N-WASP knockdown upregulates inflammatory cytokines expression in human gingival fibroblasts

Journal Pre-proof N-WASP Knockdown Upregulates Inflammatory Cytokines Expression in Human Gingival Fibroblasts Yijia Wang, Wenyan Kang, Lingling Shang, Aimei Song, Shaohua Ge

PII:

S0003-9969(19)30801-5

DOI:

https://doi.org/10.1016/j.archoralbio.2019.104605

Reference:

AOB 104605

To appear in:

Archives of Oral Biology

Received Date:

9 August 2019

Revised Date:

6 November 2019

Accepted Date:

7 November 2019

Please cite this article as: Wang Y, Kang W, Shang L, Song A, Ge S, N-WASP Knockdown Upregulates Inflammatory Cytokines Expression in Human Gingival Fibroblasts, Archives of Oral Biology (2019), doi: https://doi.org/10.1016/j.archoralbio.2019.104605

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

N-WASP Knockdown Upregulates Inflammatory Cytokines Expression in Human Gingival Fibroblasts

Running headline: Effects of N-WASP knockdown on human gingival fibroblasts

Yijia Wang, Wenyan Kang, Lingling Shang, Aimei Song, Shaohua Ge*

ro of

[email protected]

Department of Periodontology, School and Hospital of Stomatology, Shandong

University & Shandong Provincial Key Laboratory of Oral Tissue Regeneration &

-p

Shandong Engineering Laboratory for Dental Materials and Oral Tissue Regeneration,

*

re

Address：No.44-1 Wenhua Road West, 250012, Jinan, Shandong, China

Corresponding author: Prof. Shaohua Ge, Department of Periodontology,

lP

School and Hospital of Stomatology, Shandong University & Shandong Provincial Key Laboratory of Oral Tissue Regeneration & Shandong Engineering Laboratory for Dental Materials and Oral Tissue Regeneration, No. 44-1 Wenhua Road West, Tel: +86-531-88382123; Fax: +86-531-88382923

ur

na

Jinan 250012, China.,

Highlights:

Jo

N-WASP deficiency caused periodontal tissue inflammation in mice. N-WASP knockdown upregulated IL-6, IL-8, CCL2, SOD2 and PTGS2 in HGFs. N-WASP deficiency upregulated inflammatory cytokine expression via NF-κB and MAPK signaling pathways in HGFs.

Abstract Objective: The neuronal wiskott-aldrich syndrome protein (N-WASP) is a member of the

wiskott-aldrich syndrome protein (WASP) family. N-WASP plays a vital role in promoting cell migration, receptor signaling and immune inflammatory responses. This study aimed to observe the changes in the expression of inflammatory factors and involving pathways after N-WASP knockdown in human gingival fibroblasts (HGFs).

ro of

Design: Gingival inflammatory condition of N-WASP knockout mice was evaluated by

H&E staining. N-WASP in HGFs was knockdown by siRNA and the best knockdown efficiency was determined by qRT-PCR and immunofluorescence. The mRNA levels

of interleukin (IL)-6, IL-8, C-C motif ligand 2 (CCL2), superoxide dismutase 2 (SOD2)

-p

and prostaglandin endoperoxide synthase 2 (PTGS2) were evaluated by qRT-PCR after N-WASP knockdown with or without mitogen-activated protein kinase (MAPK) and

re

nuclear factor-κB (NF-κB) inhibitors. The protein levels of IL-6, IL-8 and CCL2 were

MAPK signaling pathways.

lP

assessed by ELISA. Western blotting was used to detect the activation of NF-κB and

Results: Gingival tissue from N-WASP knockout mice exhibited an inflammatory

na

reaction. The expression of IL-6, IL-8, CCL2, SOD2 and PTGS2 was significantly upregulated after N-WASP knockdown in HGFs for 6, 24 and 48 h, except for the SOD2 at 6 h. N-WASP knockdown significantly activated the signaling pathways of NF-κB

ur

and MAPK. The inhibitors of p65, p38, ERK and JNK clearly decreased IL-6, IL-8, CCL2, SOD2 and PTGS2 expression after N-WASP knockdown.

Jo

Conclusion: These data indicated that N-WASP deficiency in HGFs increases the production of inflammatory cytokine and is regulated via NF-κB and MAPK signaling pathways.

Keywords: N-WASP; human gingival fibroblasts; inflammation cytokine; psoriasis

1. Introduction

Wiskott-aldrich syndrome (WAS) is an X-linked disease characterized by eczema, thrombocytopenia, immunodeficiency and autoimmunity (Catucci, Castiello, Pala, Bosticardo, & Villa 2012). The appearance of WAS is associated with various genes mutation in wiskott-aldrich syndrome protein (WASP). N-WASP is a vital component of WASP family involved in actin cytoskeletal reorganization (Stradal et al., 2004). Li et al found that N-WASP knockout caused immunodeficiency and chronic skin inflammation in mice, mainly as psoriasis (Li et al., 2018). The immunopathogenesis of psoriasis consists of the complex interplay among innate and acquired immune cell

ro of

types and immune factors produced by dendritic cells (DCs), T cells and keratinocytes in the psoriatic plaque (Levine & Gottlieb 2009). Additionally, bacteria played an

important role in the immunopathogenesis of psoriasis (Fry, Baker, Powles, & Engstrand, 2015). The appearance and aggravation of psoriatic lesions were associated

-p

with the production of inflammatory mediators such as interleukin (IL)-6, plasminogen activator inhibitor 1 (PAI-1) and some hormones (leptin, resistin), which elevated

re

chronic pro-inflammatory status (Naldi, 2016).

