site may be inaccessible. Finally, the 3 mutants EG20-EG22, which were placed in the C-terminus, are not glycosylated, consistent with data from other workers showing an intracellular localization for the C-terminus. Interestingly, 11out of 12 mutants found to be glycosylated were nonfunctional, suggesting that glycosylation at inappropriate positions interferes with the structure of the receptor and renders it nonfunctional. Conversely, 8 out of 11 mutants that were nonglycosylated formed functional ion channels, demonstrating that the mutagenetic amino acid changes

Neuron 1336

EG15, which were considered doubtful. Additionally, all EG mutants that did not shift when constructed in GluR1-AG also did not shift in wild-type GluR1 (data not shown). From these data we conclude that the topology of GluR1-ANG is not different from that of GluR1.

A

* EG1

+

. EG2

+

EG3

+

-

+

*

+

EC-4 EG5

.

+

-

+

EGSx EG6

-

+

-

+

-

+

EG7 EG8 EG9

*

+

EG10

-

+

EG11

B

- ÷ - + - + - + . + _ + . + _ + . + . + . ÷ EG12

EG13

EG14 EG15 EG16 EG17 EG18 EG19 E ~

EG21 EG~

Figure 3. N-Glycosylationat EngineeredSitesas Assayedby Gel Mobility Shift Comparison of mobilities of GluR1-ANG mutants with engineered N-glycosylationsites or site clusters (seeTable 1) EG1EG11(A) and EG12-EG22(B).Mutantswereexpressedin oocytes in the absence(-) and presence(+) of tunicamycin. SDS-PAGE was performedas in Figure2A, exceptthat EG6was immunoprecipitatedfrom 5oocytesprior to applicationto the gel (seeExperimental Procedures). Note that mutants EG1-EG4, EGSx,and EG12-EG18 show shifts relative to the unglycosylated tunicamycin controls.

alone rarely abolished receptor function. This conclusion is supported by the observation that, for 5 of the 11 nonfunctional glycosylated mutants, function could be partially restored by preventing glycosylation with tunicamycin. Furthermore, restoration of function in the presence of tunicamycin indicates that the mutant receptors are unlikely to suffer from any gross structural changes, and that in all likelihood they retain their normal topology. GIuR1-ANG, the nonfunctional parent construct of all EG mutants analyzed (Table 1; Figures 3A and 3B), could potentially suffer from an altered topology caused by the mutations introduced to remove the endogenous N-glycosylation sites. Therefore, we also analyzed mutants EGI-EG22 in wild-type GIuR1 in the gel shift assay. Although, as mentioned above, shifts were less obvious in most cases, all mutants that showed shifts in the GIuRI-ANG construct also showed shifts in wild-type GIuRI, except mutants EG3 and

Deletion of Transmembrane Domains The glycosylation site analysis presented above suggests a receptor topology incompatible with any of the TMD models proposed for GluR1 (Figure 1A, models 1-4). If the N-terminus is extracellular, the C-terminus intracellular, and the entire L3 domain extracellular, then the region between TMD I and TMD III cannot contain a membrane-spanning domain (unless it had two, or any even number of them). Since there is no evidence for two hydrophobic domains in this region, the simplest possibility is that TMD II does not span the membrane. To test this hypothesis, we deleted TMD II and examined the effect of this manipulation on a reporter glycosylation site C-terminal of TMD II. The prediction is that an extracellular site C-terminal of TMD II that is normally glycosylated would still be extracellular and be glycosylated even after removal of TMD II. However, ifTMD II does indeed span the membrane, then this site should switch from the extra- to the intracellular side of the membrane in the deletion mutant, and then it cannot be glycosylated (see Figure 4). We used EG15 as the reporter site and found that it remained glycosylated when TMD II was deleted (Table 2; Figure 5). This suggests that TMD II does not span the membrane. To show that deletion of a true TMD would actually change the glycosylation pattern of sites C-terminal of the deleted TMD as predicted (Figure 4), we deleted TMD III and tested for glycosylation of EG15. This time, the glycosylation pattern changed from glycosylated to nonglycosylated (Table 2; Figure 5), consistent with the conclusion that the site switched sides relative to the membrane. This confirmed the validity of our approach to determine topology and at the same time showed that TMD III is a membrane-spanning domain. To confirm that TMD I spans the membrane, we deleted this domain (see Experimental Procedures) and combined this deletion with the introduction of reporter glycosylation sites EG10, EG10a, and EG10b, which are located in the putative TMD II and, when introduced in GluR1-ANG, are not glycosylated (Table 1; Figure 3A). However, when engineered into the deletion mutant GluR1-ANG-ATMD I, all three sites are glycosylated (Table 2), demonstrating that they switched from the intracellular face of the membrane to the extracellular side, as expected when TMD I is a transmembrane domain. This result also confirms our previous finding that TMD II does not span the membrane, since if it did, no glycosylation would be possible at the sites EG10, EG10a, and EG10b, which would be buried within the membrane.

Transmembrane Topology of GluR1 1337

Figure 4. Schematic Representation of the Effects of TMD Deletions on the Topology (A) Deletion of a true TMD (Y):sites located N-terminal of the TMD (1 and 2) keep their topological position, while sites located C-terminal of the deletion (3 and 4) switch to the other side of the membrane. (B) Deletion of a non-membrane-spanning domain (Y):sites N-terminal (1 and 2) aswell as C-terminal (3 and 4) of the deleted domain keep their topological orientation with respect to the membrane.

A

ext....

e.t om.o

intracell

"

topologychanged

2~~

B

ext.... lular~

i~

deletionof domainY~]

~

,n, ....

"~topology unchanged

Discussion O u r data suggest a topology for GluR1 that is substantially different from earlier models. In fact, the only features remaining of previous models are the extracellular localization of the N-terminus up until T M D I and the intracellular localization of L1. From T M D II on, the t o p o l o g y appears to be almost the reverse of what has formerly been assumed. T M D II probably does not span the membrane but remains intracellular, causing L2 to be intracellular and T M D III to cross the membrane from inside to outside rather than from outside to inside. The long L3 region is then an extracellular domain, and T M D IV crosses from the outside to the inside to put the C-terminus inside the cell (Figure 1A, models 5a and 5b; Figure 6). Thus, GluR1 posseses o n l y three TMDs, T M D A, T M D B, and T M D C, which are equivalent to TMDs I, III, and IV, respectively, of the old four T M D model.

