NAD binding by human CD38 analyzed by Trp189 fluorescence

Accepted Manuscript NAD binding by human CD38 analyzed by Trp189 fluorescence

Valerie Wolters, Anette Rosche, Andreas Bauche, Frederike Kulow, Angelika Harneit, Ralf Fliegert, Andreas H. Guse PII: DOI: Reference:

S0167-4889(18)30508-1 https://doi.org/10.1016/j.bbamcr.2018.11.011 BBAMCR 18399

To appear in:

BBA - Molecular Cell Research

Received date: Revised date: Accepted date:

30 July 2018 16 November 2018 16 November 2018

Please cite this article as: Valerie Wolters, Anette Rosche, Andreas Bauche, Frederike Kulow, Angelika Harneit, Ralf Fliegert, Andreas H. Guse , NAD binding by human CD38 analyzed by Trp189 fluorescence. Bbamcr (2018), https://doi.org/10.1016/ j.bbamcr.2018.11.011

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT NAD binding by human CD38 analyzed by Trp189 fluorescence Valerie Wolters, Anette Rosche, Andreas Bauche, Frederike Kulow, Angelika Harneit, Ralf Fliegert, and Andreas H. Guse The Calcium Signaling Group, Department of Biochemistry and Molecular Cell Biology, University Medical Centre Hamburg-Eppendorf, 20246 Hamburg, Germany Running title: NAD binding by human CD38

CR

IP

T

Correspondence: Andreas H. Guse, The Calcium Signaling Group, Department of Biochemistry and Molecular Cell Biology, University Medical Centre Hamburg-Eppendorf, Building N30, Martinistraße 52, 20246 Hamburg, Germany; Telephone: +49 (0)40 7410-53917; FAX: +49 (0)40 7410-54592; E-mail: [email protected]

ED

M

AN

US

Abstract The NAD-glycohydrolase/ADP-ribosyl cyclase CD38 catalyzes the metabolism of nicotinamide adenine dinucleotide (NAD) to the Ca2+ mobilizing second messengers ADP-ribose (ADPR), 2’-deoxyADPR, and cyclic ADP-ribose (cADPR). In the present study, we investigated binding and metabolism of NAD by a soluble fragment of human CD38, sCD38, and its catalytically inactive mutant by monitoring changes in endogenous tryptophan (Trp) fluorescence. Addition of NAD resulted in a concentration-dependent decrease in sCD38 fluorescence that is mainly caused by the Trp residue W189. Amplitude of the fluorescence decrease was fitted as one-site binding curve revealing a dissociation constant for NAD of 29 µM. A comparable dissociation constant was found with the catalytically inactive sCD38 mutant (KD 37 µM NAD) indicating that binding of NAD is not significantly affected by the mutation. The NAD-induced decrease in Trp fluorescence completely recovered in case of sCD38. Kinetics of recovery was slowed down with decreasing temperature and sCD38 concentration and increasing NAD concentration demonstrating that recovery in fluorescence is proportional to the enzymatic activity of sCD38. Accordingly, recovery in fluorescence was not observed with the catalytically inactive mutant.

PT

Keywords: CD38, conformational change, enzyme mechanism, nicotinamide adenine dinucleotide (NAD), tryptophan, fluorescence

AC

CE

Introduction Human CD38 was initially identified as a type II transmembrane glycoprotein in the cell membrane of lymphocytes. Its expression pattern depends on differentiation and activation state(s) of lymphocytes [1,2]. However, it recently became clear that CD38 is ubiquitously expressed in virtually all cell types [3,4]. Further, CD38 is not exclusively expressed on the plasma membrane [5,6]. It is well established that human CD38 is a multi-functional NAD glycohydrolase (EC 3.2.2.6.) [7,8]. In vitro, it catalyzes the synthesis of ADP-ribose (ADPR) and 2’deoxy-ADPR, as well as synthesis and hydrolysis of cyclic ADP-ribose (cADPR) and nicotinic acid adenine dinucleotide phosphate (NAADP) [3,9–11]. Catalytically important amino acids in the active site of CD38 have been identified by site-directed mutagenesis and by crystal structures in complex with various substrates and metabolites [12–15]. Glu226 was found to be of special importance for the enzymatic function of CD38, as any modification of this residue results in catalytic inactivity [12]. Furthermore, localization to the membrane is not required for the enzymatic activity of CD38 since a truncated version of human CD38 lacking N-terminus and the transmembrane domain, soluble CD38 (sCD38), has been described to be still catalytically active [12,16–18]. Binding and enzymatic metabolism of substrates result in conformational changes in human CD38, as demonstrated by crystal structures and biochemical assays [15,19]. These conformational changes can be detected by endogenous tryptophan (Trp) fluorescence of the protein, as previously described [20]. 1

ACCEPTED MANUSCRIPT

T

However, it remains elusive, which of the eight Trp residues mainly contribute to the fluorescence changes induced by substrate binding. In the present study we identified the Trp residue mainly responsible for the alterations in fluorescence and utilized the fluorimetric approach in order to investigate NAD- and nicotinamide mononucleotide (NMN)induced conformational changes in recombinantly expressed sCD38, and its catalytically inactive mutant, sCD38(E226Q). Recording the endogenous Trp fluorescence enables the detection of conformational changes in the proteins with high temporal resolution and without the need for exogenous fluorescent proteins or dyes. By analyzing alterations in Trp fluorescence, we characterized binding and metabolism of NAD by sCD38 and demonstrated that NAD is bound with comparable affinity by the catalytically inactive mutant.