Chronic periodontitis is also a chronic inflammatory disease characterized by the

lP

destruction of supporting tissues of the teeth, which eventually leads to alveolar bone resorption and tooth loss. It is well known that the occurrence of periodontitis is caused

na

by a complex and diverse microbial biofilm formed on the teeth. Porphyromonas gingivalis (P. gingivalis) is one predominant bacterium among gram-negative anaerobic bacteria, which is one of the suspected periodontal pathogens and is

ur

frequently isolated from periodontal pockets of patients with chronic periodontitis (Kang, Hu, & Ge, 2016). As the important constituents of gingival connective tissue,

Jo

human gingival fibroblasts (HGFs) may directly interact with bacteria and bacterial products (Takeuchi et al., 2001). HGFs could produce proinflammatory cytokines when stimulated with lipopolysaccharide (LPS), which is one of the virulence factors of P. gingivalis (Wang et al., 1999). The production of IL-1β, IL-6 and IL-8 in HGFs was significantly enhanced under the induction of P. gingivalis, indicating that the dysregulation of inflammatory cytokines is related to the pathogenesis of periodontal disease (Ariyoshi, Okinaga, Knudson, Knudson, & Nishihara, 2014). In addition to IL-

6 and IL-8, C-C motif ligand 2 (CCL2), superoxide dismutase 2 (SOD2) and prostaglandin endoperoxide synthase 2 (PTGS2) were found to be upregulated in patients with periodontitis (Damgaard et al., 2016; Yoon, Kim, Lee & Kim 2018; Mendes et al., 2014). Nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathways were both involved in the development of periodontitis (de Souza, Rossa, Garlet, Nogueira, & Cirelli, 2012). Both chronic periodontitis and psoriasis are chronic inflammatory diseases. Psoriasis has the same inflammatory process with periodontitis (Antal, Braunitzer,

ro of

Mattheos, Gyulai, & Nagy, 2014). It is established that the immunopathogenesis of psoriasis and the aggravation of periodontitis are linked with altered T-lymphocytemediated immunity (Ohlrich, Cullinan, & Seymour, 2009). A previous study showed

that salivary expression of tumor necrosis factor (TNF)‐ α, transforming growth factor

-p

(TGF)‐ β1, IL‐ 1β and CCL2 was statistically significantly higher in psoriasis, with a positive correlation between TGF‐ β1, IL‐ 1β, CCL2 expression and oral disease

re

severity (Ganzetti et al., 2015). Besides, smoking affected the progression and prognosis of these two diseases as a risk factor (Mendes, Cota, Costa, Oliveira, & Costa,

lP

2019).

N-WASP is associated with psoriasis, and psoriasis has the same risk factors and

na

inflammatory processes as periodontitis. Therefore, we speculate that N-WASP may play a role in the pathogenesis of periodontitis, and there is no report on this aspect. Therefore, this present study aimed to evaluate the effect of N-WASP knockdown on

ur

the expression of inflammatory cytokines in HGFs, as well as the underneath

Jo

mechanisms.

2. Materials and methods

2.1. Gingival tissue of N-WASP knockout mice and hematoxylin-eosin (H&E) staining The gingival tissue samples of N-WASP knockout mice (Li et al., 2018) were kindly provided by Dr. Hui Li (Department of Biomedical Sciences, University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen, Denmark). Mice were

129Sv/C56Bl6 outbred with keratinocyte-restricted deletion of N-WASP gene (NWASP fl/ fl K5 cre). All of the gingival tissue specimens were fixed with 4% paraformaldehyde (Solarbio, Beijing, China) at 4 °C for 12 h. Then, the samples were dehydrated, embedded with paraffin and sliced into 5 μm sections for further experiments. The paraffin sections were dewaxed twice in xylene (5 min for each) and rehydrated in gradient alcohol (100%, 100%, 95%, 95%, 80%, and 70%; 3 min for each). After being washed with running water for 5 min, the sections were stained with hematoxylin for 7 min. Next, the sections were stained with eosin for 1 min. The

ro of

sections were then dehydrated with gradient alcohol (95%, 95%, 100%, and 100%; 30 sec for each), cleared in xylene for 10 min, and mounted with neutral balsam. Histopathological changes in the tissue were observed and photographed with a light

-p

microscope (OLYMPUS BX51, Tokyo, Japan).

2.2. Tissue collection and cell culture

re

The study protocol was approved by the Medical Ethical Committee of School of Stomatology, Shandong University (Protocol Number: GR201801). All the protocols

lP

were performed according to the guidelines of the Helsinki Declaration of 1975, as revised in 2013. After the participants signed the informed consent form, the healthy

na

gingival tissues of the impacted teeth were removed from three healthy donors. Before delivered to laboratory , the isolated gingival tissues were stored in Dulbecco’s modified Eagle’s medium (DMEM; Hyclone, Logan, UT, USA) with 5% antibiotics

ur

(100 U/mL of penicillin, 100 mg/mL of streptomycin; Sigma Aldrich, St Louis, MO, USA) in ice bath. Immediately, the tissues were washed thrice with phosphate-buffered

Jo

saline (PBS; Hyclone) containing 5% antibiotics (Sigma Aldrich) and then were minced into fragments (1-3 mm2) and digested with collagenase I (3 mg/mL; Sigma) and dispase II (4 mg/mL; Sigma) for 2 h at 37 °C. After termination of the digestion, the single-cell suspension was seeded into 25 cm2 air-permeable flasks and cultivated with DMEM supplemented with 20% foetal bovine serum (FBS; BioInd, Kibbutz, Israel) and 1% antibiotics at 37 °C in a 5% CO2 incubator. The culture medium was changed once every three days, and cells were passaged with 0.25% trypsin-EDTA (Solarbio)

solution till 80%-90% confluence. The passaged HGFs were then cultured in 10% FBS DMEM without antibiotics. The 3-5 generation cells were used for the following experiments.

2.3. siRNA transfection HGFs were seeded in six-well plates at a density of 2.5 × 105/well and reached 70%-80% confluence after incubation overnight at 37 °C. According to our previous study (Shang et al., 2018), HGFs were then transfected with 30 nmol/L siRNA (FAM-

ro of

siRNA; GenePharma, Shanghai, China) using lipofectamine 2000 (Invitrogen, Cal, USA) to determine the transfection efficiency. The cells transfected with negative

control siRNA (Table 1) was used as negative control for siRNA transfection. HGFs were incubated in reduced‐ serum medium (Opti-MEM; Gibco, Grand Island, NY,

-p

USA) for 6 h and replaced with DMEM containing 10% FBS and cultured for additional

re

24 and 48 h. RNA was extracted and the optimal sequence was detected.

