Naked PCV-2 cloned genomic DNA is infectious by mucosal (intratracheal or oro-nasal) inoculation

Virus Research 165 (2012) 90–94

Contents lists available at SciVerse ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Short communication

Naked PCV-2 cloned genomic DNA is infectious by mucosal (intratracheal or oro-nasal) inoculation Béatrice Grasland ∗ , Lionel Bigault, Maëna Le Corvec, Anne-Cécile Hernandez-Nignol, Aurélie Oger, Daniel Dory, Nicolas Rose, Roland Cariolet, André Jestin Anses, Laboratory of Ploufragan-Plouzané, BP 53, 22440 Ploufragan, France

a r t i c l e

i n f o

Article history: Received 17 November 2011 Received in revised form 5 January 2012 Accepted 5 January 2012 Available online 14 January 2012 Keywords: Viral genome Mucosal inoculation Porcine circovirus

a b s t r a c t Porcine circovirus type 2 (PCV-2) is involved in several diseases named porcine circovirus-associated diseases and is transmitted by oro-faecal route. In this study we inoculated porcine-circovirus free piglets by mucosal routes (intratracheal or oro-nasal routes) with a plasmid carrying two copies of PCV-2 genomic DNA and compared the results to the intramuscular route. We observed that this PCV-2 naked DNA serves as template for viral replication and infectious PCV-2 particles are detected in the whole body after parenteral (intramuscular) or mucosal (intratracheal or oro-nasal) delivery. These results suggest that PCV-2 genome could play a role in in vivo transmission. © 2012 Elsevier B.V. All rights reserved.

Porcine circoviruses are small, non-enveloped viruses with a circular single-stranded DNA. Porcine circovirus type 1 (PCV-1) was discovered as a contaminant of porcine kidney cell lines (PK15 ATCC CCL33) but is considered non-pathogenic in pigs. Recently, it has been reported that full-length PCV-1 DNA contaminated a human rotavirus vaccine, Rotarix, administered to infants by oral route (Baylis et al., 2011; McClenahan et al., 2011; Victoria et al., 2010). On the other hand, porcine circovirus type 2 (PCV-2) is the causal agent of post-weaning multisystemic wasting syndrome (PMWS) and is associated with several diseases designated by porcine circovirus-associated diseases. Typical PMWS clinical signs are lethargy associated with growth retardation, skin pallor, hyperthermia and enlargement of inguinal lymph nodes. At necropsy, the main gross lesions consist of hypertrophy of lymph nodes. The histological lesions include lymphoid depletion, interstitial pneumonia and hepatitis (Gillespie et al., 2009). Although PCV-2 infection in herd is highly prevalent, co-factors as bacteria, virus and immunostimulation are often required to trigger PMWS (Madec et al., 2008). However, PMWS-affected pigs showed higher PCV-2 viral loads than non-affected pigs. The detection of PCV-2 genome in nasal, oral and faecal swabs demonstrates that the virus is probably shed through respiratory, oral secretions and faeces (Segales et al., 2005; Shibata et al., 2003). Moreover, the horizontal transmission of PCV-2 by direct or indirect contact has been confirmed experimentally (Andraud et al., 2008, 2009; Dupont et al., 2009). Airborne transmission is likely to occur since the viral

∗ Corresponding author. Tel.: +33 02 96 01 62 22; fax: +33 02 96 01 62 83. E-mail address: [email protected] (B. Grasland). 0168-1702/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2012.01.006

