Nano-gold plasmon coupled with dual-function quercetin for enhanced photoelectrochemical aptasensor of tetracycline

Accepted Manuscript Title: Nano-gold plasmon coupled with dual-function quercetin for enhanced photoelectrochemical aptasensor of tetracycline Author: Hongbo Li Jing Li Yunfei Qiao Hailin Fang Dahe Fan Wei Wang PII: DOI: Reference:

S0925-4005(16)31995-5 http://dx.doi.org/doi:10.1016/j.snb.2016.12.032 SNB 21406

To appear in:

Sensors and Actuators B

Received date: Revised date: Accepted date:

28-9-2016 5-11-2016 7-12-2016

Please cite this article as: Hongbo Li, Jing Li, Yunfei Qiao, Hailin Fang, Dahe Fan, Wei Wang, Nano-gold plasmon coupled with dual-function quercetin for enhanced photoelectrochemical aptasensor of tetracycline, Sensors and Actuators B: Chemical http://dx.doi.org/10.1016/j.snb.2016.12.032 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Nano-gold plasmon coupled with dual-function quercetin for enhanced photoelectrochemical aptasensor of tetracycline

Hongbo Li a *, Jing Li a, Yunfei Qiao a,b, Hailin Fang a, Dahe Fan a, Wei Wang a*

a

School of Chemistry and Chemical Engineering, Yancheng Institute of Technology, 211 East

Jianjun Road, Yancheng 224051, PR China b

School of Chemistry and Chemical Engineering, Jiangsu University, Zhenjiang 212013, PR

China

*Phone & Fax: +86-515-88298735. E-mail: [email protected]; [email protected].

Highlights 

A novel and label-free "signal-off" PEC aptasensor for tetracycline was developed.



LSPR of nano-Au and dual-function quercetin for enhanced photocurrent responses.



The PEC aptasensor exhibited excellent performances in detecting tetracycline.



The novel strategy paves a new way for the improvements in PEC sensing.

1

Abstract：A simple and novel photoelectrochemical (PEC) aptasensor for tetracycline (Tc) was developed using the enhanced photocurrent response strategy by localized surface plasmon resonance (LSPR) of nano-Au and dual-function quercetin. With the photoexcitation of simulated light, the increased photocurrent for nano-Au/TiO2 than that of pure TiO2 nanoparticles is attributed to the hot electrons from excited Au nanoparticles. Also, quercetin was chosen as both photosensitizer and electron sacrificial agent for the enlarged photocurrents and thus the high sensitivity of the PEC aptasensor. The excellent selectivity is assigned to the specific binding of Tc to its aptamer. On the optimized condition, the PEC response was linear with the concentration of Tc in the range from 0.3 to 1600 nmol L-1 with a detection limit of 0.1 nmol L-1. The same concentration of other conventional organics did not interfere in the detection of Tc and the recovery was between 93.7% and 105.3%. Finally, the PEC aptasensor was successfully for the detection of Tc in liquid milk samples with good performance in wide linear range, low cost, high selectivity and sensitivity. Also, it provided an alternative approach to the detection of Tc.

Keywords: Photoelectrochemistry, Aptasensor, Localized surface plasmon resonance, Quercetin, Tetracycline

2

1. Introduction Photoelectrochemical (PEC) detection is based on the combination of an electrochemical instrument and an irradiation source [1]. It has the advantages of both optical and electrochemical analysis due to the complete separation of light excitation source and lower background photocurrent detection signal [2]. In order to further improve the separations of photon-generated carriers and thus the sensitivities of PEC strategies, varieties of approaches such as dye sensitizations [3-7], heterojunctions [8-13], metal-doped semiconductors [14-16] have been performed. Recently the use of nano-Au [6, 17, 18] or silver [19] has also been introduced in PEC detection systems due to their localized surface plasmon resonance (LSPR), which occurs in properly designed nanostructures and can confine free electrons oscillate with the same frequency of the incident radiation [20]. The outstanding light-trapping and electromagnetic-field-concentrating properties of surface plasmons are very favorable to promote the separation of photonic carriers and thus increase the sensitivity of PEC sensors. However, the PEC sensing strategy based on noble-metal plasmons is still in its infancy. Tetracycline (Tc) is a member of broad-spectrum antibiotics, it is extensively used as a veterinary drug or feed additive to prevent and treat bacterial infections or promote the growth of livestock [21]. However, the abuse of Tc may cause the accumulation of antibiotics in animal products and it will potentially result in a risk to human health. European Union (EU) has set the maximum residue limits (MRLs) for Tc as 0.3 mg kg −1 in liver, 0.6 mg kg −1 in kidney, 0.2 mg kg−1 in egg, and 0.1 mg kg−1 3