2.4. Selection of siRNA sequences by total RNA extraction and quantitative real-time

lP

polymerase chain reaction (qRT-PCR)

To obtain the optimal N-WASP gene knockdown effect, three different small-

na

interfering sequences (497, 660, 786, Table 1) were respectively designed for N-WASP. RNA was separated with TRIzol (Takara, Kusatsu, Japan), and the messenger RNA (mRNA) concentrations of the samples were determined using the GeneQuant™ pro

ur

RNA/DNA Calculator spectro photo meter (Amersham Biosciences, Pittsburgh, PA, USA). mRNA was reverse transcribed to complementary DNA (cDNA) using

Jo

PrimeScript™ RT reagent kit with gDNA Eraser (Takara) with a thermal cycler. qRTPCR primers for N-WASP and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were listed in Table 2. qRT-PCR was performed in duplicate using LightCycler 480 II Real-Time PCR System (Roche, Basel, Switzerland) with a two-step method. Reactions involved a volume of 5 μL SYBR green I (Takara), 1 μL sample DNA, 3.6 μL double distilled water, 0.2 μL former primer and 0.2 μL reverse primer. The hot start enzyme was activated (95 °C for 30 s), and cDNA was then

amplified for 50 cycles consisting of denaturation at 95 °C for 5 s and extension at 60 °C for 30 s. A melt curve assay was then performed (95 °C for 5 s and then the temperature increased by 0.11 °C every 1 s) to detect the formation of primer-derived trimers and dimers. Melting curve analysis was used to test the specificity of PCR products. Expression levels of interested genes were normalized to GAPDH, by calculating the ΔCt (Ct gene of interest-average Ct housekeeping gene), and the expression of an interested gene was expressed as 2−(ΔCt).

ro of

2.5. Effects of N-WASP knockdown on inflammatory cytokine expression HGFs were transfected with 30 nmol/L siRNA N-WASP using lipofectamine 2000 (6 μL/well). Afterwards, HGFs were incubated in reduced-serum medium for 6 h and replaced with DMEM for cultured for additional 6, 24 and 48 h.

-p

After N-WASP knockdown, HGFs were incubated in DMEM containing 10 μM SP60012 (MedChemExpress, NJ, USA) (Nonaka et al., 2017), 10 μM U0126 (abcam)

re

(Nonaka et al., 2017), 10 μM SB203580 (abcam) (Kang, Shang, Wang, Liu, & Ge, 2018) or 5 μM BAY11-7082 (abcam) (Kang, Shang, Wang, Liu, & Ge, 2018) separately for

lP

48 h. The expression of IL-6, IL-8, CCL2, PTGS2 and SOD2 in gene level was detected through qRT-PCR. qRT-PCR primers for IL-6, IL-8, CCL2, PTGS2, SOD2 and

na

GAPDH were listed in Table 2. All experiments were repeated three times.

2.6. Measurement of IL-6, IL-8 and CCL2 levels by enzyme-linked immunosorbent

ur

assay (ELISA)

To clarify the effect of N-WASP knockdown on inflammatory cytokine protein

Jo

production, culture supernatants collected were centrifuged at 12,000 rpm for 5 min at 4 °C to pellet any presence of bacteria and dead cells and obtained pure supernatants. ELISA kits (BioLegend, San Diego, CA, USA) were used to determine the protein levels of IL-6, IL-8 and CCL2 according to manufacturer’s instructions. The optical absorbance values were measured by a microplate reader (SPECTROstar Nano; BMG Labtech) at 450 nm. All measurements were repeated three times.

2.7. Immunofluorescence To detect the effect of N-WASP knockdown on nuclear translocation of NF-κB p65, HGFs were transfected with siRNA for 6 h and then culture medium was replaced with DMEM containing 5% FBS and cultured for 6 h or 30 min. Afterwards, HGFs were fixed with 4% paraformaldehyde (Solarbio) for 10 min and then permeabilized using 0.5% Triton X-100 (Solarbio) for 10 min. After blocking with 10% normal goat serum, cells were incubated with an N-WASP antibody (1:300; abcam, Massachusetts, US) and an anti‐ RelA/p65 antibody (1:300; Proteintech, Chicago, IN, USA) at 4 °C

ro of

overnight, washed with PBS thrice, and incubated with Alexa Fluor 594-conjugated goat anti-rabbit IgG secondary antibody (1:400; Proteintech) in dark for 1 h at room

temperature . Nuclei were stained with 2-(4-Amidinophenyl)-6-indolecarba midine dihydrochloride (DAPI; Proteintech) in the dark for 5 min. Images were observed under

-p

a fluorescence microscope (OLYMPUS IX73, Tokyo, Japan) in the darkroom and

captured by the camera and examined using an imaging software (OLYMPUS cellSens

re

Standard 1.17).

lP

2.8. Protein isolation and western blot analysis

HGFs at a density of 2.5 × 105 cells/well were seeded in 6-well plates and

na

transfected for 6 h the same as mentioned above. Afterwards, culture medium was replaced with DMEM containing 5% FBS and cultured for 30 min. Treated cells were washed with ice-cold PBS (Hyclone) thrice and extracted with RIPA lysis buffer

ur

(Solarbio) containing 1% phenylmethanesulfonyl fluoride (Solarbio) and 1% phosphatase inhibitor (Boster, Wuhan, China) on ice. The concentration of protein was

Jo

determined by a BCA Protein Assay Kit (KeyGEN BioTECH, Nanjing, China). Equal loading quantity of protein (20 μg/lane) was separated by 10% gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene fluoride membranes (PVDF; Millipore, Billerica, MA, USA). After blocking with 5% nonfat milk for 1 h, membranes were probed with primary antibodies of the interested proteins overnight at 4 °C and incubated with horseradish peroxidase-conjugated secondary antibodies (1:10 000; Proteintech) for 1 h at room

temperature. The protein bands were visualized with enhanced chemiluminsescence reagents (Millipore) and scanned using an extra-sensitive imager (Amersham Imager 600; GE Healthcare Life Sciences, Pittsburgh, PA, USA). Image J 1.44 software (National Institutes of Health, USA) was used to quantify the protein expression. The primary antibodies and dilution ratio were as follows: rabbit anti-NF-κB p65 (1:1000; Cell Signaling Technology, MA, USA), rabbit anti-phospho-NF-κB p65 (1:1000; Cell Signaling Technology), rabbit anti-p38 (1:1000; Cell Signaling Technology), rabbit anti-phospho-p38 (1:1000; Cell Signaling Technology), rabbit anti-JNK (1:1000; Cell

ro of

Signaling Technology), rabbit anti-phospho-JNK (1:1000; Cell Signaling Technology), rabbit anti-ERK1/2 (1:1000; Cell Signaling Technology), rabbit anti-phospho-ERK1/2 (1:1000; Cell Signaling Technology). Experiments were repeated three times.