AC

CE

PT

ED

M

AN

US

CR

IP

Experimental procedures Chemicals - LB-broth, LB-agar, milk powder, glycine and HEPES were purchased from Carl Roth (Karlsruhe, Germany). Dulbecco´s modified Eagle´s medium, fetal calf serum and penicillin/streptomycin were from Gibco (Fisher Scientific GmbH, Schwerte, Germany), ECL solution from GE Healthcare (Dornstadt, Germany), Agarose from Lonza (Basel, Switzerland) and Coomassie stain and TEMED were purchased from BioRad (Munich, Germany). All other substances were purchased from Sigma-Aldrich (Steinheim, Germany). Plasmids - A vector including the cDNA for human CD38 was kindly provided by Philippe Deterre (Faculté de Médecine, Pitié-Salpêtrière, Paris, France). The open reading frame encoding amino acids 44 to 300 (sCD38) was amplified by polymerase chain reaction and cloned by use of the restriction site BsaI into the eukaryotic expression vector pEXPR IBA 42 (IBA GmbH, Goettingen, Germany), which contains an Nterminal His-tag, a C-terminal Strep-tag, and the signal sequence BM40 for secretion into the supernatant. The E226Q mutant of this construct was generated by site-directed mutagenesis using the following primer: 5'-GCACTTTTGGGAGTGTGCAGGTC CATAATTTGCAACC-3'. Analogously the Trp-mutants were generated by the following primers 5'- GTCGTCCCGAGGTTCCGCCAGCAGTG GAG-3' (sCD38(W46F)), 5'-GCGCCAGCAGTTC AGCGGTCCGGGC-3' (sCD38(W50F)), 5'-GAC TGCCAAAGTGTATTCGATGCTTTCAAGGG TGC-3' (sCD38(W86F)), 5'-CAACAAGATTCTT CTTTTCAGCAGAATAAAAGATC-3' (sCD38(W125F)), 5'-GCTGATGACCTCACATT CTGTGGTGAATTCAACAC-3' (sCD38(W159F)), 5'-CAATCTTGCCCAGACTT CAGAAAGGACTGCAGC-3' (sCD38(W176F)), 5'-CCTGTTTCAGTATTCTTCAAAACGGTTTC CCGCAG-3' (sCD38(W189F)), 5'-CAGACACT AGAGGCCTTCGTGATACATGGTGGAAG-3' (sCD38(W241F)). Purification of sCD38 and sCD38-mutants - Protein expression was performed in HEK293 cells that were cultured at 37 °C in a humidified atmosphere with 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) (4.5 g/l glucose, GlutaMAX), supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 0.1 mg/ml streptomycin. Transient transfection of HEK293 cells with sCD38 or sCD38mutants was conducted with 9 µg plasmid DNA and 36 µg Polyethylenimine (PEI) solution per 10 cm dish in serum-free DMEM. After 16 h, medium was changed to DMEM supplemented with 1% fetal bovine serum. Three days after transfection, the medium was collected and the secreted protein was purified by its His-tag using Ni-NTA agarose (Qiagen GmbH, Hilden, Germany). Protein purity was confirmed by SDSPAGE and staining with Coomassie brilliant blue or Ponceau S solution (Fig. S1A). Determination of sCD38 catalytic activity - The catalytic activity of sCD38 was analyzed using the metabolism of 1,N6-etheno-NAD to 1,N6-etheno-ADPR. 1,N6-Etheno-ADPR shows a strong fluorescence at 410 nm upon excitation at 300 nm. The 1,N6-etheno-ADPR fluorescence was detected using a fluorescence spectrophotometer (F-2710, Hitachi, Tokio, Japan) with a sampling rate of 5 Hz. A defined volume of sCD38 purification was dissolved in 1 ml intracellular buffer (110 mM KCl, 10 mM NaCl, 2 mM MgCl2, 5 mM KH2PO4, 20 mM HEPES, pH 7.2) at 37 °C under constant stirring. After 100 s 100 µM 1,N6-etheno-NAD was added and the recording was continued for 1000 s. The fluorescence data were converted into the 1,N6-etheno-NAD concentration using a calibration curve and the catalytic activity was calculated as initial slope (≤ 5% of substrate metabolized). 2