The Role of TMD II At present, we cannot distinguish between a model in which T M D II is entirely intracellular (Figure 1A, model 5a) and one in which it loops into the plasma membrane from the intracellular side (most likely in a [3-sheet conformation) w i t h o u t actually traversing it (Figure 1A, model 5b; Figure 6), similar to the model

that has been suggested for the H5 region between TMDs $5 and S6 in potassium channels (Yellen et al., 1991; Yool and Schwarz, 1991). It is possible that T M D II merely provides the intracellular vestibule of the ion channel, or that it forms the ion channel in conjunction w i t h T M D I. This possibility is particularly relevant in view of the f i n d i n g that editing of sites in T M D I as well as T M D II influences the ion selectivity of the channel (K6hler et al., 1993). O u r approach to topology analysis does not allow us to identify domains that are merely inserted into the membrane rather than actually spanning it (insertion sequences or embedding sequences [Blobel, 1980; Rapoport, 1985]) because attachment of carbohydrates to a reporter site in such a domain will most likely prevent this domain from being inserted into the membrane. Therefore, the glycosylation observed for sites EG10, EG10a, and EG10b, w h e n combined w i t h the deletion of T M D I, cannot be taken as evidence against a model in which T M D II loops into the membrane. If T M D II looped in and out of the membrane, this could place the glutamine/arginine (Q/R) editing site of AMPA receptors and the equivalent site of N M D A receptors (containing an asparagine [N]) at the intracellular mouth of the channel (see Figure 1A, model 5b), rather than at the extracellular entrance, as in the four T M D model. The Q/R site has

Table 2. Glycosylation Properties of GluR1 Mutants Containing an Engineered N-Glycosylation Consensus Site Combined with Deletions of TMD I, TMD II, or TMD III Mutant Clone

TMD Deleted

Location of N-Glycosylation S i t e s

Glycosylation

GluR1-ANG-EG15 GluR1-ANG-ATMD II-EG15 GluR1-ANG-ATMD III-EG15

None II III

L3 L3 L3

Yes Yes No

GluR1-ANG-EG10 (or -EG10a, -EG10b) GluR1-ANG-ATMD I-EG10 GluR1-ANG-ATMD I-EG10a GluR1-ANG-ATMD I-EG10b

None I I I

TMD TMD TMD TMD

II II II II

No Yes Yes Yes

TMDs were deleted in-frame as described in Experimental Procedures and were engineered to contain a reporter glycosylation site to be analyzed. Analysis was done by gel shift assay as described in Table 1. None of the clones with a TMD deletion were functional (data not shown).

Neuron 1338

~,

iI

r

m

- 105

-99.8

~i~¸: + A

B

+ C

+ D

+ E

Figure 5. N-Glycosylation of GIuRI Mutants That Combine Engineered N-GlycosylationSiteswith Deletionsof TMD II or TMD III GIuRI-ATMDII (A) and GIuR1-ATMDIII(D) expressedin oocytes in the absence (-) and presence (+) of tunicamycin. Note that both TMD deletion mutants are capable of glycosylating their native sites, as is evident from the large shifts. GIuR1-ANGATMDII-EG15 (B and C) and GIuR1-ANG-ATMDIII-EG15(E) expressed in oocytes in the absence (-) and presence (+) of tunicamycin. The two experiments shown in (B) and (C), both analyzing GIuRI-ANG-ATMDII-EGIS, represent two different batches of oocytes. SDS-PAGEwas performed as in Figure 2A. Note shift in (B) and (C) but absence of shift in (E).

been identified as the site of the ion selectivity filter of AMPA receptors (Hume et al., 1991; Burnashev et al., 1992a), w h i l e the h o m o l o g o u s N site in the N M D A receptors is involved in the magnesium block (Burnashev et al., 1992b; M o r i et al., 1992). Based on electrophysiological data, it has been argued by several authors that these sites should be located within the membrane, at the intracellular mouth of the channel rather than the extracellular entrance (Ascher and Nowak, 1988; D i n g l e d i n e et al., 1992; Imoto, 1993). Therefore, we favor the model in which TMD II inserts a loop into the membrane (Figure 1A, model 5b; Figure 6). Previous Data Supporting Our Topology Model Our data confirm the intracellular localization of the C-terminus that, based on electron immunocytochemical data, was first discussed by Petralia and Wenthold (1992) and later also shown by others (Molnar et al., 1993, 1994; Baude et al., 1994). Intracellular localization of the C-terminus is further supported by Tingley et al. (1993), w h o detected phosphorylation of the C-terminus of NMDARI. An extracellular localization of a portion of L3 was first considered by Seeburg (1993), based on the reasoning that the flip/flop domain of AMPA receptors, which is located in front of TMD IV(see Figure IB; Figure 6), should be extracellular in order to explain the effects of flip/flop on re-

Figure 6. Three TMD Topology of GIuR1 as Derived from N-Glycosylation SiteTagging:Graphical Presentationof Mutated Sites, Glycosylation Data Obtained, and Deduced SchematicArrangement of TMDs A, B, and C The 889 amino acids of the mature GIuR1 protein are shown in standard single-letter code. Native N-glycosylation sites NGING6 are indicated by round pinheads. Square pinheads mark the mutated sites for the engineered N-glycosylation mutants EGI-EG22. EG mutants that are glycosylated are marked by an asterisk. Amino acids mutated to create N-glycosylation sitesare stippled; the 4 lysine residues-K501, K502, 1(505, and 1(507that were changed to glutamines in mutant EG5x(seetext) are cross-hatched.The arrows at amino acids 398,443,and 445 point to sites implicated in ligand binding in a mutagenesis study (Uchino et al., 1992).The stippled area around amino acids 463480 shows the hydrophobic domain H1 previously hypothesized to be TMD I (Hollmann et al., 1989).The box around amino acids 740-783depicts the alternatively splicing exon that was dubbed "flip~flop" (Sommer et al., 1990).The tags P1, P2, and P3at amino acids 627,643,and 676,respectively,point to putative phosphorylation sites mentioned in the Discussion. The region between amino acids 567 and 585,which is shown looping in and out of the membrane in I~-sheetconformation, represents the domain formerly designated TMD II.