-p

2.9. Statistical analysis

All data were presented as mean ± standard deviation (SD). Tests were performed

re

with GraphPad Prism software (version 6, by MacKiev Software, Boston, MA, USA). Multiple comparisons were analyzed by one-way analysis of variance. The variance

lP

between the two groups was compared by t test with GraphPad Prism software (version 6, by MacKiev Software). A value of p < 0.05 was considered to indicate a statistically

na

significant difference.

ur

3. Results

3.1. Histological assessment of healthy and inflamed gingival tissue

Jo

The healthy gingival tissue in control group presented a typical appearance of

stratified squamous epithelium and loose connective tissue with fibers (Fig. 1A, B). However,

gingival

tissue

in

N-WASP

knockout

mouse

displayed

histopathological signs of inflammation, such as significant lymphocytic infiltration, epithelial spike elongation, loss of acinar morphology and acinus was replaced with lymphocytes (Fig. 1C, D).

3.2. Selection of siRNA sequence for the optimal N-WASP knockdown effect In order to optimize N-WASP knockdown sequence, 30 nmol/L was chosen as the optimal transfected concentration of siRNA according to our previous study [17] and HGFs transfected with FAM-siRNA were observed under an inverted microscope (Fig.2A-C). The results showed that 497 sequence exhibited the best knockdown effect after transfected for 24 and 48 h as indicated by qRT-PCR (Fig. 2D, E). The presence of transfected N-WASP was examined by immunofluorescence staining as shown in Fig.2F. N-WASP located in the cytoplasm and the cytoplasmic width of N-WASP

ro of

knockdown in HGFs was shallower than that of negative control group (NC), further demonstrated that the efficiency of N-WASP knockdown in HGFs.

3.3. N-WASP knockdown upregulated inflammatory cytokines expression

-p

To explore the effect of N-WASP knockdown on inflammatory cytokines

production at gene and protein levels, HGFs were transfected for 6, 24 and 48 h. qRT-

re

PCR was used to analyze gene expression of IL-6, IL-8, CCL2, SOD2 and PTGS2. ELISA was used to measure the production of IL-6, IL-8 and CCL2 at protein levels.

lP

The results revealed that N-WASP knockdown time-dependently augmented SOD2 (p <0.01), IL-6 (p <0.001), IL-8 (p <0.001) and CCL2 (p <0.001) expression in gene levels

na

compared with NC (Fig. 3A, C, D, E). The expression of PTGS2 in gene level was upregulated at 6, 24 and 48 h compared with NC, and the expression at 48 h was maximal (p <0.001) (Fig. 3B). As for ELISA results, the production of IL-6 was

ur

significantly promoted at 6 and 24 h compared with NC (p <0.01), but had no obvious difference at 48 h compared with NC (p>0.05) in Fig. 3F. As shown in Fig. 3G, the

Jo

production of IL-8 was significantly promoted at 24 and 48 h compared with NC (p <0.001) while there was nearly unchanged for 6 h. N-WASP knockdown significantly enhanced the production of CCL2 at 24 and 48 h compared with NC (p <0.001), whiles there was no difference at 6 h compared with NC (p>0.05) (Fig. 3H). Therefore, NWASP knockdown significantly upregulated the inflammatory cytokines in HGFs.

3.4. N-WASP knockdown activated NF-κB and MAPK signaling pathways

Afterwards, the underneath mechanisms by which N-WASP knockdown increased the production of inflammatory cytokines were investigated. Activation of NF-κB was determined by phosphorylation of p65 (p-p65) and subsequent translocation of NF-κB p65 from the cytoplasm to the nucleus. Western blotting showed that N-WASP knockdown significantly promoted the expression of NF-κB p65 (Fig. 4A). Nuclear translocation of NF-κB p65 was examined by immunofluorescence staining, as shown in Fig. 4B. NF-κB p65 of untreated HGFs was mainly localized in the cytoplasm and partially translocated to the nucleus when N-WASP knockdown. Similarly, Fig. 4C

ro of

showed that the phosphorylation levels of p38, c-Jun N-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK) were elevated in HGFs after N-WASP knockdown. To further confirmed the involvement of MAPK and NF-κb pathways after N-WASP knockdown, 10 μM JNK inhibitor (SP60012), 10 μM ERK inhibitor (U0126),

-p

10 μM p38 inhibitor (SB203580) and 5 μM p65 inhibitor (BAY11‐ 7082) were used to determine their effects on the aforementioned gene expressions. qRT-PCR was used to

re

analyze mRNA levels of IL-6, IL-8, CCL2, PTGS2 and SOD2. The results indicated that N-WASP knockdown enhanced IL-6, IL-8, CCL2, PTGS2 and SOD2 mRNA

lP

expression (p < 0.01). However, 10 μM SP60012, 10 μM U0126, 10 μM SB203580 and 5 μM BAY11‐ 7082 clearly inhibited IL-6, IL-8, CCL2, PTGS2 and SOD2 mRNA

ur

4. Discussion

na

expression in the N-WASP knockdown HGFs (p < 0.01) (Fig. 5A-E).