genome was detected in aerosols in swine herds (Verreault et al., 2010). Molecular PCV-2 genomic DNA clones were developed to study the role of PCV-2 and of co-factors in PMWS pathogenesis and to develop PCV-2 vaccines. Two genomic clones of PCV-2 isolates from Europe and North America have been constructed to investigate if such genomic clones are infectious in pigs and could be used. Both were infectious and caused sub-clinical infection when injected in the liver and/or lymph nodes (Fenaux et al., 2003), by intramuscular or intraperitoneal routes (Roca et al., 2004). Using PCV-2 genomic DNA clone and an immunostimulation known to trigger PMWS, PMWS was reproduced in PCV-free pigs after inoculation by the intramuscular route (Grasland et al., 2005). Moreover PCV-1 naked DNA was found infectious in vitro (McClenahan et al., 2011). In vivo PCV-1 cloned genomic DNA led to the production of infectious viruses when injected intramuscularly as PCV-2 cloned genomic DNA (Fenaux et al., 2003). Since the PCV-2 may be shed through respiratory, oral secretions and faeces, we investigate in this study if PCV-2 cloned genomic DNA, previously described (GenBank accession number AF201311), is also infectious by mucosal routes, i.e. intratracheal or oro-nasal routes and compare the efficacy of these routes to the well-known intramuscular one. In this work, thirty specific-pathogen-free (SPF) piglets, including free of PCV-1 and PCV-2 were used. The piglets weaned at four weeks of age, were housed in four separate SPF-growing rooms with a level 3 of biosecurity. The experiment was carried out in accordance with EU and French regulations on animal experimentation and with national guidelines for animal welfare. The first group of six piglets correspond to the non-inoculated control. The three other groups were composed of eight piglets inoculated with 400 ␮g of PCV-2 cloned genomic DNA (2 mL) by intramuscular (IM),

B. Grasland et al. / Virus Research 165 (2012) 90–94

91

Table 1 PCV-2 seroconversion assessed by PCV-2 ELISA. Group

Number of seropositive pigs Control group Intramuscular group Intratracheal group Oro-nasal group

Fig. 1. Impact of the inoculation route of PCV-2 naked genome DNA on the relative daily weight gain assessed for each group by comparison of piglet daily weight gains with those of control piglets. The asterisk represents a significant difference (p ≤ 0.05) with the control group indicated by a line with a value of 1.

intratracheal (IT) or oro-nasal (ON) (1 mL in the right nostril and 1 mL in the mouth) routes. Rectal temperatures and clinical observations were monitored daily. Weekly, piglets were weighed and blood samples collected. At 13 and 23 days post-inoculation (dpi), one pig in the control group and two in inoculated groups were euthanized by anaesthesia with Nesdonal® (Merial, France) followed by bleeding. The trial ended at 34 dpi and the remaining animals were slaughtered. At necropsy, macroscopic lesions were examined and a sample of tracheobronchial (TB) and inguinal (ING) lymph nodes (LN), tonsils, lung and liver were fixed in 10% buffered formalin (Sigma–Aldrich, MO, USA) for histopathological examinations as previously described (Grasland et al., 2005). Additional tissue samples were collected and stored at −80 ◦ C for quantitative PCR and immuno-peroxidase monolayer assay (IPMA). No hyperthermia was recorded in all piglets throughout the experiment (data not shown). A significant decrease of the relative daily weight gain was observed in animals inoculated by IM and ON routes in the second week post-inoculation (p ≤ 0.05 with the non-parametric U-test of Mann and Whitney used throughout this study) (Fig. 1). In the third week, the relative daily weight gain of IM inoculated piglets was still significantly lower than that of the control group (p ≤ 0.05). One week later, it was significantly lower for the IT inoculated group compared to the control group. At necropsy, no macro- and micro-lesions were detected in all control piglets. At 13 dpi, despite the absence of macrolesions, mildto-severe lymphoid depletion was noticed in TB and ING LN and mild-to-moderate interstitial pneumonia in lungs in the three PCV2 DNA-inoculated groups. At 23 and 34 dpi, whatever the route of inoculation used, only the TB LN were slightly enlarged (1/2 piglet per group at 23 dpi and 3/4 piglets at 34 dpi). At 23 dpi, the animals inoculated by IM and IT routes showed the same microlesions than earlier and in the ON group, the lesions were less serious. At 34 dpi, microlesions consisting of a mild-to-moderate lymphoid depletion in TB and ING LN and of a mild interstitial pneumonia in lungs were observed in IM and IT inoculated animals. The animals of the ON group presented only mild lymphocyte depletion in TB and ING LN. Moreover, PCV-2 capsid protein was detected in the organs of the IM, IT and ON groups at 23 and 34 dpi by immunohistochemistry as already described (Allemandou et al., 2011). Serum antibodies to PCV-2 were detected using an ELISA test based on the recognition of a recombinant PCV-2 capsid protein/GST fused protein (Blanchard et al., 2003). All the animals of the control group remained PCV-2 seronegative throughout the study (Table 1). Two out of six animals that received PCV-2 DNA by the IM route developed antibodies against the PCV-2 capsid at 20 dpi. At the same time, only one out of six pigs in the IT and ON inoculated groups developed an immune response to the PCV-2 capsid