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Western Blot of sCD38 - 10 µg purified protein was separated on a 12.5% SDS-gel after heating to 95 °C for 5 min with loading dye without 2-mercaptoethanol. The proteins were transferred to a PVDF membrane by wet blotting for 2h at 220 mA. The membrane was incubated with a primary antibody against CD38 (CD38 (AT1), sc-7325, Santa Cruz Biotechnology, 1:200 in blocking milk) at 4 °C overnight. As secondary antibody, HRP conjugated goat anti-mouse IgG-HRP (sc-2302, Santa Cruz Biotechnology, 1:5000 in blocking milk) was used. The membrane was incubated with ECL prime solution (Amersham) for 5 min and luminescence was detected with ImageQuant LAS 4000 (GE Healthcare). Recording and evaluation of Trp fluorescence - Recording of Trp fluorescence of sCD38 or sCD38-mutants was performed using a fluorescence spectrophotometer (F-2710, Hitachi, Tokio, Japan). The respective amount of protein was dissolved in 1 ml intracellular buffer (110 mM KCl, 10 mM NaCl, 2 mM MgCl2, 5 mM KH2PO4, 20 mM HEPES, pH 7.2) in a quartz half-micro cuvette (109F-QS, Hellma Analytics, Müllheim, Germany). The Trp residues were excited at 295 ± 2.5 nm and fluorescence was recorded at 340 ± 2.5 nm [20] with a sampling rate of 5 Hz at 37 °C under continuous stirring unless specified otherwise. 100 s after adding the protein, NAD or AMP was added via a septum and the recording was continued for another 600 s. Fluorescence data were corrected for bleaching effects and normalized to the sCD38 or sCD38-mutant fluorescence. Individual fluorescence recordings were averaged and displayed as mean ± S.E.M. The amplitude of the decrease in fluorescence after addition of NAD or AMP was determined as the difference between the averaged values of the last 10 time points before adding the nucleotides and the averaged values in the minimum after nucleotide addition. ‘Time to plateau’ was determined as the period of time between the addition of NAD or AMP and the time point, when the fluorescence values had recovered and reached a plateau again. Analysis of nucleotides by HPLC - sCD38 or sCD38-mutants dissolved in 80 µl intracellular buffer (110 mM KCl, 10 mM NaCl, 2 mM MgCl2, 5 mM KH2PO4, 20 mM HEPES, pH 7.2) at a concentration of 0.8 nkat/ml was pre-warmed to 37 °C in a heating block. 20 µl pre-warmed NAD solution (500 µM) were added and, upon completion, the enzymatic reaction was stopped by addition of 100 µl trichloroacetic acid (20%) after defined time points. The protein precipitate was separated by centrifugation. Trichloroacetic acid was removed from the supernatant by solvent extraction for 4 times with 1 ml diethyl ether. Remaining diethyl ether was evaporated. Afterwards, the sample volume was determined, the sample filtered through a 0.2 µm syringe filter (Minisart RC 4, Sartorius AG, Goettingen, Germany) and the containing nucleotides were analyzed by HPLC as previously described [21]. In brief, 10% of the sample were diluted in 15% methanol to 100 µl and separated by an ion pair reversephase HPLC on a Multohyp BDS-C18 5µ column (Chromatographie Service GmbH, Langerwehe, Germany) equipped with a C18 4x3.0 mm guard cartridge (SecurityGuard, Phenomenex, Aschaffenburg, Germany). Nucleotides were eluted with a nonlinear gradient with elution buffer (20 mM KH2PO4 and 5 mM tetrabutylammonium dihydrogen phosphate, pH 6.0) and increasing amounts of methanol. Analysis was performed at 20 °C at a flow rate of 0.8 ml/min with the following gradient: 0 min (30% methanol), 11 min (62.5% methanol), 25 min (100% methanol), and 29 min (30% methanol). Nucleotides were detected by UV absorption at λ=260 nm with a diode array detector (1260 series, Agilent Technologies, Böblingen, Germany). Peaks were analyzed with ChemStation software (Agilent Technologies, Waldbronn, Germany). The peaks of ADPR and cADPR were identified by external standards. The peak area was determined and quantification was performed using a calibration curve. Evaluation and Statistics - Data evaluation was conducted with Excel 2013 (Microsoft, Redmond, USA), GraphPad Prism 6 (GraphPad Software, La Jolla, USA), and Origin Pro 9.1 (OriginLab, Northampton, USA). Arithmetic mean and standard error were calculated where applicable. Statistics were analyzed by analysis of variance (ANOVA) with Bonferroni post-hoc test. P<0.05 were considered to represent significant differences between tested conditions. Results Trp fluorescence indicates conformational changes in sCD38 upon substrate binding - Human sCD38 was recombinantly expressed in HEK293 cells, secreted into the supernatant and purified by affinity chromatography using His-tag as described in Materials and Methods. Three independent purifications 3

ACCEPTED MANUSCRIPT were produced with an appropriate protein purity, as verified by SDS-PAGE, ponceau staining and western blotting (Fig. S1A). sCD38 from each purification showed high NAD-glycohydrolase activity using 1,N6etheno-NAD as substrate (0.50 ± 0.08 nkat/µg (mean ± S.E.M, n=3)).