N-WASP is a widely expressed WASP family protein and regulates actin

Jo

polymerization by modulating the activity of Arp2/3 complex (Prehoda, Scott, Mullins, & Lim, 2000). The development of thymocytes is closely related to the regulation of the molecules of actin cytoskeleton upstream by N-WASP (Cotta-de-Almeida et al., 2007). Thus, N-WASP is critical for T cell development. A previous study proved that conditional knockout N-WASP in mice caused atopic dermatitis-like inflammation and a systemic immune response in the skin (Kalailingam et al., 2017). When N-WASP was ablated, immune cells were activated in the epidermis, and the expression of IL-6 and

IL-17 was induced by dermal T lymphocytes (Brooks, 2018). Subsequently, Li et al demonstrated that skin sections of N-WASP knockout mice of all ages showed mild to moderate epidermal hyperplasia and dermal cell proliferation in back, tail, eyelid, ear, nose and facial skin (Li et al., 2018). A series of inflammatory cytokines such as IL-1α, IL-6, interferon (IFN)-α and IFN-β were upregulated in the back skin compared with control mice (Li et al., 2018). The association between chronic dermatitis, an immunemediated inflammatory disease and periodontitis has been studied and recognized in the past few years (Brooks, 2018). The similarity of periodontitis and psoriasis is not

ro of

only that they are both chronic immune-mediated inflammatory diseases, but they share the standard immunopathogenic processes, such as the activation of innate and adaptive

immune responses and deregulation (Christophers, 2017; Christophers, Metzler, & Rocken, 2014). Likewise, our study demonstrated that the gingival epithelium and

-p

connective tissue of N-WASP knockout mice exhibited a similarly moderate

inflammatory reaction in skin. Therefore, we speculated that the deficiency of N-WASP

re

was related to inflammatory response in periodontal tissue.

HGFs, which are connective tissue cells that form a major part of periodontal

lP

tissue, participate in the inflammatory response of periodontitis (Scheres & Crielaard, 2013). Periodontitis is a multifactorial infection and immune inflammatory disease that

na

stems from the complex interaction between colonized microorganisms and host immune-inflammatory responses (D'Aiuto, Parkar, Brett, Ready, & Tonetti, 2004). The expression of inflammatory mediators in serum of patients with severe periodontal

ur

disease is significantly elevated (Trindade et al., 2014). Although HGFs are not natural inflammatory cells, they can be important determinants for the development of chronic

Jo

inflammatory diseases (Buckley et al., 2001; Flavell et al., 2008; Buckley, 2001). Also, they can provide signals that not only attract and regulate the infiltration of inflammatory cells to clear the infection at the necessary site, but also ensure clearance of the inflammatory cell infiltration after the initial inflammation has been resolved. Dysregulation of these processes may lead to prolonged inflammation (Trindade et al., 2014; Buckley et al., 2001; Buckley, 2011). Upon stimulation with bacteria and bacterial products, such as P. gingivalis LPS, HGFs can produce excessive potent

osteoclast activators, pro-inflammatory cytokines and chemokines in periodontal connective tissue, which create the microenvironment for periodontal destruction (D'Aiuto, Parkar, Brett, Ready, & Tonetti, 2004; Trindade et al., 2014). Accumulating evidence demonstrated that these inflammatory mediators such as IL-6, IL-8, CCL2, SOD2 and PTGS2 led to the pathologic process of periodontitis (Naruishi & Nagata, 2018; Shindo, Hosokawa, Hosokawa, & Shib, 2019; Mayadas, Cullere, & Lowell, 2014; Hu, Huang, & Chen, 2013; Hao et al., 2017). At present, there is no relevant literature to the role of N-WASP in HGFs.

ro of

In our study, we analyzed the expression of a series of cytokines involved in periodontitis. Not surprisingly, mRNA expression of IL-6, IL-8, CCL2, SOD2 and PTGS2 was enhanced after N-WASP knockdown in HGFs and reached the maximum at 48 h. However, the gene expression profiles of cytokines were not always consistent

-p

with secreted protein levels. In HGFs, the protein levels of IL-8 and CCL2 were time-

dependently augmented after N-WASP knockdown, which was consistent with mRNA

re

expression. Whereas, IL-6 protein production reached its maximum in a relatively short time compared with mRNA level. It was reported that mRNA levels are associated with

lP

transcription and protein levels are associated with translation (Wang et al., 2010). On one hand, mRNA and protein levels in a cell should be correlated to a certain degree

na

(Abreu, Penalva, Marcotte, & Vogel, 2009). On the other hand, the processes of transcription and translation are affected by a variety of factors. Protein regulation is complex and related to different levels, different times and different types (Abreu,

ur

Penalva, Marcotte, & Vogel, 2009). Expression of mRNA alone cannot promise the production of the corresponding protein, but other factors such as protein half-life and

Jo

rate of synthesis also affect protein expression levels (de Klerk & 't Hoen, 2015). Therefore, owing to the differences in post-transcriptional modifications and regulations, the correlation between mRNA levels will not necessarily be retained in the corresponding protein levels (Wang et al., 2010). As we all know, both NF-κB and MAPK pathways are related to the development of periodontitis. NF-κB pathway was considered as a prototypical proinflammatory signaling pathway, primarily based on its role in upregulating the expression of

proinflammatory genes (Lawrence, 2009). The phosphorylation of NF-κB p65 is essential for the transcriptional activation of the prototypical p65/p50 complex after nuclear translocation (Sakurai et al., 2003). Meanwhile, a previous study certified that NF-κB played a critical role in the development of periodontal diseases and expressed in HGFs (Hao et al., 2017). Besides, MAPK is also associated with LPS-induced proinflammatory mediator production and regulation of NF-κB, which is critical for the development of periodontal diseases (Kim et al., 2006; Li, Valerio, & Kirkwood, 2012). Therefore, the effect of N-WASP knockdown on MAPK phosphorylation was also

ro of

investigated. In our study, upon N-WASP knockdown, the phosphorylation level of p65 was activated by nuclear translocation of NF-κB p65 and the phosphorylation levels of p38, JNK and ERK were also promoted. In the meanwhile, the expression of inflammatory factors was reduced by the inhibitors of p65, p38, JNK and ERK after N-

to the activation of NF-κB and MAPK pathways.

-p

WASP knockdown. All of these results showed that N-WASP knockdown was related

re

Nevertheless, a previous study showed that the phosphorylation of p38, JNK and NF-κB were unchanged in N-WASP knockdown keratinocytes compared to control

lP

cells (Li et al., 2018), which was opposite to our results. The conflicting results might be attributed to the selection of different cells. It is reported that HGFs are more likely

na

to encounter cytokines due to their location in periodontal tissue than keratinocytes, indicating that HGFs are more likely to recognize and respond to changes in cytokine concentrations (Liu, Du, Chen, Hu, & Chen, 2013). In conclusion, our study proved

ur

that the increased production of inflammatory cytokines by N-WASP knockdown was regulated via NF-κB and ERK/MAPK signaling pathways.