Day post-inoculation 0

6

13

20

27

34

0/6 0/8 0/8 0/8

0/6 0/8 0/8 0/8

0/6 0/8 0/8 0/8

0/5 2/6 1/6 1/6

0/4 4/4 2/4 2/4

0/4 4/4 2/4 2/4

protein. Afterwards, all the IM inoculated pigs seroconverted. At 34 dpi, two out of four animals that received PCV-2 DNA by IT or ON routes were PCV-2 seropositive. PCV-2 genomic load was assessed by quantitative real-time PCR (in TB, ING and mesenteric LN; tonsil, spleen, ileum, lung and liver) as previously reported (Grasland et al., 2005). No PCV-2 genomic DNA was detected in the organs collected from the negative control piglets throughout the experiment (data not shown). At 13 and 23 dpi, an individual variability in the PCV-2 genomic load was observed for the three inoculated groups (Fig. 2A). For the animals inoculated by IM or IT routes, all the tissues were positive for PCV-2 genomic DNA at 13 dpi with respectively a mean of 2.1 × 1011 and 5.7 × 1010 genomic copies/g of tissue (Fig. 2A). In the ON group, PCV-2 DNA was also found in all the tissues for one piglet but with a lower genomic load than in the two other groups (108 copies/g of tissue). For the second ON inoculated animal, PCV-2 DNA was only detected in tonsils and mesenteric LN at a level of 6 × 105 copies/g of tissue. At 23 dpi, all the organs of all pigs were positive for the presence of PCV-2 DNA when the IM or IT routes were used with quite similar individual genomic loads. The PCV-2 DNA quantity raised slightly with a mean of 2.9 × 1011 and 4.2 × 1011 in the IM and IT groups respectively. In the ON group, one piglet showed PCV-2 DNA in all the tested organs with an average of 9.2 × 109 copies/g of tissue and the other one had only four organs positive with 2.2 × 105 copies/g of tissue in average. At 34 dpi, the genomic loads in the three inoculated groups were not significantly different (Fig. 2B). The mean number of PCV-2 DNA copies remained at the same order of magnitude compared to the time before in IM and IT group (5.3 × 1010 and 5.4 × 1010 copies/g of tissue respectively). On the other hand, the genomic loads in the ON group increased with a mean value of 1.2 × 1011 copies/g of tissue which is more or less equivalent to the values of the two other inoculated groups. The persistence of the PCV-2 clone DNA input in the organs (TB, ING and mesenteric LN; tonsil, spleen, ileum, lung and liver) was evaluated by quantitative real-time PCR with two primers (PCV-2 primer 5 TCCCGCTCTCCAACAAGGTA3 and pBKS reverse primer 5 TCGATAAGCTTGATATCGAATTCCT3 ) and a TaqMan probe (5 FAM-CCTAGATCTCAGGGACAAC-MGB 3 ) overlapping the junction between pBluescript vector and the PCV-2 genome in the PCV-2 DNA clone. The amplification parameters were similar to the PCV-2 quantitative PCR. No plasmid DNA corresponding to input of PCV-2 cloned DNA was detected in all the organs of the control and inoculated pigs throughout the trial. Thus the PCV-2 DNA detected in the organs of inoculated piglets was viral genomic DNA and not input plasmid DNA. This is in agreement with the rapid clearance of plasmid DNA (within 24 h) further to intranasal (IN) (Oh et al., 2001) or IM (Gravier et al., 2007) inoculation of plasmid DNA. Only 14% of the plasmid DNA administered by IN route reached the systemic circulation and are distributed to different organs including LN (Oh et al., 2001) against 10% when administered by IM route (Gravier et al., 2007). The infectious viral titres were assessed in three lymphoid organs (tonsils, TB and ING LN) by IPMA as already described (Grasland et al., 2005). Purified naked PCV-2 cloned DNA was put