AN

US

CR

IP

T

In order to investigate conformational changes in sCD38, its intrinsic Trp fluorescence was continuously recorded. As shown in a typical tracing, addition of sCD38 resulted in pronounced fluorescence due to eight endogenous Trp residues (Fig. S1B). Then, addition of 100 µM NAD resulted in a transient decrease in fluorescence, which recovered within tens of seconds (Fig. S1B, C). For further evaluation, the recordings were corrected for bleaching, normalized to the intrinsic sCD38 fluorescence and shown as average trace ± S.E.M. (Fig. S1C). Control experiments using addition of buffer or 100 µM AMP resulted in only a minor decrease in fluorescence confirming the specificity of sCD38 for NAD as substrate (Fig. S1C). Next, we investigated the influence of temperature, enzyme and NAD concentration on alterations in Trp fluorescence upon NAD addition. The decrease in Trp fluorescence upon addition of 100 µM NAD was significantly amplified at 10 °C (Fig. 1A, C), while temperature effects upon AMP addition were not observed (Fig. 1B, C, D). Further, decreasing temperatures significantly slowed down recovery in fluorescence (Fig. 1A, D). Different amounts of sCD38 had only minor influence on the amplitude of the decrease in fluorescence upon addition of NAD (Fig. 1E, G). However, the recovery in Trp fluorescence upon NAD addition was accelerated with increasing amounts of sCD38, while Trp fluorescence in control experiments with addition of 100 µM AMP was again not affected (Fig. 1F, G, H). As metabolism depends on temperature and enzymatic activity, these results indicate that the recovery in fluorescence may mirror the metabolism of NAD by sCD38.

AC

CE

PT

ED

M

Dependence of Trp fluorescence on NAD concentration in catalytically active and inactive sCD38 - Next, we investigated the effect of different NAD concentrations on the decrease in Trp fluorescence. The amplitude was enlarged with increasing NAD concentrations until it reached a maximum; this maximum amounted to about 15% of sCD38’s endogenous Trp fluorescence (Fig. 2A, and D). The resulting concentration-response curve was used to calculate the KD-value for NAD binding to sCD38. Fitting as one-site binding curve with variable Hill slop revealed a KD of 29 µM NAD (Fig. 2D), which is in accordance to previously published results [7,8,20]. In addition, the time to plateau rose with increasing NAD concentrations (Fig. 2E). Interestingly the CD38 substrate NMN did not affect Trp fluorescence of sCD38 up to 100 µM (Fig. 2B), although subsequent HPLC analysis showed that NMN was fully converted to nicotinamide and ribose-5-phosphate (data not shown). This indicates that either the enzyme substrate complexes with NMN and NAD differ markedly in fluorescence or only a minor fraction of CD38 is occupied by NMN due to the low affinity and high turnover rate for this substrate (KM 149 µM and kcat 512 s-1 [8]). Additional experiments with 500 µM NMN showed a weak, but long-lasting decrease in fluorescence that recovered only slowly at 37°C and did not recover over the course of the experiment at 10°C (Suppl. Fig S2A) suggesting that at concentrations below the KM of NMN occupation of the Michaelis complex is insufficient to result in a significant decrease in fluorescence. Different concentrations of AMP only modestly affected the Trp fluorescence of sCD38 (Fig. 2C, and D). The previously described catalytically inactive CD38 mutant E226Q [12] showed a NAD concentrationdependent decrease in fluorescence that reached a maximum of about 20% of total endogenous sCD38(E226Q) fluorescence (Fig. 2F). Fitting of the NAD binding curve revealed a KD of 37 µM indicating that binding of NAD is not markedly affected by the mutation (Fig. 2I). Fluorescence did not recover at all with the catalytically inactive mutant, suggesting that this process is dependent on metabolism of NAD. Consistently the low affinity substrate NMN also resulted in a concentration-dependent decrease of the fluorescence of sCD38(E226Q) which did not recover over time (Fig. 2G). Fitting of a binding curve showed a KD of 53 µM for NMN which is somewhat lower than the KM for the enzyme (Fig. 2I). Control experiments with different AMP concentrations showed only a minor effect on the Trp fluorescence (Fig. 2H, I).

4

ACCEPTED MANUSCRIPT Trp residues responsible for NAD-induced alterations in Trp fluorescence - In order to investigate the specific role of single Trp residues for the alteration in Trp fluorescence after NAD binding, single mutants of the eight Trp residues were analyzed using the same protocol (Fig. 3). Only one single Trp residue, W189F, significantly diminished the decrease of fluorescence upon NAD addition, while for all other Trp residues the decrease remained unchanged or was even enlarged (Fig. 3A, B, C). Two double mutants, W159F+W189F and W125F+W189F, showed a similar behavior, while W159F and W125F alone did not affect the decrease of fluorescence upon NAD addition. Kinetics of the recovery in fluorescence was significantly slowed down by the mutation of both W125 and W189 (Fig. 3A, B, D).

US

CR

IP

T

Kinetics of NAD metabolism by sCD38, sCD38(W125F), and sCD38(W189F) - To further investigate the temporal correlation between alterations in Trp fluorescence of sCD38 and degradation of NAD, we analyzed kinetics of ADPR and cADPR production by HPLC (Fig. 4A, B, C). Using identical conditions as for the Trp-fluorescence measurements (100 µM NAD and 0.8 nkat/ml sCD38 at 37 °C), metabolism of NAD to ADPR and cADPR was completed within about 1000 s (Fig. 4D). A comparably high ADPR/cADPR product ratio was previously described for human CD38 [3]. Unexpectedly, NAD metabolism and alterations in Trp fluorescence, both measured under the very same conditions, revealed different time courses (Fig. 4D). Though Trp fluorescence recovered completely within 40s, according to HPLC analysis only about 30% of the expected amounts of products ADPR and cADPR were detected. Product formation was further slowed down in mutants W125 or W189 (Fig. 4 E).