ceptor desensitization (Sommer et al., 1990). However, in this model only the C-terminal half of L3 was proposed to be extracellular, whereas the N-terminal half was intracellular in order to retain an extracellular N-terminus of the protein, to treat T M D II as a transmembrane domain, and to place some phosphorylation consensus sites in L3 in the intracellular compartment. To accomplish this topology, the model required the introduction of a conjectural fifth TMD

Transmembrane Topology of GluR1 1339

in the middle of L3 (Figure 1A, model 4), for which there is no experimental evidence. Our finding that L3 is entirely extracellular fits predictions, based on sequence comparisons of bacterial glutamine binding proteins with GluRs, that the ligand-binding domain is made up of two half-domains, one located at the N-terminus and the other in L3. This was first discussed by Nakanishi et al. (1990) for AMPA receptors and later extended to NMDA receptors by O'Hara et al. (1993), and is supported by mutagenesis data for the glycine binding site of the NMDA receptor (Ku ryatov et al., 1994) and the AMPA/kainate binding site of AMPA/kainate receptors (Stern-Bach et al., 1994 [this issue of Neuron]). Although an interaction between these two half-domains could potentially occur in a "trans" fashion across the membrane, a "cis" interaction on the same side of the membrane, as in the bacterial glutamine binding proteins, seems more likely. Our view that L3 is intracellular is further supported by the observation that 2 cysteine residues located in L3 are responsible for redox modulation of the NMDA receptor (Sullivan et al., 1994). Incidentally, our finding that all six native N-glycosylation sites of GluR1 are glycosylated parallels findings for the a and 15 subunits of the nAChR, which are also glycosylated at all native sites (Chavez and Hall, 1991; Strecker et al., 1994).

Phosphorylation Studies and Topology Several studies of GluR phosphorylation have examined kinase consensus sites present in the L3 domain. For example, atyrosine kinase site has been proposed for GluR1 at Y643 (Moss et al., 1993), a calcium/calmodulin-dependent protein kinase II (CaMKII) site was suggested for GluR1 at $627 (McGlade-McCulloh et al., 1993), and phosphorylation of GluR6 by cyclic AMP-dependent protein kinase (PKA) at residue $684 has been proposed by two groups (Raymond et al., 1993; Wang et al., 1993; see Figu re 1B). For any of these sites to be phosphorylated, they would have to be localized intracellularly. However, our experiments demonstratethat L3 is an entirely extracellular domain in GluR1. A glycosylation site (mutant EG13) placed at position Y643 (the putative tyrosine kinase site of GluR1) was glycosylated (Figure 3B). We also introduced several glycosylation sites around the potential CaMKII site $627 (mutant EG12) and found that this cluster mutant was also glycosylated (Figure 3B). Similarly, mutants EG14 and EG15 were placed immediately adjacent to both sides of site $676, which in GluR1 is analogous to the putative PKA site $684 of GluR6. Both mutants were glycosylated (Figure 3), a result that is incompatible with the sites' being intracellular. How can the contradictory data from glycosylation and phosphorylation studies be reconciled? There is the formal possibility that GluR6 has a topology different from that of GluR1. However, considering the substantial sequence homology between kainate and AMPA receptors (36%-41%; Hollmann and Heine-

mann, 1994), this appears unlikely. Furthermore, it would solve onlythe problem of the PKA site of GluR6, not those of tyrosine kinase and the CaMKII sites of GluR1. The tyrosine kinase site at Y643 was proposed since it is the only consensus site for this kinase in GluR1. Neither site-directed mutagenesis data nor sequence data of the single tyrosine-phosphorylated peptide fragment of GluR1 (Moss et al., 1993) are available to support the assignment. Thus, it seems possible that phosphorylation observed in that study took place at another, nonconsensus tyrosine. Alternatively, the observed phosphorylation might represent a cell culture artifact. Phosphorylation of GluR1 by tyrosine kinase was analyzed by coexpression of protein tyrosine kinase v-src with GluR1 in embryonic kidney 293 cells (Moss et al., 1993). It is conceivable that lysed cells released v-src into the medium that then phosphorylated GluR1 at an extracellular tyrosine residue. CaMKII-mediated phosphorylation was investigated by in vitro experiments using baculovirus-expressed protein. This method cannot distinguish between phosphorylation of extracellular and intracellular sites. There are a total of ten consensus sites (Ken nelly and Krebs, 1991) present in the entire GluR1, and site S627was chosen because it is conserved between several GluRs and located in a putative intracellular domain. In our three TMD model, there are three intracellular CaMKII consensus sites available in the C-terminus ($818, T840, and $863), one in L1 (T559), and one in L2 ($593), any of which could account for the observed phosphorylation. As for the PKA-mediated phosphorylation reported for GluR6 (Raymond et al., 1993; Wang et al., 1993), the authors argue that site S684 is the only strong PKA consensus site (RRXS) in the protein and thus the only candidate site for the serine phosphorylation they observed. However, a consensus sequence that includes 95% of all known PKA sites (RX(X)S/T; Kennelly and Krebs, 1991) is found at four sites in GluR6 (Hollmann and Heineman n, 1994)when the intracellular domains predicted by model 2 of Figu re 1A are analyzed. When the intracellular domains of the threeTMD model proposed in the present paper are considered, three potential PICA sites are found in GluR6: one at $554 in L1, one at S837 in the C-terminus, and a possible third site at $593, which is located at the very C-terminal end of TMD II and might potentially be accessible to phosphorylation. Thus, PKA-mediated phosphorylation of GluR6 could well take place at sites other than the proposed S684. Furthermore, the mutagenesis experiments performed by Raymond et al. (1993) to prove phosphorylation at $684 are not conclusive, since the mutant GluR6-S684A is still phosphorylated to some extent (see their Figure 2a); this is not consistent with $684 being the only site of phosphorylation. No data were provided to demonstrate that the phosphopeptide observed by Raymond et al. (1993) maps tothe consensus site. Raymond et al. (1993) found that GluR6-S684A completely blocked the PKA-mediated