Jo

To sum up, this is the first report about the relationship between N-WASP and

periodontal tissue inflammation. This research certified that N-WASP knockdown upregulated the levels of inflammatory cytokines in vitro and explored the underneath mechanisms. The proposed mechanism illustration was presented in Fig. 6. These preliminary findings suggested that N-WASP played a critical role in the immunopathogenesis of periodontal disease, while the exact mechanism of N-WASP in the pathogenesis of periodontitis needs further study to address.

5. Conclusion

The present study showed that N-WASP deficiency in HGFs increases the production of inflammatory cytokine and is regulated via NF-κB and MAPK signaling pathways, which indicated that low expression of N-WASP was associated with periodontal tissue inflammation and provided a new basis for the pathogenesis and

ro of

targeted therapy of periodontitis.

Conflict of interest The authors declare that they have no conflicts of interest.

Sources of funding

This research was supported by the National Natural Science

-p

Foundation of China (Nos. 81670993 and 81873716), Key Research and Development Program of Shandong Province (No. 2018GSF118065), The Fundamental Research

re

Funds of Shandong University (No. 2018JC005), Collaborative Innovation Center of Technology and Equipment for Biological Diagnosis and Therapy in Universities of

lP

Shandong, The National Key Research and Development Program of China (No.2017YFA0104604), Open Foundation of Shandong Provincial Key Laboratory of

na

Oral Tissue Regeneration (No. SDKQ201901, SDKQ201904) and The Construction Engineering Special Fund of “Taishan Scholars” of Shandong Province (No.

ur

tsqn20161068).

Ethical approval

Ethics approval was gained from the Medical Ethical Committee

Jo

of School of Stomatology, Shandong University (Protocol Number: GR201801).

Acknowledgments The authors acknowledge Dr. Hui Li in Department of Biomedical Sciences, University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen, Denmark for kindly providing the gingival tissue samples of N-WASP knockout mice.

References Abreu, R. D., Penalva, L. O., Marcotte, E. M., & Vogel, C. (2009). Global signatures of protein and mRNA expression levels. Molecular Biosystems, 5(12), 1512-1526. Antal, M., Braunitzer, G., Mattheos, N., Gyulai, R., & Nagy, K. (2014). Smoking as a Permissive Factor of Periodontal Disease in Psoriasis. Plos One, 9(3): e92333. Ariyoshi, W., Okinaga, T., Knudson, C. B., Knudson, W., & Nishihara, T. (2014). High molecular weight hyaluronic acid regulates osteoclast formation by inhibiting receptor activator of NF-

ro of

kappa B ligand through Rho kinase. Osteoarthritis and Cartilage, 22(1), 111-120.

Brooks, J. K. (2018). Psoriasis: A review of systemic comorbidities and dental management considerations. Quintessence International, 49(3), 209-217.

-p

Buckley, C. D. (2011). Why does chronic inflammation persist: An unexpected role for fibroblasts. Immunology Letters, 138(1), 12-14.

re

Buckley, C. D., Pilling, D., Lord, J. M., Akbar, A. N., Scheel-Toellner, D., & Salmon, M. (2001). Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation. Trends

lP

in Immunology, 22(4), 199-204.

Catucci, M., Castiello, M. C., Pala, F., Bosticardo, M., & Villa, A. (2012). Autoimmunity in Wiskott-Aldrich syndrome: an unsolved enigma. Frontiers in Immunology, 3: 209.

na

Christophers, E. (2017). Periodontitis and risk of psoriasis: another comorbidity. Journal of the European Academy of Dermatology and Venereology, 31(5), 757-758.

ur

Christophers, E., Metzler, G., & Rocken, M. (2014). Bimodal immune activation in psoriasis. British Journal of Dermatology, 170(1), 59-65..

Jo

Cotta-de-Almeida, V., Westerberg, L., Maillard, M. H., Onaldi, D., Wachtel, H., Meelu, P., et al. (2007). Wiskott-Aldrich syndrome protein (WASP) and N-WASP are critical for T cell development. Proceedings of the National Academy of Sciences of the United States of America, 104(39), 15424-15429.

D'Aiuto, F., Parkar, M., Brett, P. M., Ready, D., & Tonetti, M. S. (2004). Gene polymorphisms in pro-inflammatory cytokines are associated with systemic inflammation in patients with severe periodontal infections. Cytokine, 28(1), 29-34.

Damgaard, C, Kantarci, A, Holmstrup, P, Hasturk, H, Nielsen, C. H., & Van Dyke, T. E. (2016). Porphyromonas gingivalis-induced production of reactive oxygen species, tumor necrosis factor-α, interleukin-6, CXCL8 and CCL2 by neutrophils from localized aggressive periodontitis and healthy donors: modulating actions of red blood cells and resolvin E1. Journal of Periodontal Research, 52(2): 246-254. de Klerk, E., & 't Hoen, P. A. C. (2015). Alternative mRNA transcription, processing, and translation: insights from RNA sequencing. Trends in Genetics, 31(3), 128-139. de Souza, J. A. C., Rossa, C., Garlet, G. P., Nogueira, A. V. B., & Cirelli, J. A. (2012). Modulation

ro of

of host cell signaling pathways as a therapeutic approach in periodontal disease. Journal of Applied Oral Science, 20(2), 128-138.

Flavell, S. J., Hou, T. Z., Lax, S., Filer, A. D., Salmon, M., & Buckley, C. D. (2008). Fibroblasts as

novel therapeutic targets in chronic inflammation. British Journal of Pharmacology, 153, S241-

-p

S246.

Fry, L., Baker, B.S., Powles, A.V., & Engstrand, L. (2015) Psoriasis is not an autoimmune disease?

re

Experimental Dermatology, 24 (4):241-244.

Ganzetti, G., Campanati, A., Santarelli, A., Pozzi, V., Molinelli, E., Minnetti, I., et al. (2015).

lP

Involvement of the oral cavity in psoriasis: results of a clinical study. British Journal of Dermatology, 172(1), 282-285.

induced

na

Hao, C., Wu, B., Hou, Z., Xie, Q., Liao, T., Wang, T., et al. (2017). Asiatic acid inhibits LPSinflammatory

response

in

human

gingival

fibroblasts.