(about 200×10–9 mol L-1 ) in milk or muscle tissues [22]. Therefore, sensitive and specific approaches for detection of Tc in food products are necessary [23]. Up to now, various analytical methods for the detection of Tc have been developed including immunoassays [24], high performance liquid chromatography (HPLC) [25, 26], microbiological methods [27], chemiluminescence [28], capillary electrophoresis (CE) [29], electroanalysis [23, 30-32], colorimetric analysis [21, 22], and fluorescent detection [33, 34]. However, each of these methods suffers from at least one undesirable limitation, such as limited selectivity, low sensitivity, operational complexity, lack of portability, economy or speed. Aptasensors, one kind of affinity-based biosensors using aptamer as recognition element and commonly constructed with different signal transducers, have attracted remarkable attentions in analytical assays [35]. Aptamers are synthetic nucleic acid sequences, selected by Systematic Evolution of Ligands by Exponential Enrichment (SELEX) [36]. They can bind various molecular targets with high specificity and affinity such as small molecules, proteins and even whole cells and viruses [37]. Compared to antibodies or other biological recognition elements, aptamers exhibit many unique advantages such as low cost, easy production, high thermal and chemical stability, reproducible synthesis and not involved with immunogenicity and toxicity [23]. Therefore, the high-sensitive PEC assay technique coupled aptamer with unique properties will bring out good performance in PEC aptasensing [38]. In this work, we developed a novel signal amplification strategy using nano-gold plasmon coupled with dual-function quercetin for a label-free and “signal-off” PEC 4

aptasensor of Tc (see Scheme 1). Herein, gold nanoparticles act as the role of the immobilization matrix for Tc-aptamer. Moreover, plasmonic gold nanoparticles can also directly convert the collected light into electrical energy by generating hot electrons, which can be injected in the conduction band of TiO2 nanoparticles and thus enhanced the photoelectric conversion efficiency and the analytical performance. In order to further enhance photocurrent response and the high sensitivity of the PEC aptasensor, quercetin was chosen as both photosensitizer and electron sacrificial agent in this case. The HOMO, LUMO energy levels of quercetin are -5.09 eV, -2.67 eV versus the vacuum level, respectively and thus a band gap of 2.42 eV can be obtained [39]. Therefore, quercetin is a narrow bandgap and environment-friendly photosensitizer in nature. Compared to the conventional electron donor ascorbic acid (AA) in PEC sensing system, quercetin has a much greater electron donor ability in the FRAP (ferric reducing antioxidant power) assay [40]. Finally, triple signal amplification of nano-Au plasmon coupled with dual-function quercetin based PEC aptasensor has been applied to the detection of Tc and the analytical mechanism and properties have also been investigated systematically. Scheme 1 is here.

2. Experimental 2.1 Reagents and apparatus All reagents used were analytical grade and were used directly without purification. Tc was obtained from Aladdin (Shanghai, PR China). Ammonium hexafluorotitanate ((NH4)2TiF6), boric acid (H3BO3), chloroauric acid (HAuCl4∙4H2O), 5

tris (hydroxymethyl) aminomethane (Tris-HCl), sodium citrate (C6H5Na3O7∙2H2O) and potassium borohydride (KBH4) were purchased from sinopharm chemical reagent Co., Ltd. (Shanghai, PR China). Aptamer was chosen according to the prior reported literature [41]. The oligonucleotides used were purchased from Sangon Biotech Co., Ltd. (Shanghai, PR China) with the sequences: 5'-(SH)-(CH2)6-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATC CGAGCTCCACGTG-3'. The Tc-aptamer was dissolved in Tris-EDTA buffer (TE, pH 8.0) and kept frozen. In this work, 0.1 mol L−1 phosphate buffer solution (PBS) of pH 7.0 was always employed as the supporting electrolyte for PEC detection. The ultrapure water with 18.2 MΩ cm−1 was used throughout the whole experiments. PEC measurements were performed with a PEC system equipped with a 150 W Xe lamp as the irradiation source (simulated sunlight irradiation) (Zolix, Beijing, China). The photocurrent was measured by the current–time curve experimental technique using a CHI660E electrochemical workstation (CH Instruments, Shanghai, China). All experiments were carried out at room temperature using a conventional three-electrode system: a modified ITO (φ= 5 mm, resistivity 10 Ω/sq, Zhuhai Kaivo Electronic Components Co. Ltd., China) as the working electrode, a saturated calomel electrode as the reference electrode, and a Pt wire as the counter electrode. Transmission electron micrographs (TEM) were performed using a Tecnai 12 TEM (Philips, Netherlands). High resolution transmission electron micrographs (HRTEM) were implemented by a Tecnai G2 F30 S-TWIN (FEI, USA). UV-Vis diffuse reflection spectra were recorded at room temperature with a Cary 5000 ultraviolet and 6