Neuron 1340

increase in glutamate-gated currents and interpreted this as evidence that $684 is the p h o s p h o r y l a t i o n site. However, using the same mutant (GluR6-S684A), Wang et al. (1993) w e r e unable to d e m o n s t r a t e a total block. In fact, they f o u n d significant p o t e n t i a t i o n , and only a second m u t a t i o n , introduced at $666 (which is not a consensus site for PKA), entirely abolished the PKA effect. In v i e w of these conflicting data, w e suggest that $684 of GluR6 is not an intracellular PKA p h o s p h o r y l a t i o n site, but is rather an extracellular site. It could be speculated that this site is involved in a structural d o m a i n that relays m o d u l a t i o n of receptor function o r i g i n a t i n g in a different part o f the protein to the ion channel. Interestingly, t w o recent reports (Roche et al., 1994; Taverna et al., 1994) s h o w e d that GluR6 is glycosylated at position N720, near the m i d d l e of L3. O u r data confirm these results for GluR1, since the m u t a n t EG16, made at the equivalent position in GluR1 (N715), is also glycosylated. Based on this mutant, both g r o u p s proposed a fifth TMD, located between the p r o p o s e d PKA site at $684 and t h e d e m o n s t r a t e d N-glycosylation site at N720 (Roche et al., 1994; Taverna et al., 1994; Figure 1A, m o d e l 4). However, there is no evidence for a h y d r o p h o b i c d o m a i n in this region. In fact, the 35 a m i n o acids between $684 and N720 include 8 charged residues, r e n d e r i n g this region an unlikely candidate for a TMD. Moreover, the m u t a n t EG15, w h i c h is glycosylated (Figure 3B), is located in the region of GluR1 that is equivalent to the p r o p o s e d fifth T M D of GluR6. While this m a n u s c r i p t was in preparation, the cloning of t w o goldfish kainate b i n d i n g proteins (GFKAR~ and GFKARI3) of 41 k D a w a s reported (Wo and Oswald, 1994). These proteins s h o w sequence and structural homology w i t h the previously cloned frog and chicken kainate b i n d i n g proteins (Gregor et al., 1989; Wada et al., 1989) and, to a lesser extent, w i t h m a m m a l i a n GluRs. The biological f u n c t i o n of these proteins, however, is u n k n o w n , as they c o u l d not be s h o w n to form functional ion channels. Interestingly, these proteins contain several consensus sites for N-glycosylation in L3 (but none in the N-terminus), and the authors showed that at least t w o of the sites are glycosylated in GFKARm They also showed that d e l e t i o n of the putative T M D II d i d not change the glycosylation pattern, and c o n c l u d e d that TMD II did not span the m e m b r a n e and that L3 was extracellular. They proposed a three T M D m o d e l for the t o p o l o g y of the t w o GFKAR proteins that is identical to o u r m o d e l (Figure 1A, models 5a and 5b) for the GluR1 t o p o l o g y .

Experimental Procedures Mutagenesis N-glycosylation sites (consensus sequence NXS or NXT; Hart et al., 1978) were introduced by overlap extension polymerase chain reaction (PCR). Sites were selected in such a way that in most cases1 of the 2 consensus amino acids was already present in wild-type GluR1; thus, only a single mutation was required to build the entire consensus site. Briefly, oligonucleotide primers of 24-60 bp length, depending on the number of N-glyco-

sylation sites to be introduced, were synthesized on an Applied Biosystems model 392 DNA synthesizer. Primers were made for both strands across the site to be mutated. These two primers were corn bined with upstream and downstream primers, respectively, in two PCR reactions with GluR1 in pBluescript SK(-) (Hollmann et al., 1989) as the template. This generated an upstream and a downstream fragment, both of which contained the mutated sites and overlapped at those sites. The two fragments were purified from low-melt agarose gels and combined in a second round of PCR in which the overlaps were extended during the first cycle. The resulting combined fragments were then amplified using the same upstream and downstream primers as in the first PCR. Up to four N-glycosylation sites were introduced simultaneously with this method within a stretch of 30-40 bp. Additionally, a silent mutation creating an analytical restriction site was introduced into every mutant to facilitate the rapid analysis of mutant clones. PCR conditions were 1 ng of template DNA, 10 mM Tris-HCI (pH 8.3), 50 mM KCI, 1.5 mM MgCI2, 0.01% gelatin, 50 p.M each of dATP, dGTP, dCTP, and dl-IP, 100 pmol of each primer, and 2 U of AmpliTaq DNA polymerase. Reaction cycle was 2 min at 95°C for denaturation followed by 30 cycles of 30 s at 50°C for annealing, 2.5 rain at 72°C for extension, and 30 s at 95°C for denatu ration. PCRfragments containing the desired mutations were cut with convenient restriction sites present in the GluR1 sequence to obtain cassettesof -400-800 bp, which were exchanged for the respective wild-type cassettesof GluR1. The following cassettes were used (nucleotides [nt] are numbered starting with the codon for the first amino acid of the mature protein): NarI-Mrol (nt 1024-1778), BgllI-Bglll (nt 1560-1970), MroI-Ball (nt 17782405), and Eco47111-Xhol(nt 2344-2760). All mutations were verified by double-stranded DNA sequencing with the dideoxynucleotide chain termination method (Sanger et al., 1977), employing the Sequenase 2.0 sequencing kit (United States Biochemicals) and synthetic oligonucleotide primers. Sequence analysiswas performed using the University of Wisconsin software package (Devereux et al., 1984). To facilitate analysis of glycosylation at engineered sites, the six native glycosylation sites in the N-terminal domain of GluR1 (at amino acids 45, 231,239, 345, 383, and 388)were removed by site-directed mutagenesis as described above (the asparagines of the consensus sequence were converted into serines), resulting in a nonglycosylated receptor termed GluR1-ANG.