Discussion

CE

PT

ED

M

AN

Effect of ADPR, cADPR and nicotinamide on Trp fluorescence of sCD38 and sCD38(E226Q) - Next, we investigated, whether the reaction products ADPR, cADPR, or nicotinamide affect the Trp fluorescence of sCD38 and sCD38 (E226Q). In the catalytically inactive variant E226Q, 100 µM ADPR, 100 µM cADPR or 100 µM nicotinamide affected NAD evoked decrease of Trp fluorescence only very weakly (Fig. 5 A F). Since only very high ADPR concentrations (10 mM) exerted an effect similar to 100 µM NAD, ADPR does not effectively quench fluorescence of W189. Likewise, in catalytically active sCD38, only very high ADPR concentrations (10 mM) induced a pronounced decrease in fluorescence, while 100 to 500 µM ADPR or 1 to 100 µM cADPR had almost no effect (Fig. 5G, H). Further, 10 mM ADPR prevented recovery of Trp fluorescence upon NAD addition (Fig. 5G), likely due to product inhibition of the reaction [22]. These data indicate that NAD binding to CD38 results in quenching of W189 fluorescence while the products ADPR, cADPR or nicotinamide have no or only minor effects at concentrations ≤ 100 µM NAD.

AC

In the present study, we characterize binding and metabolism of NAD by sCD38 regarding dependence on temperature, enzyme mass (activity), and substrate concentration by means of Trp fluorescence. We identified one Trp residue mainly responsible for the NAD-dependent alterations in Trp fluorescence. Method - The fluorimetic approach is based on the endogenous Trp fluorescence of CD38 that is due to its eight Trp residues [20]. Advantages of the method are the detection of conformational changes in a protein with high temporal resolution without the need to utilize exogenous fluorescent proteins or dyes. Thus, physiological conditions are simulated as close as possible. For the experiments a soluble variant of CD38, sCD38, was used that lacks the transmembrane domain. The truncated variant is well established and improves the recombinant expression of the proteins [16,17]. As it has already been shown that the catalytic activity is not affected by the modification, we consider it unlikely that binding and metabolism of nucleotides are significantly affected [12,18]. Mutational analysis demonstrated that Trp-residue W189 is mainly responsible for the decrease in Trp fluorescence after NAD binding (Fig. 3). W189 is located in the binding pocket of CD38 and described to interact with NAD by π-π interactions [22]. KD - The binding of NAD to sCD38 or sCD38(E226Q) obtained by Trp fluorescence was fitted as a onesite binding curve. This allows the determination of KD for sCD38 (KD: 29 µM NAD) that is in well accordance with previously published results (KD: 16 µM [8], 46 µM [7], 30 µM [20]). Furthermore, sCD38 5

ACCEPTED MANUSCRIPT

PT

ED

M

AN

US

CR

IP

T

and sCD38(E226Q) (KD: 37 µM NAD) reveal comparable results indicating that binding of NAD is not significantly impaired in the catalytically inactive mutant. In order to control for the specificity of NAD binding, we added the same concentration of AMP that does not bind to CD38. Throughout the experiments we observed no significant alteration in Trp fluorescence by AMP. In addition, we investigated NMN as a fragment of the original substrate NAD. A decrease in sCD38 fluorescence was only observed at 500µM NMN most likely because only a small fraction of the enzyme is in a Michaelis complex due to the 10-fold lower affinity and 5-fold higher turnover rate of CD38 for NMN compared to NAD [8]. The fluorescence of the catalytically inactive sCD38(E226Q) in contrast did decrease after addition of NMN allowing us to determine a KD of 53 µM. This value is lower than the published KM of 149 µM for the hydrolysis of NMN by CD38 [8] which might reflect the faster addition of water to the oxocarbenium intermediate relative to its formation. Kinetics - In case of sCD38, NAD induced a decrease in Trp fluorescence that completely recovered to initial values after about 38 s at 37 °C. Kinetics of recovery was slowed down with decreasing temperature and CD38 concentration (Fig. 1A and E) and increasing NAD concentration (Fig. 2A) demonstrating that the recovery in fluorescence is proportional to the enzymatic activity of CD38. Likewise, the catalytically inactive mutant sCD38(E226Q) showed a similar, even more pronounced decrease in Trp fluorescence upon NAD binding, but no recovery in fluorescence, as metabolism of NAD does not take place (Fig. 2F). Unexpectedly, HPLC analysis of the products ADPR und cADPR revealed that recovery in fluorescence is completed long before products ADPR and cADPR can quantitatively be detected by HPLC (Fig. 4C). Although the data shown in Figs. 1 and 2 suggest that the transient decrease in Trp fluorescence upon NAD addition exactly mirrors complete conversion of NAD to its products, very reliable HPLC data do not support such a view (Fig. 4C). Usually, the rate limiting step in enzyme kinetics is conversion of the enzyme-substrate complex to free product(s) and free enzyme. However, our results indicate that formation of the enzyme-substrate, e.g. binding of NAD to CD38, is fast, as shown by the decrease of Trp-fluoresence. Mechanistically, W189 fluorescence is quenched by NAD, more precisely by the nicotinamide moiety of NAD. The latter is very likely, because ADPR that lacks the nicotinamide moiety does not quench W189 fluorescence in the concentration range used here (≤ 100 µM). Accordingly, we hypothesize that the rapid decrease in fluorescence upon NAD addition described binding of NAD to the active site of CD38, in other words the enzyme-substrate complex is formed (Fig. 6). Then, NAD is converted quantitatively to ADPR leading to recovery of fluorescence; here an enzyme-product complex is formed (Fig. 6). Usually, enzymeproduct complexes rapidly dissociate, but for CD38 this does not seem to be the case, since another approx. 960 s are necessary to release all products ADPR and cADPR in a quantitative fashion (Fig. 4D).