visible spectrophotometer (Varian, USA). X-ray diffraction (XRD) patterns of TiO2 and Au/TiO2 were measured in the range of 2θ = 10–80° by step scanning on the Bruker D8 Advance (super speed) diffractometer (Bruker-AEX, Germany) with Cu Kα radiation (κ = 0.15406 nm) operated at 40 kV and 100 mA. X-ray photoelectron spectroscopy (XPS) measurements were performed with an Ultra Axis spectrophotometer equipped with a monochromatic Al Kα source operated at 150W (V.G. Scientific. Ltd, England). 2.2 Preparation of nano Au/TiO2-based PEC sensing Firstly, the ITO electrode (1 cm×4 cm) was cleaned with the mixed solution containing hydrogen peroxide, ammonia and water with volume ratio of 1 : 1 : 50, and it was finally washed by ultrapure water and dried in air. Meanwhile, 0.15 mol L-1 boric acids were added to 0.05 mol L-1 ammonium hexafluorotitanate solutions. After intensive mixing, the mixed solution of pH 2.5 was obtained by adjustion of HCl [42]. Then, the cleaned ITO substrate was immersed vertically in the middle of the mixed solution and kept at 50 ◦C for 48 h. Afterwards, the nano-TiO2 film was rinsed with ultrapure water and absolute ethanol for several times and annealed at 500 ◦C for 60 min in air. Next, Au nanoparticles were prepared by using KBH4 as a reductant and stabilized with sodium citrate following the literature [43]. 5 mL of 1% HAuCl4 and 10 mL of 0.03 mol L-1 sodium citrate were added in 250 mL of ultrapure water and stirred. Then 5 mL of 0.1 mol L-1 fresh KBH4 solution was added, and the mixed solution was stirred at room temperature for 24 h. Finally, the diameter of the Au nanoparticles about 13 nm was obtained. Next, the nano-TiO2 film was immersed in 7

the suspension of Au NPs for 24 h, and then the Au/TiO2 photoanode was successfully prepared after it was thoroughly rinsed with ultrapure water. Secondly, the Au/TiO2/ITO photoanode was immersed in Tc-aptamer solution (1 μmol L-1) at 4 ◦C overnight for assembly of the aptamer on its surface, and it was rinsed with Tris–HCl buffer to remove the unlinked aptamers. Then, the assembled aptamer/Au/TiO2/ITO photoanode was covered with 10 μL of 1 mmol L-1 mercaptoethanol (MCH) and kept at room temperature for 30 min to block nonspecific sites. Finally, the MCH/aptamer/Au/TiO2/ITO photoanode was thus successfully developed after the rinsing of ethanol and ultrapure water for several times.

3. Results and discussion 3.1 Characterization of synthesized nanomaterials Transmission electron micrographs (TEM) were used to investigate the morphology and microstructure of TiO2 and Au/TiO2 nanoparticles in Fig. S-1. As the TEM images can be seen from Fig. S-1(A), the mean size of TiO2 nanoparticles was 35 ± 6 nm. After the coverage of Au nanoparticles on the surface of nano-TiO2, the TEM image of Au/TiO2 showed that the mean size of Au nanoparticles was 13 ± 3 nm in Fig. S-1(B). In order to clearly confirm that Au nanoparticles were deposited on the surfaces of nano-TiO2, HRTEM images of Au/TiO2 nanoparticles were also shown in Fig. S-1 (C) and (D). It can be seen that Au nanoparticles with a mean size of 13 ± 3 nm were deposited on the anatase TiO2{101} surface with an orientation relationship of Au{111} ‖ TiO2{101}. The introduction of Au nanoparticles not only acts as the 8