Engineeringof TMD Deletions To generate Glu R1-ATMD I, two Ndel sites were introduced into GluR1 by site-directed mutagenesis as described above. One of these sites was introduced upstream of TMD I (nt 1553-1558), the otherone downstream (nt 1631-1636).In the resulting mutant clone, Ndel was used to excise a fragment of 78 bp between nt 1555 and 1632. This manipulation deleted 26 amino acids in the protein, from Y519(2 amino acids N-terminal of TMD I) through P544 (5 amino acids C-terminal of TMD I). To create in-frame deletions of putative TMDs II and III (designated ATMD II and ATMD III, respectively), different strategies were employed. To generate GluR1-ATMD II, the enzyme Bglll was used to excise a 410 bp fragment from GluR1 that contains the TMD II region plus adjacent sequences. This fragment was purified and cut with Maelll, which generated three pieces of 122, 72, and 216 bp, respectively. The 72 bp fragment contains the TMD II region to be removed. The other two fragments (122 and 216 bp) were then re-ligated into the GluR1 "arms" from which the 410 bp fragment had initially been excised. This generated a 72 bp in-frame deletion that resulted in the removal of 24 amino acids, from D562 (5 amino acids N-terminal ofTMD II) through C585 (the C-terminal end of TMD II). To generate GluR1-ATMD III, two fragments containing the sequences N-terminal (up until a Mrol site at nt 1778)and C-terminal of TMD III (starting at a Bgll site at nt 1847), respectively, were generated by restriction digests and bridged by a synthetic linker between the Mrol and the Bgll sites designed to delete TM D II I. The l i n ker was created by an nealing two synthetic oligo-

Transmembrane Topology of GluR1 1341

nucleotides, a sense oligonucleotide (CCGGACGCATCTCCTCGTACACAGCCAACC) and an antisense oligonucleotide (TGGCTGTGTACGAGGAGATGCGT). Ligation of the linker with the N-and C-terminal fragments of GluR1 then created a 39 bp in-frame deletion that resulted in the removal of 13 amino acids within TMD III, from V597 (the second amino acid of TMD III) through 1609 (5 amino acids in front of the putative end of TMD III).

cRNA Synthesis Template was prepared from circular plasmid cDNA by linearizing with Xhol. cRNA was prepared from 0.5 Ilg of linearized template using an in vitro transcription kit (Stratagene) with a modified standard protocol that utilizes each of the nucleotides at 800 I~M (except for GTP at 200 ~M), 800 I~M mTGpppG (Pharmacia) for capping, and an extended reaction time of 3 hr with T3 polymerase. All cRNAs were trace-labeled with [=P]UTP (Amersham) to allow for quality checks by gel electrophoresis and calculation of the yield.

ElectrophysiologicalExperiments in XenopusOocytes Frog oocytes of stages V-V/were surgically removed from the ovaries of Xenopus laevis (Nasco) anesthetized with 3-aminobenzoic acid ethylester (1 g/I). Lumps of - 2 0 oocytes were incubated with 580 U/ml (=2.3 mg/ml) collagenase type I (Worthington) for 2.75 hr in calcium-free Barth's solution (see below) with slow agitation to remove the follicular cell layer, then washed extensively with Barth's solution (88 mM NaCI, 1.1 mM KCI, 2.4 mM NaHCO3, 0.3 mM Ca(NOb, 0.3 mM CaCI2, 0.8 mM Mg, 15 mM HEPES [pH 7.6 with NaOH]). Oocytes were maintained in Barth's solution supplemented with 100 V.g/ml gentamycin, 40 ~.g/ml streptomycin, 63 I~g/ml penicillin. Oocyteswere injected with 10 ng of cRNA 24 hr after collagenase treatment using a 10 p.I Drummond microdispenser. Then, 2-6 days after RNA injection, oocytes were recorded in frog Ringer's solution (115 mM NaCI, 2.5 mM KCl, 1.8 mM CaCl2, 10 mM HEPES [pH 7.2 with NaOH]) under voltage clamp at a holding potential of -70 mV, with an Axoclamp-2A amplifier (Axon Instruments). Voltage electrodes had a resistance of 1-4 M ~ and were filled with 3 M KCl; current electrodes had a resistance of -0.5 MC~ and were filled with 3 M CsCl. Agonist was pulse applied (1.6 ml per pulse) by superfusion at a flow rate of 4 ml/min in a 300 Ill chamber, and peak currents were recorded.

Gel Shift Assay for Receptor Glycosylation A crude membrane fraction was prepared from oocytes 3-6 days after RNA injection. Briefly, 20 oocytes were homogenized with a teflon pestle in 400 I~1of buffer H (1@) mM NaCI, 20 mM TrisHCI [pH 7.4], 1% Triton X-100 containing a cocktail of protease inhibitors: 1 mM phenylmethylsulfonyl fluoride, 2.5 I~g/ml pepstatin, 2.5 I~g/ml leu peptin, 20 Ilg/ml aprotinin, 20 I~g/ml benzamidine-hydrochloride). The homogenate was kept on a shaker at 4°C for 15 min, then spun down for 1 min at 16,000 x g to pellet yolk platelets and the melanin pigment. The supernatants containing the cytosol and the solubilized membranes were run on 40 cm DISC-PAGE SDS gels (Laemmli, 1970; 5% stacking gel, 7.5% separating gel; running time, 22 hr at 4°C) to facilitate separation of the glycosylated and nonglycosylated forms of GluR1 mutants, which can differ by as little as 3 kDa if a single site is glycosylated, or even less if the basic carbohydrate building block of 3 kDa is trimmed down in the Golgi apparatus. The region of the gel between 80 and 120 kDa, identified by prestained protein markers (Bio-Rad), was cut out and blotted (Towbin et al., 1979) onto nitrocellulose filters (Schleicher and SchiJII). Filters were blocked with 5% dry milk powder, 5% goat serum, 0.1% Triton X-100, 20 mM Tris-HCI (pH 7.6), 140 mM NaCl and probed (overnight at 4°C) with an affinity-purified rabbit antiserum kindly provided by Dr. Bob Wenthold. The antiserum was made against a C-terminal peptide of GluR1 (amino acids 877-889; Wenthold et al., 1992). Immunoreactive bands were detected by a peroxidase-labeled donkey anti-rabbit IgG antiserum (Jackson Lab) and visualized with the chernoluminescence method (ECL detection kit, Amersham). With this method, wildtype GluR1 protein from as little as one-eighth of an oocyte could