92

B. Grasland et al. / Virus Research 165 (2012) 90–94

A

IM inoculaon

IT inoculaon

ON inoculaon

PCV-2 DNA copies/g of ssue

1.00E+13 1.00E+12 1.00E+11 1.00E+10 1.00E+09 1.00E+08 1.00E+07 1.00E+06 1.00E+05 1.00E+04

13 Mean genomic load at each time in: IM inoculation group 2.1 1011 (±5.7 1011) IT inoculation group 5.7 1010 (±2.2 1011) ON inoculation group 4.5 107 (±1.6 108) IM inoculaon

B

IT inoculaon

23

dpi

2.9 1011 (±5.4 1011) 4.2 1011 (±6.7 1011) 4.6 109 (±9.3 109) ON inoculaon

PCV-2 DNA copies/g of ssue

1.00E+12 1.00E+11 1.00E+10 1.00E+09 1.00E+08 1.00E+07 1.00E+06 1.00E+05 1.00E+04

Mean genomic load at each time in: IM inoculation group IT inoculation group ON inoculation group

dpi

34 10

11

5.3 10 (±1.3 10 ) 5.4 1010 (±1.6 1011) 1.2 1011 (±2.2 1011)

Fig. 2. Mean of PCV-2 genomic loads in several organs (tracheobronchial, inguinal and mesenteric lymph nodes; tonsil, spleen, ileum, lung and liver) for each pig in the three inoculated groups with two pigs per group at 13 and 23 dpi (A) and four at 34 dpi (B). The PCV-2 genomic loads are expressed in PCV-2 DNA copy numbers per gram of tissue. The average of PCV-2 genomic load with standard deviations are indicated for each group at each time below the graphs.

on fresh PK15 cells with a quantity corresponding to the highest quantity found in the organs in order to determine if capsid protein detection by IPMA results from viral infection rather than transfection of high viral DNA quantity. No stain was revealed after 36 h of culture evidencing that titres result from infection of PK15 cells by viral infectious particles and not from transfection. All the tissues of the control animals remained free of PCV-2 infectious particles (data not shown). At 13 dpi, the three lymphoid organs of all the animals inoculated by IM or IT routes were infected by PCV-2 with 3.9 × 104 and 7.3 × 103 TCID50 /g of tissue on average (Fig. 3A). In the ON group, the piglet with the highest genomic load showed infectious virus with 1.9 × 102 TCID50 /g of tissue and the second one had no infectious particles. At 23 dpi, the infectious titres increased in IM and IT groups (Fig. 3A). The animals inoculated by ON route presented lower infectious titres. In this group, the infectious titres increased thereafter with a mean of 8.3 × 103 TCID50 /g of tissue while it decreased in the two other inoculated groups (3 × 104 and 7.9 × 103 TCID50 /g of tissue in IM and IT groups) (Fig. 3B). At that time, the three lymphoid organs of all the inoculated animals displayed infectious virus and no significant difference was found between the three inoculated groups.

In this study, we demonstrated that naked PCV-2 cloned genomic DNA was infectious after mucosal delivery in pigs whether it is administered by IT or ON route. Indeed, PCV-2 DNA and infectious particles were detected as soon as 13 dpi and until 34 days after the IM, IT and ON DNA inoculation. The genomic loads determined in the organs reached 5.3 × 1010 copies/g of tissue at 34 dpi and only PCV-2 sub-clinical infection was observed and are in agreement with previous studies using the same PCV-2 genomic clone injected by IM route (Allemandou et al., 2011; Grasland et al., 2005). In our study, the IM delivery seemed more effective than the two tested mucosal routes as the humoral response against PCV-2 was detected earlier and as the PCV-2 genomic load and the infectious titre in lymphoid organs were higher at 13 dpi. This could be due to a more pronounced DNA degradation by nuclease present in the mucus after mucosal inoculation or a less effective transfection of specific cells. PCV-2 genomes were detected up to 107 copies per cubic meter in swine confinement buildings (Verreault et al., 2010). Moreover, PCV-2 DNA was quantified in tonsillar, nasal, trachea-bronchial, urinary and faecal swabs from PCV-2 infected pigs (Segales et al., 2005). Even if the number of infectious viral particles was not