AC

CE

Conclusion Taken together, NAD-induced conformational changes in sCD38 and its catalytically inactive mutant sCD38(E226Q) were resolved with high temporal resolution by use of internal Trp fluorescence. Only one single Trp residue, W189F, significantly diminished the decrease of fluorescence upon NAD addition. Decrease in the Trp fluorescence of W189 likely reflects the concentration-dependent binding of NAD to CD38 while fluorescence recovery indicates a rapid turnover from NAD*CD38 complex to ADPR*CD38 complex, with a slow release phase of products afterwards.

Acknowledgments This work was supported by Landesforschungsförderung Hamburg, research network ReAd Me (project 1 to A.H.G.), by the Deutsche Forschungsgemeinschaft (SFB1328, project A01 to A.H.G., and A05 to R.F.), Joachim-Herz-Foundation, Infectophysics consortium, project 4 (to AHG); and by EU project INTEGRATA - DLV-813284 to R.F. and A.H.G). Conflict of interest The authors declare that are no conflicts of interest with the contents of this article. 6

ACCEPTED MANUSCRIPT Author contributions

AC

CE

PT

ED

M

AN

US

CR

IP

T

VW and AHG designed the study and wrote the paper. VW and AR performed and analyzed the experiments shown in figures 1, 3, 4, 5, S1 and part of figure 2, FK performed and analyzed some of the experiments shown in figure 2 and all experiments shown in figure S2 AB performed and analyzed the experiments shown in figure 4. RF and AH created the sCD38 expression plasmid. All authors reviewed the results and approved the final version of the manuscript.

7

ACCEPTED MANUSCRIPT References

AC

CE

PT

ED

M

AN

US

CR

IP

T

1. Malavasi, F., Funaro, A., Alessio, M., DeMonte, L. B., Ausiello, C. M., Dianzani, U., Lanza, F., Magrini, E., Momo, M., and Roggero, S. (1992) CD38: a multi-lineage cell activation molecule with a split personality. Int. J. Clin. Lab. Res. 22, 73–80 2. Lund, F. E., Cockayne, D. A., Randall, T. D., Solvason, N., Schuber, F., and Howard, M. C. (1998) CD38: a new paradigm in lymphocyte activation and signal transduction. Immunol. Rev. 161, 79–93 3. Takasawa, S., Tohgo, A., Noguchi, N., Koguma, T., Nata, K., Sugimoto, T., Yonekura, H., and Okamoto, H. (1993) Synthesis and hydrolysis of cyclic ADP-ribose by human leukocyte antigen CD38 and inhibition of the hydrolysis by ATP. J. Biol. Chem. 268, 26052–26054 4. Fernàndez, J. E., Deaglio, S., Donati, D., Beusan, I. S., Corno, F., Aranega, A., Forni, M., Falini, B., and Malavasi, F. (1998) Analysis of the distribution of human CD38 and of its ligand CD31 in normal tissues. J. Biol. Regul. Homeost. Agents. 12, 81–91 5. Sun, L., Adebanjo, O. A., Koval, A., Anandatheerthavarada, H. K., Iqbal, J., Wu, X. Y., Moonga, B. S., Wu, X. B., Biswas, G., Bevis, P. J. R., Kumegawa, M., Epstein, S., Huang, C. L.-H., Avadhani, N. G., Abe, E., and Zaidi, M. (2002) A novel mechanism for coupling cellular intermediary metabolism to cytosolic Ca2+ signaling via CD38/ADP-ribosyl cyclase, a putative intracellular NAD+ sensor. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 16, 302–314 6. Khoo, K. M., Han, M. K., Park, J. B., Chae, S. W., Kim, U. H., Lee, H. C., Bay, B. H., and Chang, C. F. (2000) Localization of the cyclic ADP-ribose-dependent calcium signaling pathway in hepatocyte nucleus. J. Biol. Chem. 275, 24807–24817 7. Berthelier, V., Tixier, J. M., Muller-Steffner, H., Schuber, F., and Deterre, P. (1998) Human CD38 is an authentic NAD(P)+ glycohydrolase. Biochem. J. 330 ( Pt 3), 1383–1390 8. Sauve, A. A., Munshi, C., Lee, H. C., and Schramm, V. L. (1998) The reaction mechanism for CD38. A single intermediate is responsible for cyclization, hydrolysis, and base-exchange chemistries. Biochemistry (Mosc.). 37, 13239–13249 9. Howard, M., Grimaldi, J. C., Bazan, J. F., Lund, F. E., Santos-Argumedo, L., Parkhouse, R. M., Walseth, T. F., and Lee, H. C. (1993) Formation and hydrolysis of cyclic ADP-ribose catalyzed by lymphocyte antigen CD38. Science. 262, 1056–1059 10. Lee, H. C. (2001) Physiological functions of cyclic ADP-ribose and NAADP as calcium messengers. Annu. Rev. Pharmacol. Toxicol. 41, 317–345 11. Lee, H. C. (2006) Structure and enzymatic functions of human CD38. Mol. Med. Camb. Mass. 12, 317–323 12. Munshi, C., Aarhus, R., Graeff, R., Walseth, T. F., Levitt, D., and Lee, H. C. (2000) Identification of the enzymatic active site of CD38 by site-directed mutagenesis. J. Biol. Chem. 275, 21566–21571 13. Liu, Q., Kriksunov, I. A., Graeff, R., Munshi, C., Lee, H. C., and Hao, Q. (2005) Crystal structure of human CD38 extracellular domain. Struct. Lond. Engl. 1993. 13, 1331–1339 14. Liu, Q., Kriksunov, I. A., Graeff, R., Lee, H. C., and Hao, Q. (2007) Structural basis for formation and hydrolysis of the calcium messenger cyclic ADP-ribose by human CD38. J. Biol. Chem. 282, 5853–5861 15. Zhang, H., Graeff, R., Chen, Z., Zhang, L., Zhang, L., Lee, H., and Hao, Q. (2011) Dynamic conformations of the CD38-mediated NAD cyclization captured in a single crystal. J. Mol. Biol. 405, 1070–1078 16. Fryxell, K. B., O’Donoghue, K., Graeff, R. M., Lee, H. C., and Branton, W. D. (1995) Functional expression of soluble forms of human CD38 in Escherichia coli and Pichia pastoris. Protein Expr. Purif. 6, 329–336 17. Munshi, C. B., Fryxell, K. B., Lee, H. C., and Branton, W. D. (1997) Large-scale production of human CD38 in yeast by fermentation. Methods Enzymol. 280, 318–330 18. Zhao, Y. J., Zhang, H. M., Lam, C. M. C., Hao, Q., and Lee, H. C. (2011) Cytosolic CD38 protein forms intact disulfides and is active in elevating intracellular cyclic ADP-ribose. J. Biol. Chem. 286, 22170–22177 8