be detected as a distinct band at 105 kDa after 10 min of exposu re. Water-injected control oocytes gave no signals whatsoever. Some mutants were expressed at very low levels. In those cases, the mutant GluR1 protein was immunoprecipitated from crude membranes from 5 pooled oocytes. Immunoprecipitations were carried out overnight at 4°C with the affinity-purified rabbit antiserum in buffer H, followed by incubation with protein A-sepharose beads (Pharmacia) to pellet the immunocomplexes. The pellet was boiled in 40 I~1of SDS gel loading buffer for 5 min and spun down briefly, after which the supernatant was applied to the gel.

Inhibition of N-Glycosylationby Tunicamycin A proper nonglycosylated control was desirable in order to be able to judge whether a shift in molecular weight seen in the gel shift assays was really due to glycosylation and not just a structural change in the protein caused by the mutation. To obtain such a control, one can either deglycosylate the protein or prevent N-glycosylation from occurring in the first place. We preferred to prevent attachment of carbohydrates rather than remove them, since the glycosidases commonly used to remove carbohydrate side chains depend on unrestricted access to the cleavage sites and frequently leave some carbohydrate behind due to steric hindrance. Since this would obscure the interpretation of small gel shifts, we elected to use tunicamycin, an inhibitor of glycosylation (Duksin and Mahoney, 1982). Before injection (1 day) with in vitro transcribed RNA, oocytes were preinjected with 50 nl of 400 lig/lJ.I tunicamycin (=20 ng). Tunicamycin had been dissolved in dimethylsulfoxide at 10 mg/ml, then diluted to 4% dimethylsulfoxide, which does not adversely affect the oocytes.

Reagents Unless noted otherwise, all chemicals were purchased from Sigma. Restriction enzymes were from Boehringer, Promega, and NE Biolabs. All nucleotides were from Pharmacia, tunicamycin was from Boehringer, and AmpliTaq DNA polymerase was from Cetus.

Acknowledgments We would like to thank Dr. Robert Wenthold for generously providing affinity-purified polyclonal rabbit anti-GluR1 antibody, Dr. Nils Brose for help with the ECL detection method, Chris Boyer and James Nolan for excellent frog oocyte preparation, Drs. Jim Boulter, Miguel Garcia-Guzman, and Stephen Traynelis for many helpful discussions, and Dr. Jim Boulter for critical reading of the manuscript. This work was supported by a Heisenberg fellowship of the Deutsche Forschungsgemeinschaft to M. H., NINCDS grants NSl1549 and NS28709, and grants of the Human Frontiers of Science Program and the Muscular Dystrophy Association to S. H. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC Section 1734 solely to indicate this fact. Received September 14, 1994; revised October 17, 1994.

References Abeijon, C., and H irschberg, C. B. (1992).Topographyof glycosylation reactions in the endoplasmic reticulum. Trends Biochem. Sci. 17, 32-36. Ascher, P., and Nowak, L. (1988). The role of divalent cations in the N-methyI-D-aspartate responses of mouse central neurones in culture. J. Physiol. 399, 247-266. Aubert, J. P., Helbecque, N., and Loucheux-Levebvre, M. H. (1981). Circular dichroism studies of synthetic Asn-X-Ser/Thrcontaining peptides: structure-glycosylation relationship. Arch. Biochem. Biophys. 208, 20-29. Bamberg, K., and Sachs, G. (1994). Topological analysis of H+,K+-