role of the substrate for the immobilization of Tc-aptamer but also the separation promoter for the photonic carriers of nano-TiO2 owing to their instinct LSPR effects. The X-ray diffraction (XRD) patterns of the pure TiO2 sample and Au/TiO2 nanocomposite were presented in Fig. 1(A). For pure TiO2, all peaks could be well indexed as the anatase phase (JCPDS card No. 02-0406) and no peaks for any other phase or impurities could be detected. As also can be seen from Fig. 1(A), the four diffraction peaks at 38.3°, 44.6°, 64.7° and 77.5° could be assigned to the (111), (200), (220) and (311) planes of face-centered cubic (fcc) Au (JCPDS 01-1172) in comparison to pure TiO2 nanoparticles. The Au/TiO2 nanocomposite did not show any peak shift and the intensities of peaks were consistent with those of nano-TiO2, indicating that the TiO2 matrix was well maintained as the anatase phase. It also can be explained that the introduced gold nanoparticles did not alter the crystalline properties of the TiO2 matrix. Fig. 1(B) showed the UV-Vis diffuse reflectance spectra of pure nano-TiO2 and Au/TiO2 nanoparticles in the range of 200-800 nm. It could be clearly seen that the pure nano-TiO2 was inactive in the visible range due to its big energy band gap (~3.2 eV). Under the wavelength of 380 nm (corresponding to the biggest absorption edge of nano-TiO2), the Au/TiO2 still displayed much stronger absorbance than that of pure TiO2, indicating a strong interaction between the nano-Au and TiO2 semiconductor. Nano-Au, as an excellent electronic conductor, could promote the rapid transfer of TiO2 photoelectrons. Also, it could accelerate the separation of photo-carriers and lead to a decreased recombination rate [44]. 9

Compared to pure TiO2, the extra absorption band of Au/TiO2 was observed in the visible wavelength of 510–675 nm (corresponding to the plasmon peak of nano-Au). The enhanced absorption was attributed to the LSPR of Au nanoparticles, which extended the photoresponse range of TiO2 nanoparticles. Thus, TiO2 nanoparticles modified with Au nanoparticles were favorable to improve the sensitivity of PEC sensing. Fig. 1 is here. XPS is a very useful technique to analyze the chemical environment of materials and has been carried out to check the chemical composition of the Au/TiO2 nanoparticles. As shown in Fig. 2(A), all of the peaks were assigned to Ti, Au, C, and O elements, further indicating that the Au/TiO2 nanoparticles were successfully obtained without any existing impurity. The high resolution XPS spectrum of Ti 2p shown in Fig. 2(B) clearly showed that the two peaks located at 458.3 eV and 463.9 eV corresponded to Ti 2p3/2 and Ti 2p5/2, respectively. The energy difference between the two peaks was 5.6 eV, which clearly indicated that titanium species was in the formal Ti4+ valence state [45]. Fig. 2(C) showed binding energies of Au 4f7/2 at 83.4 eV and Au 4f5/2 at 87.2 eV, which are significantly different from Au+ 4f7/2 (84.6 eV) and Au3+ 4f7/2 (87.0 eV) but similar to Au0 4f7/2 (84.0 eV). It suggests that the Au species are present in the metallic state and the negative shift of Au0 4f7/2 (0.6 eV) indicates strong interactions between Au and the TiO2 nanoparticles [46]. The carbon 1s spectrum with three deconvoluted peaks positioned at 284.6, 286.1, and 288.6 eV were respectively shown in Fig. 2(D), it was mainly derived from adventitious carbon. 10

The binding energies of O 1s were showed in Fig. 2(E), which had three different binding energy positions. The peak located at about 529.8 eV can be assigned to lattice oxygen in anatase TiO2. The other two peaks located at 533.2 and 531.7 eV can be attributed to oxygen species in H2O molecules and CO32-, respectively [45]. Fig. 2 is here. 3.2 PEC sensing response and analytical mechanism 3.2.1 Effect of different amount of quercetin on PEC sensing response Quercetin, both as a sensitizer and as an electron donor, can efficiently promote the separation of photonic carriers and improve the sensitivity of PEC sensing [39]. Therefore, the amount of quercetin in the PEC cell should be optimized. After 0, 50, 100, 150, 200, 250 and 300 µL of 0.1 mol L-1 quercetin was added in 30 mL of 0.1 mmol L-1 PBS (pH 7.0) respectively, the photocurrent responses at the aptamer/Au/TiO2 photoanodes were measured at a bias voltage of 0.2 V with simulated sunlight light irradiation. As can be seen in Fig. S-2, the photocurrent increased until the addition of 200 µL quercetin and arrived at a maximum of 5.12±0.25 μA. It can be attributed that the more photoresponsive quercetin is on the photoanode, the more exited electrons can be produced and injected in the excited state nano-Au or the conduction band of TiO2 and then to the ITO electrode. Also, quercetin is an excellent electron donor and it is beneficial to enlarge the photocurrent response of aptamer/Au/TiO2 photoanode. However, extra quercetin in PBS may prevent the absorbance of incident light and block the transfer of electrons from quercetin to aptamer/Au/TiO2 photoanode. Therefore, 200 µL of 0.1 mol L-1 quercetin 11