International

Immunopharmacology, 50, 313-318.

ur

Hu, P., Huang, P., & Chen, M. W. (2013). Curcumin attenuates cyclooxygenase-2 expression via Inhibition of the NF-kappaB pathway in lipopolysaccharide-stimulated human gingival

Jo

fibroblasts. Cell Biology International, 37(5), 443-448.

Kalailingam, P., Tan, H. B., Jain, N., Sng, M. K., Chan, J. S. K., Tan, N. S., & Thanabalu, T. (2017). Conditional knock out of N-WASP in keratinocytes causes skin barrier defects and atopic dermatitis-like inflammation. Scientific Reports, 7 (1):7311. Kang, W., Hu, Z., & Ge, S. (2016). Healthy and Inflamed Gingival Fibroblasts Differ in Their Inflammatory Response to Porphyromonas gingivalis Lipopolysaccharide. Inflammation, 39(5), 1842-1852.

Kang, W., Shang, L., Wang, T., Liu, H., & Ge, S. (2018). Rho-kinase inhibitor y-27632 downregulates lps-induced il-6 and il-8 production via blocking p38 mapk and nf-κb pathways in human gingival fibroblasts. Journal of Periodontology, 89(7), 883-893. Kim, H. G., Shrestha, B., Lim, S. Y., Yoon, D. H., Chang, W. C., Shin, D. J., et al. (2006). Cordycepin inhibits lipopolysaccharide-induced inflammation by the suppression of NFkappaB through Akt and p38 inhibition in RAW 264.7 macrophage cells. European Journal of Pharmacology, 545(2-3), 192-199. Lawrence, T. (2009). The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb

ro of

Perspect Biol, 1(6), a001651. Levine, D., & Gottlieb, A. (2009). Evaluation and Management of Psoriasis: An Internist's Guide. Medical Clinics of North America, 93(6), 1291-1303.

Li, H., Yao, Q., Mariscal, A. G., Wu, X. D., Hulse, J., Pedersen, E., et al. (2018). Epigenetic control

-p

of IL-23 expression in keratinocytes is important for chronic skin inflammation. Nature Communications, 9. (1):1420.

Journal of Signal Transduction, 308943.

re

Li, Q., Valerio, M. S., & Kirkwood, K. L. (2012). MAPK usage in periodontal disease progression.

lP

Liu, J., Du, X., Chen, J., Hu, L., & Chen, L. (2013). The induction expression of human betadefensins in gingival epithelial cells and fibroblasts. Archives of Oral Biology, 58(10), 1415-

na

1421.

Mayadas, T. N., Cullere, X., & Lowell, C. A. (2014). The Multifaceted Functions of Neutrophils. Annual Review of Pathology: Mechanisms of Disease, Vol 9, 181-218.

ur

Mendes, R. T., Sordi, R., Olchanheski, L. R., Machado, W. M., Stanczyk, C. P., Assreuy, J., et al. (2014). Periodontitis increases vascular cyclooxygenase-2: potential effect on vascular tone.

Jo

Journal of Periodontal Research, 49(1), 85-92.

Mendes, V. S., Cota, L. O. M., Costa, A. A., Oliveira, A. M. S. D., & Costa, F. O. (2019). Periodontitis as another comorbidity associated with psoriasis: A case-control study. Journal of Periodontology, 90(4), 358-366. Naldi, L. (2016). Psoriasis and smoking: links and risks. Psoriasis (Auckl), 6, 65-71. Naruishi, K., & Nagata, T. (2018). Biological effects of interleukin-6 on Gingival Fibroblasts: Cytokine regulation in periodontitis. Journal of Cellular Physiology, 233(9), 6393-6400.

Nonaka, K., Kajiura, Y., Bando, M., Sakamoto, E., Inagaki, Y., Lew, J. H., et al. (2017). Advanced glycation end-products increase il-6 and icam-1 expression via rage, mapk and nf-κb pathways in human gingival fibroblasts. Journal of Periodontal Research, 53(3), 334-344. Ohlrich, E. J., Cullinan, M. P., & Seymour, G. J. (2009). The immunopathogenesis of periodontal disease. Australian Dental Journal, 54, S2-S10. Prehoda, K. E., Scott, J. A., Mullins, R. D., & Lim, W. A. (2000). Integration of multiple signals through cooperative regulation of the N-WASP-Arp2/3 complex. Science, 290(5492), 801-806. Sakurai, H., Suzuki, S., Kawasaki, N., Nakano, H., Okazaki, T., Chino, A., et al. (2003). Tumor

ro of

necrosis factor-alpha-induced IKK phosphorylation of NF-kappaB p65 on serine 536 is mediated through the TRAF2, TRAF5, and TAK1 signaling pathway. The Journal of Biological Chemistry, 278(38), 36916-36923.

Scheres, N., & Crielaard, W. (2013). Gingival fibroblast responsiveness is differentially affected by

-p

Porphyromonas gingivalis: implications for the pathogenesis of periodontitis. Molecular Oral Microbiology, 28(3), 204-218.

re

Shang, L., Wang, T., Tong, D., Kang, W., Liang, Q., & Ge, S. (2018). Prolyl hydroxylases positively regulated LPS-induced inflammation in human gingival fibroblasts via TLR4/MyD88-

lP

mediated AKT/NF-kappa B and MAPK pathways. Cell Proliferation, 51(6): e12516. Shindo, S., Hosokawa, Y., Hosokawa, I., & Shiba, H. (2019). Interleukin (IL)-35 Suppresses IL-6

na

and IL-8 Production in IL-17A-Stimulated Human Periodontal Ligament Cells. Inflammation, 42(3), 835-840.

Stradal, T. E. B., Rottner, K., Disanza, A., Confalonieri, S., Innocenti, M., & Scita, G. (2004).

ur

Regulation of actin dynamics by WASP and WAVE family proteins. Trends in Cell Biology, 14(6), 303-311.

Jo

Takeuchi, Y., Umeda, M., Sakamoto, M., Benno, Y., Huang, Y., & Ishikawa, I. (2001). Treponema socranskii, Treponema denticola, and Porphyromonas gingivalis are associated with severity of periodontal tissue destruction. Journal of Periodontology, 72(10), 1354-1363.