Neuron 1342

ATPase using in vitro translation. J. Biol. Chem. 269,16909-16919. Barnard, E. A., Darlison, M. G., and Seeburg, P. (1987). Molecular biology of the GABA^ receptor: the receptor/channel superfamily. Trends Neurosci. 10, 502-508. Baude, A., Molnar, E., Latawiec, D., Mcilhinney, R. A. J., and Somogyi, P. (1994). Synaptic and nonsynaptic localization of the GluR1 subunit of the AMPA-type excitatory amino acid receptor in the rat cerebellum. J. Neurosci. 14, 2830-2843. Blackstone, C. D., Moss, S. J., Martin, L. J., Levey, A. I., Price, D. L., and Huganir, R. L. (1992). Biochemical characterization and localization of a non-N-methyl-o-aspartateglutamate receptor in rat brain. J. Neurochem. 58, 1118-1126. Blaschke, M., Keller, B. U., Rivosecchi, R., Hollmann, M., Heinemann, S., and Konnerth, A. (1993).A single amino acid determines the subunit-specific spider toxin block of alpha-amino-3-hydroxy-5methylisoxazole-4-propionate/kainate receptor channels. Proc. Natl. Acad. Sci. USA 90, 6528-6532. BIobel, G. (1980). Intracellular protein topogenesis. Proc. Natl. Acad. Sci. USA 77, 1496-1500. Boulter, J., Hollmann, M., O'Shea-Greenfield, A., Hartley, M., Deneris, E. S., Maron, C., and Heinemann, S. (1990). Molecular cloning and functional expression of glutamate receptor subunit genes. Science 249, 1033-1037. Burnashev, N., Monyer, H., Seeburg, P. H., and Sakmann, B. (1992a). Divalent ion permeability of AMPA receptor channels is dominated by the edited form of a single subunit. Neuron 8, 189-198. Burnashev, N., Schoepfer, R., Monyer, H., Ruppersberg, J. P., Gunther, W., Seeburg, P. H., and Sakmann, B. (1992b). Control by asparagine residues of calcium permeability and magnesium blockade in the NMDA receptor. Science 257, 1415-1419. Chavez, R. A., and Hall, Z. W. (1991). The transmembrane topologyofthe amino terminus of the o.subunit of the nicotinic acetylcholine receptor. J. Biol. Chem. 266, 15532-15538. Claudio, T., Ballivet, M., Patrick, J., and Heinemann, S. (1983). Nucleotide and deduced amino acid sequence of Torpedo californica acetylcholine receptor gamma subunit. Proc. Natl. Acad. Sci. USA 80, 1111-1115. Devereux, J., Haeberli, P., and Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucl. Acids Res. 12, 587-395. Devillers-Thiery, A., Galzi, J. L., Eisele, J. L., Bertrand, S., Bertrand, D., and Changeux, J. P. (1993). Functional architecture of the nicotinic acetylcholine receptor- a prototype of l igand-gated ion channels. J. Membr. Biol. 136, 97-112. Dingledine, R., Hume, R. I., and Heinemann, S. F. (1992). Structural determinants of barium permeation and rectification in non-NMDA glutamate receptor channels. J. Neurosci. 12, 40804087. Duksin, D., and Mahoney, W. C. (1982). Relationship of the structure and biological activity of the natural homologues of tunicamycin. J. Biol. Chem. 257, 3105-3109. Gregor, P., Mano, I., Maoz, I., McKeown, M., and Teichberg, V. I. (1989). Molecular structure of the chick cerebellar kainatebinding subunit of a putative glutamate receptor. Nature 342, 689. Guy, H. R., and Hucho, F. (1987).The ion channel of the nicotinic acetylcholine receptor. Trends Neurosci. 10, 318-321. Hart, G. W., Brew, K., Grant, G. A., Bradshaw, R. A., and Lennarz, W. J. (1978). Primary structural requirements for the enzymatic formation of the N-glycosidic bond in glycoproteins. J. Biol. Chem. 254, 9747-9753. Hirschberg, C. B., and Snider, M. D. (1987).Topography of glycosylation in the rough endoplasmic reticulum and Golgi apparatus. Annu. Rev. Biochem. 56, 63-87. Hollmann, M., and Heinemann, S. (1994). Cloned glutamate receptors. Annu. Rev. Neurosci. 17, 31-108. Hollmann, M., O'Shea-Greenfield, A., Rogers, S. W., and Heinemann, S. (1989). Cloning by functional expression of a member

of the glutamate receptor family. Nature 342, 643-648. Hullebroeck, M. F., and Hampson, D. R. (1992). Characterization of the oligosaccharide side chains on kainate binding proteins and AMPA receptors. Brain Res. 590, 187-192. Hume, R. I., Dingledine, R., and Heinemann, S. F. (1991). Identification of a site in glutamate receptor subunits that controls calcium permeability. Science 253, 1028-1031. Imoto, K. (1993). Ion channels: molecular basis of ion selectivity. FEBS Lett. 325, 100-103. Karlin, A. (1993). Structure of nicotinic acetylcholine receptors. Curr. Opin. Neurobiol. 3, 299-309. Kein~inen, K., Wisden, W., Sommer, B., Werner, P., Herb, A., Verdoorn, T. A., Sakmann, B., and Seeburg, P. H. (1990).A family of AMPA-selective glutamate receptors. Science 249, 556-560. Kennelly, P. J., and Krebs, E. G. (1991). Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases. J. Biol. Chem. 266, 15555-15558. K6hler, M., Bumashev, N., 5akmann, B., and Seeburg, P. H. (1993). Determinants of Ca2+ permeability in both TM1 and TM2 of high affinity kainate receptor channels: diversity by RNA editing. Neuron 10, 491-500. Kronquist, K. E., and Lennarz, W. J. (1978). Enzymatic conversion of proteins to glycoproteins by lipid-linked saccharides: a study of potential exogenous acceptor proteins. J. Supramol. Struct. 8, 51-65. Kuryatov, A., Laube, B., Betz, H., and Kuhse, J. (1994). Mutational analysis of the glycine-binding site of the NMDA receptor: structural similaritywith bacterial amino acid-binding proteins. Neuron 12, 1291-1300. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Landolt-Marticorena, C., and Reithmeier, R. A. F. (1994). Asparagine-linked oligosaccharides are localized to single extracytosolic segments in multi-span membrane glycoproteins. Biochem. J. 302, 253-260. McGlade-McCulloh, E., Yamamoto, H., Tan, S. E., Brickey, D. A., and 5oderling, T. R. (1993). Phosphorylation and regulation of glutamate receptors by calcium calmodulin-dependent protein kinase-II. Nature 362, 640-642. Molnar, E., Baude, A., Richmond, S. A., Patel, P. B., Somogyi, P., and Mcilhinney, R. A. J. (1993). Biochemical and immunocytochemical characterization of antipeptide antibodies to a cloned GluR1 glutamate receptor subunit: cellular and su bcellular distribution in the rat forebrain. Neuroscience 53, 307-326. Molnar, E., Mcllh inney, R. A. J., Baude, A., Nusser, Z., and 5omogyi, P. (1994). Membrane topology of the GluR1 glutamate receptor subunit: epitope mapping by site-directed antipeptide antibodies. J. Neurochem. 63, 683-693. Mori, H., Masaki, H., Yamakura, T., and Mishina, M. (1992).Identification by mutagenesis of a Mg2+-block site of the NMDA receptor channel. Nature 358, 673-675. Moriyoshi, K., Masu, M., Ishii, T., Shigemoto, R., Mizuno, N., and Nakanishi, S. (1991).Molecular cloning and characterization of the rat NMDA receptor. Nature 354, 31-37. Moss, S. J., Blackstone, C. D., and Huganir, R. L. (1993). Phosphorylation of recombinant non-NMDA glutamate receptors on serine and tyrosine residues. Neurochem. Res. 18, 105-110. Musshoff, U., Madeja, M., Bloms, P., Muschnittel, K., and Speckmann, E. J. (1992). Tunicamycin-induced inhibition of functional expression of glutamate receptors in Xenopus oocytes. Neurosci. Lett. 147, 163-166. Nakanishi, N., Shneider, N. A., and Axel, R. (1990). A family of glutamate receptor genes: evidence for the formation of heteromultimeric receptors with distinct channel properties. Neuron 5, 569-581. O'Hara, P. J., Sheppard, P. O., Th~gersen, H., Venezia, D., Haldeman, B. A., McGrane, V., Houamed, K. M., Thomsen, C., Gilbert, T. L., and Mulvihill, E. R. (1993). The ligand-binding domain in metabotropic glutamate receptors is related to bacterial periplas-