B. Grasland et al. / Virus Research 165 (2012) 90–94

IM inoculaon

A

IT inoculaon

ON inoculaon

1.00E+07

TCID50/g of ssue

1.00E+06 1.00E+05 1.00E+04 1.00E+03 1.00E+02 1.00E+01 1.00E+00

DPI

13 Mean infectious titre at each time in: IM inoculation group 3.9 104 (± 5.4 104) IT inoculation group 7.3 103 (± 9.6 103) ON inoculation group 9.9 101 (± 1.4 102)

B

IM inoculaon

IT inoculaon

23 5

5

1.2 10 (± 1.7 10 ) 7.1 105 (± 9.9 105) 3.1 102 (± 2.3 102) ON inoculaon

1.00E+07

TCID50/g of ssue

1.00E+06 1.00E+05

93

99.6–99.7% of nucleotide similarity with a chimeric strain used in an inactivated vaccine (Gillespie et al., 2008) commercially available in 2008 in Canada and administered intramuscularly. If some PCV full length genome was still present in the vaccine after the inactivation procedure, it could have led to the production of infectious virus after IM injection in pigs. In the same way, PCV-1 full-length genome was detected in a rotavirus vaccine administered orally to infants (Baylis et al., 2011; McClenahan et al., 2011; Victoria et al., 2010) and thus could represent a potential risk of infection. Indeed, we found that after ON inoculation, PCV-2 cloned genomic DNA led to the production of infectious particles in all of the organs of pigs. It has been recently discovered that human hepatocellular carcinoma cells are susceptible to PCV-1 infection and produce infectious virus (Beach et al., 2011). Hence based on our results, some human cells could be infected by PCV-1 after oral intake of rotavirus vaccine including PCV-1 full-length genomes. The production of inactivated vaccines should add a procedure of DNA lyses after the virus inactivation procedure. The production of attenuated vaccines should check the presence of small viral genomes in order to eliminate them at all stages of the production. Acknowledgements

1.00E+04

The authors are grateful to Anses pathogen-free pig breeding and testing facility (Ploufragan/Plouzané Laboratory) for their expert handling of the pigs involved in this study. They also thank Hervé Morvan (LDA22, Ploufragan, France) for the histopathology.

1.00E+03 1.00E+02 1.00E+01 1.00E+00

DPI

34 Mean infectious titres at each time in: IM inoculation group 3 104 (± 5.7 104) IT inoculation group 7.9 103 (± 1.1 104) ON inoculation group 8.2 103 (± 9.1 103) Fig. 3. Evolution of the mean infectious titres determined in three lymphoid organs (tonsils, trachea-bronchial and inguinal lymph nodes) for each piglet inoculated by IM, IT or ON routes at 13 and 23 dpi after inoculation (A) and 34 dpi after inoculation (B). The infectious titres are expressed in TCID50 per gram of tissue. The average of PCV-2 infectious titres with standard deviations are indicated for each group at each time below the graphs.