Trindade, F., Oppenheim, F. G., Helmerhorst, E. J., Amado, F., Gomes, P. S., & Vitorino, R. (2014). Uncovering the molecular networks in periodontitis. Proteomics Clinical Applications, 8(9-10), 748-761. Wang, H. Y., Wang, Q., Pape, U. J., Shen, B. R., Huang, J. H., Wu, B., & Li, X. (2010). Systematic

investigation of global coordination among mRNA and protein in cellular society. BMC Genomics, 11: 364. Wang, P. L., Shirasu, S., Shinohar, M., Azuma, Y., Daito, M., Yasuda, H., et al. (1999). IL-10 inhibits Porphyromonas gingivalis LPS-stimulated human gingival fibroblasts production of IL-6. Biochemical and Biophysical Research Communications, 263(2), 372-377. Yoon, Y., Kim, T. J., Lee, J. M., & Kim, D. Y. (2018). SOD2 is upregulated in periodontitis to

Jo

ur

na

lP

re

-p

ro of

reduce further inflammation progression. Oral Diseases, 24(8), 1572-1580.

Figure Legends Fig. 1. Histological confirmation of gingival samples from control and N-WASP knockout mice (7 weeks) by H&E staining. (A, B) Representative images of healthy gingiva. (C, D) Representative images of inflamed gingiva (A, C magnification ×200, scale bar 50 μm; B, D magnification ×400 scale bar 20 μm). The boxed areas in (A) and (C) were enlarged in (B) and (D). The black arrows showed the acinus was replaced

na

lP

re

-p

ro of

with lymphocytes.

Fig. 2. The efficiency of N-WASP knockdown in HGFs. (A) HGFs transfected with 30

ur

nmol/L FAM-siRNA were observed under an inverted microscope. (B) Representative image under a fluorescence microscope after transfection. C Representative merge

Jo

images of (A) and (B) (magnification ×100, scale bar 100 μm). (D, E) HGFs were transfected with siRNA and total RNA was extracted for 24 and 48 (H) The expression of three N-WASP isoforms was assessed with qRT-PCR in HGFs. (F) The efficiency of N-WASP knockdown was evaluated by immunofluorescence staining (N-WASP, red fluorescent signals; DAPI, blue signals; magnification: ×200, scale bar 50 μm). *p <0.05, **

p < 0.01, ***p < 0.001 and ****p < 0.0001 compared with negative control group.

ro of

Fig. 3. The expression of IL-6, IL-8, CCL2, SOD2 and PTGS2 after N-WASP

-p

knockdown. (A-E) HGFs were respectively transfected with siN-WASP for 6, 24 and

48 h. The mRNA expression of SOD2, PTGS2, IL-6, IL-8 and CCL2 was detected by

re

qRT-PCR. (F-H) HGFs were respectively transfected with siN-WASP for 6, 24 and 48 h. The protein levels of IL-6, IL-8 and CCL2 were detected by ELISA. *p <0.05, **p <

Jo

ur

na

lP

0.01 and ***p < 0.001 compared with negative control group.

Fig. 4. Effects of N-WASP knockdown and the activation of NF-κB and MAPK pathways. (A, C) The protein levels of p65, p38, ERK and JNK were determined by western blotting. (B) The nuclear translocation of NF-κB p65 was evaluated by immunofluorescence staining (NF-κB p65, red fluorescent signals; DAPI, blue signals; magnification: ×200, scale bar 50 μm). *p <0.05, **p < 0.01 and ***p < 0.001 compared

lP

re

-p

ro of

with negative control group.

na

Fig. 5. Effects of BAY11-7082, SB203580, SP60012 and U0126 on IL-6, IL-8, CCL2, SOD2 and PTGS2 mRNA expression after N-WASP knockdown. HGFs were subjected

ur

to the various treatments, and then RNA was extracted for qRT‐ PCR analyses of (A) IL-6, (B) IL-8, (C) CCL2, (D) SOD2 and (E) PTGS2 mRNA levels normalized

Jo

to GAPDH mRNA expression. #p < 0.001 compared with negative control group. ***p < 0.001 compared with siN-WASP-alone group.

ro of

Fig. 6. Putative mechanism for the role of N-WASP knockdown in NF‐ κB and MAPK

signaling pathways. NF-κB and MAPK signaling pathways were activated via N-WASP knockdown to upregulate proinflammatory cytokine expression. Our study demonstrated that NF-κB p65/p50 heterodimer phosphorylation was activated by

-p

nuclear translocation of NF-κB p65. Likewise, the activation of MAPK

phosphorylation which was also promoted by N-WASP knockdown. Consequently, N-

re

WASP knockdown enhanced the expression of inflammatory cytokines. NF‐ κB,

lP

nuclear factor kappa B; MAPK, mitogen-activated protein kinase; JNK, c-Jun N-

Jo

ur

na

terminal kinase; ERK, extracellular signal regulated kinase.

Table 1

Sequences for small-interfering RNA

RNA oligo

Sense (5′- 3′)

Antisense (5′- 3′)

Negative control siN-WASP-497 siN-WASP-660 siN-WASP-786

UUCUCCGAACGUGUCACGUTT CCAGAAAUCACAACAAAUATT CAGGCUUUGAUCUGAAUAATT GAGGUGUUGAAGCUGUUAATT

ACGUGACACGUUCGGAGAATT UAUUUGUUGUGAUUUCUGGTT UUAUUCAGAUCAAAGCCUGTT UUAACAGCUUCAACACCUCTT

ro of

Primer sequences for qRT-PCR

Gene

5′-3′ forward

5′-3′ reverse

N-WASP IL-6 IL-8 CCL2

CCCCAAATGGTCCTAATCTACCC ATAACCACCCCTGACCCAAC TCAGAGACAGCAGAGCACAC CAGCCAGATGCAATCAATGCC

TGGAAATTGCTTGGTGTTCCTAT CCCATGCTACATTTGCCGAA GGCAAAACTGCACCTTCACA TGGAATCCTGAACCCACTTCT

PTGS2 SOD2

GCTGTTCCCACCCATGTCAA GGGATTGATGTGTGGGAGCA

-p

Table 2

Jo

ur

na

lP

re

AAATTCCGGTGTTGAGCAGT CATAAAGAGCTTAACATACTCAGCA