Transmembrane Topology of GluR1 1343

mic binding proteins. Neuron 11, 41-52. Petralia, R. S., and Wenthold, R. J. (1992). Light and electron immunocytochernical localization of AMPA-selective glutamate receptors in the rat brain. J. Comp. Neurol. 318, 329-354. Rapoport, T. A. (1985). Extensions of the signal hypothesis: sequential insertion model versus arnphipathic tun nel hypothesis. FEBS Lett. 187, 1-10. Raymond, L. A., Blackstone, C. D., and Huganir, R. L. (1993). Phosphorylation and modulation of recombinant GluR6 glutamate receptors by cAMP-dependent protein kinase. Natu re 361, 637-641. Roche, K. W., Raymond, L. A., Blackstone, C., and Huganir, R. L. (1994). Transmernbrane topology of the glutamate receptor subunit glur6. J. Biol. Chem. 269, 11679-11682. Rogers, S. W., Hughes, T. E., Hollmann, M., Gasic, G. P., Deneris, E. S., and Heinemann, S. (1991).The characterization and localization of the glutamate receptor subunit GluR1 in the rat brain. J. Neurosci. 11, 2713-2724. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain termination inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. Seeburg, P. H. (1993). The TiPS/TINS lecture: the molecular biology of mammalian glutamate receptor channels. Trends Pharmacol. Sci. 14, 297-303. Sommer, B., Kein~inen, K., Verdoorn, T. A., Wisden, W., Burnashev, N., Herb, A., K6hler, M., Takagi, T., Sakmann, B., and Seeburg, P. H. (1990). Flip and flop: a cell-specific functional switch in glutamate-operated channels of the CNS. Science 249, 15801585. Sommer, B., K6hler, M., Sprengel, R., and Seeburg, P. H. (1991). RNA editing in brain controls a determinant of ion flow in glutamate-gated channels. Cell 67, 11-19. Stern-Bach, Y., Bettler, B., Hartley, M., Sheppard, P. O., O'Hara, P. J., and Heineman n, S. F. (1994). Agonist selectivity of glutamate receptors is specified by two domains structurally related to bacterial amino acid binding proteins. Neuron 13, this issue. Strecker, A., Franke, P., Weise, C., and H ucho, F. (1994).All potential glycosylation sites of the nicotinic acetylcholine receptor subunit from Torpedo californica are utilized. Eur. J. Biochem. 220, 1005-1011. Sullivan, J. M., Traynelis, S. F., Chen, H.-S. V., Escobar, W., Heinemann, S. F., and Lipton, S. A. (1994). Identification of two cysteine residues that are required for redox modulation of the NMDA subtype of glutamate receptor. Neuron 13, 929-936. Surnikawa, K., Parker, I., and Miledi, R. (1988). Effect of tunicamycin on the expression of functional brain neurotransmitter receptors and voltage-operated channels in Xenopus oocytes. Mol. Brain Res. 4, 191-199. Taverna, F. A., Wang, L. Y., Macdonald, J. F., and Hampson, D. R. (1994).A transmembrane model for an ionotropic glutamate receptor predicted on the basis of the location of asparaginelinked oligosaccharides. J. Biol. Chem. 269, 14159-14164. Tingley, W. G., Roche, K. W., Thompson, A. K., and Huganir, R. L. (1993). Regulation of NMDA receptor phosphorylation by alternative splicing of the C-terminal domain. Nature 364, 7073. Towbin, H., St~ihelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350-4354. Uchino, S., Sakirnura, K., Nagahari, K., and Mishina, M. (1992). Mutations in a putative agonist binding region of the AMPAselective glutamate receptor channel. FEBS Lett. 308, 253-257. Unwin, N. (1993). The nicotinic acetylcholine receptor at 9,g, resolution. J. Mol. Biol. 229, 1101-1124. Verdoorn, T. A., Burnashev, N., Monyer, H., Seeburg, P. H., and Sakmann, B. (1991). Structural determinants of ion flow through recombinant glutamate receptor channels. Science 252, 17151718.

Wada, K., Dechesne, C. J., Shimasaki, S., King, R. G., Kusano, K., Buonanno, A., Harnpson, D. R., Banner, C., Wenthold, R. J., and Nakatani, Y. (1989). Sequence and expression of a frog brain complementary DNA encoding a kainate-binding protein. Nature 342, 684. Wang, L.-Y., Taverna, F. A., Huang, X.-P., MacDonald, J. F., and Hampson, D. R. (1993). Phosphorylation and modulation of a kainate receptor (GluR6) by cAMP-dependent protein kinase. Science 259, 1173-1175. Wenthold, R. J., Yokotani, N., Doi, K., and Wada, K. (1992). Irnrnunochemical characterization of the non-NMDA glutamate receptor using subunit-specific antibodies: evidence for a heterooligorneric structure in rat brain. J. Biol. Chem. 267, 501-507. Wo, Z. G., and Oswald, R. E. (1994). Transmernbrane topology of two kainate receptor subunits revealed by N-glycosylation. Proc. Natl. Acad. Sci. USA 91, 7154-7158. Wright, M. S., Sefland, I., and Walaas, S. I. (1993). Cloning of the long intracellular loop of the AM PA-selective glutamate receptor for phosphorylation studies. J. Recept. Res. 13, 653-656. Yellen, G., Jurrnan, M. E., Abramson, T., and MacKinnon, R. (1991). Mutations affecting internal TEA blockade identify the probable pore-forming region of a K+ channel. Science 251, 939942. Yool, A. J., and Schwarz, T. L. (1991). Alteration of ionic selectivity of a K÷ channel by mutation of the H5 region. Nature 349, 700704.