assessed in these two studies, the role of PCV-2 genome in PCV-2 transmission by ON route is raised as we demonstrated that PCV-2 cloned genomic DNA is infectious after IT or ON administration. Indeed PCV-2 cloned genomic DNA could be involved in natural pig infection because it has been reported that PCV-2 genomic DNA inhibits the first immune response to viral infection. It impairs in vitro the ability of porcine plasmacytoid dendritic cells (pDC) or natural interferon producing cells stimulated by CpG oligodeoxynucleotides to produce interferon ␣ without the use of artificial mode of DNA entry such as lipotransfection (Vincent et al., 2007). pDC are able to recognise viral DNA and more particularly CpG motif via the endosomally active toll-like receptor 9. The PCV2 genome presents such CpG motifs able to inhibit the production of interferon ␣ by porcine peripheral blood mononuclear cells in vitro (Wikstrom et al., 2007, 2011). Thus PCV-2 cloned genomic DNA could behave similarly in vivo and impair the host immune response after entry through mucosal routes. Here, we report that inoculation of naked PCV-2 cloned genomic DNA by three different inoculation routes (IM, IT and ON routes) allowed the production of PCV-2 infectious particles and most likely the replication of the virus in the whole body. The infectious potential of PCV-2 naked DNA in vivo would induce risk in using PCV-2 inactivated vaccine in which PCV DNA is not lysed and present in full-length. Indeed our results could explain why a recombinant PCV-1/PCV-2 strain was discovered in pig tissue from Canadian herds (Gagnon et al., 2010). This PCV recombinant strain shared

References Allemandou, A., Grasland, B., Hernandez-Nignol, A.C., Keranflec’h, A., Cariolet, R., Jestin, A., 2011. Modification of PCV-2 virulence by substitution of the genogroup motif of the capsid protein. Vet. Res. 42, 54. Andraud, M., Grasland, B., Durand, B., Cariolet, R., Jestin, A., Madec, F., Pierre, J.S., Rose, N., 2009. Modelling the time-dependent transmission rate for porcine circovirus type 2 (PCV2) in pigs using data from serial transmission experiments. J. R. Soc. Interface 6, 39–50. Andraud, M., Grasland, B., Durand, B., Cariolet, R., Jestin, A., Madec, F., Rose, N., 2008. Quantification of porcine circovirus type 2 (PCV-2) within- and between-pen transmission in pigs. Vet. Res. 39, 43. Baylis, S.A., Finsterbusch, T., Bannert, N., Blumel, J., Mankertz, A., 2011. Analysis of porcine circovirus type 1 detected in Rotarix vaccine. Vaccine 29, 690–697. Beach, N.M., Cordoba, L., Kenney, S.P., Meng, X.J., 2011. Productive infection of human hepatocellular carcinoma cells by porcine circovirus type 1. Vaccine 29, 7303–7306. Blanchard, P., Mahe, D., Cariolet, R., Truong, C., Le Dimna, M., Arnauld, C., Rose, N., Eveno, E., Albina, E., Madec, F., Jestin, A., 2003. An ORF2 protein-based ELISA for porcine circovirus type 2 antibodies in post-weaning multisystemic wasting syndrome. Vet. Microbiol. 94, 183–194. Dupont, K., Hjulsager, C.K., Kristensen, C.S., Baekbo, P., Larsen, L.E., 2009. Transmission of different variants of PCV2 and viral dynamics in a research facility with pigs mingled from PMWS-affected herds and non-affected herds. Vet. Microbiol. 139, 219–226. Fenaux, M., Opriessnig, T., Halbur, P.G., Meng, X.J., 2003. Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCV1 in weanling pigs. J. Virol. 77, 11232–11243. Gagnon, C.A., Music, N., Fontaine, G., Tremblay, D., Harel, J., 2010. Emergence of a new type of porcine circovirus in swine (PCV): a type 1 and type 2 PCV recombinant. Vet. Microbiol. 144, 18–23. Gillespie, J., Juhan, N.M., DiCristina, J., Key, K.F., Ramamoorthy, S., Meng, X.J., 2008. A genetically engineered chimeric vaccine against porcine circovirus type 2 (PCV2) is genetically stable in vitro and in vivo. Vaccine 26, 4231–4236. Gillespie, J., Opriessnig, T., Meng, X.J., Pelzer, K., Buechner-Maxwell, V., 2009. Porcine circovirus type 2 and porcine circovirus-associated disease. J. Vet. Intern. Med. 23, 1151–1163. Grasland, B., Loizel, C., Blanchard, P., Oger, A., Nignol, A.C., Bigarre, L., Morvan, H., Cariolet, R., Jestin, A., 2005. Reproduction of PMWS in immunostimulated SPF piglets transfected with infectious cloned genomic DNA of type 2 porcine circovirus. Vet. Res. 36, 685–697. Gravier, R., Dory, D., Laurentie, M., Bougeard, S., Cariolet, R., Jestin, A., 2007. In vivo tissue distribution and kinetics of a pseudorabies virus plasmid DNA vaccine after intramuscular injection in swine. Vaccine 25, 6930–6938. Madec, F., Rose, N., Grasland, B., Cariolet, R., Jestin, A., 2008. Post-weaning multisystemic wasting syndrome and other PCV2-related problems in pigs: a 12-year experience. Transbound. Emerg. Dis. 55, 273–283.