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

19. Berthelier, V., Laboureau, J., Boulla, G., Schuber, F., and Deterre, P. (2000) Probing ligand-induced conformational changes of human CD38. Eur. J. Biochem. FEBS. 267, 3056–3064 20. Lacapère, J.-J., Boulla, G., Lund, F. E., Primack, J., Oppenheimer, N., Schuber, F., and Deterre, P. (2003) Fluorometric studies of ligand-induced conformational changes of CD38. Biochim. Biophys. Acta. 1652, 17–26 21. Liu, Q., Kriksunov, I. A., Graeff, R., Munshi, C., Lee, H. C., and Hao, Q. (2006) Structural basis for the mechanistic understanding of human CD38-controlled multiple catalysis. J. Biol. Chem. 281, 32861–32869 22. Briggs, G. E., and Haldane, J. B. (1925) A Note on the Kinetics of Enzyme Action. Biochem. J. 19, 338–339 23. Schmid, F., Fliegert, R., Westphal, T., Bauche, A., and Guse, A. H. (2012) Nicotinic acid adenine dinucleotide phosphate (NAADP) degradation by alkaline phosphatase. J. Biol. Chem. 287, 32525– 32534

9

ACCEPTED MANUSCRIPT Legends to figures

CR

IP

T

Figure 1 Trp fluorescence of sCD38 reflects enzymatic activity. (A, B) Single traces of Trp fluorescence of sCD38 excited at 295 nm and recorded at 340 nm (0.8 nkat/ml sCD38, sampling rate 5 Hz) were corrected for bleaching, normalized to sCD38 fluorescence, averaged and indicated as mean ± S.E.M. (n=3). Fluorescence decrease after addition of NAD and kinetics of the subsequent recovery in fluorescence were influenced by the temperature (A), while the alteration in fluorescence after addition of AMP was barely affected (B). Addition of NAD or AMP is indicated by the arrow, respectively. The traces with NAD and AMP recorded with 0.8 nkat/ml sCD38 at 37 °C were already shown in figure S1C. The amplitude of the fluorescence decrease (C) and the time to plateau (D) of the individual experiments were determined as described in the Experimental procedures section, and statistical analysis was performed by ANOVA with Bonferroni post-hoc test (* P < 0.05). (E, F) Exemplary traces of Trp fluorescence of sCD38 excited at 295 nm and recorded at 340 nm (37 °C, sampling rate 5 Hz) with the indicated amount of sCD38. Traces were corrected for bleaching and normalized to sCD38 fluorescence. The amplitude of the fluorescence decrease (G) and the time to plateau (H) of the individual experiments were determined as described in the Experimental procedures section.

ED

M

AN

US

Figure 2 Determination of the dissociation constant for NAD binding by sCD38 and its catalytically inactive mutant. Single traces of Trp fluorescence of sCD38 and sCD38(E226Q) excited at 295 nm and recorded at 340 nm (37 °C, 0.8 nkat/ml sCD38 or 1.8 µg/ml sCD38(E226Q), sampling rate 5 Hz) were corrected for bleaching, normalized to CD38 fluorescence, averaged and indicated as mean ± S.E.M. (n=3). NAD concentration affects the induced fluorescence decrease and kinetics of the subsequent recovery in sCD38 (A) and sCD38(E226Q) (F). Up to 100 µM NMN did not affect the fluorescence decrease of sCD38 (B) but results in a concentration-dependent decrease of fluorescence in sCD38 (G, I), Fluorescence was barely affected by addition of different AMP concentrations (C, H). Addition of NAD, NMN or AMP is indicated by the arrow, respectively. The traces of sCD38 treated with 100 µM NAD or AMP were already shown in figure S1C. The amplitude of the fluorescence decrease (E, I) and the time to plateau (E) of the individual experiments were determined as described in the Experimental procedures section. The determined amplitudes were used for fitting a one-site binding curve with variable hill slop and calculation of the dissociation constant for NAD, and NMN binding.

AC

CE

PT

Figure 3 Effect of single Trp residues on NAD-induced alterations in Trp fluorescence. Single traces of Trp fluorescence of sCD38 excited at 295 nm and recorded at 340 nm (37 °C, 0.8 nkat/ml sCD38, sampling rate 5 Hz) were normalized to CD38 fluorescence, averaged and indicated as mean ± S.E.M. (n≥2). Addition of NAD is indicated by the arrow. The amplitude of the fluorescence decrease (B) and the time to plateau (C) of the individual experiments were determined as described in the Experimental procedures section, and statistical analysis was performed by ANOVA with Bonferroni post-hoc test (* P < 0.05). Figure 4 Kinetics of NAD metabolism by sCD38, sCD38(W189F), and sCD38(W125F). The enzymatic degradation of 100 µM NAD by 0.8 nkat/ml sCD38 or sCD38 mutants at 37 °C was stopped after defined time points by adding trichloroacetic acid. Products ADPR and cADPR were analyzed by HPLC as described in the Experimental procedures section. Exemplary chromatogram showing the reaction products of sCD38 after 200 s (A) and details of the peaks of cADPR (B) and ADPR (C) at different time points of enzymatic digest recorded at 260 nm and confirmed by standard substances. (D) The respective peak areas were determined, converted into the nucleotide concentration by a calibration curve, corrected for the blank value, averaged and indicated as mean ± S.E.M. (n=3). The trace of the Trp fluorescence of sCD38 recorded under identical conditions (37 °C, 0.8 nkat/ml sCD38, 100 µM NAD, sampling rate 5 Hz) was already shown in figure S1C. (E) ADPR concentrations after enzymatic digest of NAD by sCD38(W189F) or sCD38(W125F) was analyzed the same way and indicated as mean ± S.E.M. (n=3). The traces of the Trp fluorescence recorded under identical conditions were already shown in figure 3. 10

ACCEPTED MANUSCRIPT

Figure 5 ADPR affects Trp fluorescence of sCD38 and sCD38(E226Q). Single traces of the Trp fluorescence of sCD38 and sCD38(E226Q) excited at 295 nm and recorded at 340 nm (37 °C, 0.8 nkat/ml sCD38 or 1.8 µg/ml sCD38(E226Q), sampling rate 5 Hz) were normalized to the intrinsic fluorescence, averaged and indicated as mean ± S.E.M. (n=3). The sequential addition of NAD and ADPR, cADPR, or nicotinamide affected fluorescence of sCD38(E226Q) (A, B, C, D, E, F) and sCD38 (G, H). Addition of NAD, ADPR, cADPR, or nicotinamide is indicated by the arrow, respectively.

AC

CE

PT

ED

M

AN

US

CR

IP

T

Figure 6 Trp fluorescence of sCD38 reflects the formation of the complexes NAD*sCD38 and ADPR*sCD38. Trp fluorescence of sCD38 excited at 295 nm and recorded at 340 nm (0.8 nkat/ml sCD38, sampling rate 5 Hz) was already shown in figure S1C. Period (a) describes fluorescence of the free enzyme sCD38 in the absence of substrate and/or product. The rapid decrease in fluorescence characterizes the formation of the NAD*sCD38 complex, as shown for the period designated as (b). In period (c) ADPR*sCD38 increases while NAD*sCD38 decreases. In (d) all NAD*sCD38 is converted to ADPR*sCD38, and a slow process of release of ADPR from the product-enzyme complex ADPR*sCD38 proceeds. Release of ADPR is visualized by the HPLC kinetics experiment shown in Fig 4D.

11

ACCEPTED MANUSCRIPT Highlights for

CE

PT

ED

M

AN

US

CR

IP

T

endogenous tryptophan fluorescence was used to monitor CD38 enzyme activity NAD evoked decrease in CD38 fluorescence is mainly caused by residue W189 recovery in fluorescence occurred in wildtype CD38, but not in a catalytically inactive mutant

AC

-

12

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6