94

B. Grasland et al. / Virus Research 165 (2012) 90–94

McClenahan, S.D., Krause, P.R., Uhlenhaut, C., 2011. Molecular and infectivity studies of porcine circovirus in vaccines. Vaccine 29, 4745–4753. Oh, Y.K., Kim, J.P., Hwang, T.S., Ko, J.J., Kim, J.M., Yang, J.S., Kim, C.K., 2001. Nasal absorption and biodistribution of plasmid DNA: an alternative route of DNA vaccine delivery. Vaccine 19, 4519–4525. Roca, M., Balasch, M., Segales, J., Calsamiglia, M., Viaplana, E., Urniza, A., Hattermann, K., Mankertz, A., Plana-Duran, J., Domingo, M., 2004. In vitro and in vivo characterization of an infectious clone of a European strain of porcine circovirus type 2. J. Gen. Virol. 85, 1259–1266. Segales, J., Calsamiglia, M., Olvera, A., Sibila, M., Badiella, L., Domingo, M., 2005. Quantification of porcine circovirus type 2 (PCV2) DNA in serum and tonsillar, nasal, tracheo-bronchial, urinary and faecal swabs of pigs with and without postweaning multisystemic wasting syndrome (PMWS). Vet. Microbiol. 111, 223–229. Shibata, I., Okuda, Y., Yazawa, S., Ono, M., Sasaki, T., Itagaki, M., Nakajima, N., Okabe, Y., Hidejima, I., 2003. PCR detection of porcine circovirus type 2 DNA in whole blood, serum, oropharyngeal swab, nasal swab, and feces from experimentally infected pigs and field cases. J. Vet. Med. Sci. 65, 405–408.

Verreault, D., Letourneau, V., Gendron, L., Masse, D., Gagnon, C.A., Duchaine, C., 2010. Airborne porcine circovirus in Canadian swine confinement buildings. Vet. Microbiol. 141, 224–230. Victoria, J.G., Wang, C., Jones, M.S., Jaing, C., McLoughlin, K., Gardner, S., Delwart, E.L., 2010. Viral nucleic acids in live-attenuated vaccines: detection of minority variants and an adventitious virus. J. Virol. 84, 6033–6040. Vincent, I.E., Balmelli, C., Meehan, B., Allan, G., Summerfield, A., McCullough, K.C., 2007. Silencing of natural interferon producing cell activation by porcine circovirus type 2 DNA. Immunology 120, 47–56. Wikstrom, F.H., Fossum, C., Fuxler, L., Kruse, R., Lovgren, T., 2011. Cytokine induction by immunostimulatory DNA in porcine PBMC is impaired by a hairpin forming sequence motif from the genome of porcine circovirus type 2 (PCV2). Vet. Immunol. Immunopathol. 139, 156–166. Wikstrom, F.H., Meehan, B.M., Berg, M., Timmusk, S., Elving, J., Fuxler, L., Magnusson, M., Allan, G.M., McNeilly, F., Fossum, C., 2007. Structure-dependent modulation of alpha interferon production by porcine circovirus 2 oligodeoxyribonucleotide and CpG DNAs in porcine peripheral blood mononuclear cells. J. Virol. 81, 4919–4927.