was chosen for further studies. 3.2.2 PEC mechanism The pure TiO2 nanoparticles modified ITO showed a photocurrent of 0.39 μA at a bias of 0.2 V in 0.1 mol L-1 PBS (pH 7.0) with the simulated sunlight irradiation (Fig. 3, curve a), while the Au/TiO2 nanocomposites modified ITO showed a photocurrent of 2.55 μA (Fig. 3, curve c), which was 5.54 times increment of that observed at the TiO2/ITO. The obviously enhanced photocurrent could be attributed to the hot electrons produced in the Au nanoparticles owing to LSPR effect and injected in the conduction band of TiO2 by the visible light irradiation. Moreover, the rapid electron communication between nano-Au nanoparticles and TiO2 nanoparticles reduced the recombination of photonic carriers [44]. After the 200 µL of 0.1 mol L-1 quercetin was added in the PEC sensing systems of TiO2 and Au/TiO2-based photoanodes, respectively. The corresponding 2.39 times (curve b and a) and 1.01 times increament of photoresponse (curve d and c) for TiO2 and Au/TiO2-based photoanodes were obtained, respectively. The increased photocurrent can be assigned to quercetin both as a sensitizer and an electron donor [39]. While Tc-aptamer was immobilized on the Au/TiO2-based photoanode, the photocurrent decreased to 4.85 μA (Fig. 3, curve e). It can be explained that the immobilization of Tc-aptamer on Au nanoparticles blocked the irradiation of incident light reaching the surface Au/TiO2 nanoparticles and then inhibited the LSPR effects of nano-Au. Also, Tc-aptamer coated on Au/TiO2-based photoanode inhibited electron communication in PEC sensing systems [47]. With the addition of 100 nmol L-1 Tc, the photocurrent decreased to 3.81 μA (Fig. 3, curve f) 12

owing to the conformation change of Tc-aptamer, which subsequently closed the entrance of long passageways and resulted in the blockage of electron transfer. The more amount of Tc will bring about more formation of closed aptamer gate, leading to the more decrement of photocurrent. Therefore, the concentration of Tc can be quantified by the decreased photocurrent. Fig. 3 is here. 3.3 Analytical performance The photocurrent–time curves of the fabricated PEC aptasensor clearly showed the rapid response (the response time is 10 seconds) in different concentrations of Tc at a bias voltage of 0.2 V with the simulated sunlight irradiation. As can be seen in Fig. 4(A), the photocurrent gradually decreased with the increased concentration of Tc. Fig. 4(B) clearly indicated that there was a linear relationship between log C and (I0 – I). Here, log C refered to the logarithm of the concentrations of Tc, while the I0 and I represented the photocurrent intensity of the aptamer/Au/TiO2-based photoanode system in the absence and presence of Tc, respectively. The liner range was from 0.3 nmol L-1 to 1600 nmol L-1 with a detection limit of 0.1 nmol L-1, which was lower than the previous reports (as shown in Table S-1). The good performance is attributed to the LSPR of gold nanoparticles, which effectively promote the charges separation of TiO2 nanoparticles and amplify their photocurrents with irradiation. Moreover, quercetin was chosen as both photosensitizer and electron donor in this case. Therefore, the increased photocurrent of 12.13 times was beneficial to construct "signal-off" PEC sensing model with wide linear range. 13

Fig. 4 is here. Stability, an important parameter for the performance of the PEC aptasensor, was also investigated in Fig. 3. It demonstrated that the photoexcited process repeated 10 times over 220 s and indicated the photocurrent responses of the fabricated PEC aptasensor in the absence (curve e) and presence (curve f) of 100 nmol L-1 Tc at a bias voltage of 0.2 V with the simulated sunlight irradiation. The cycle photocurrents were almost not significant difference during the photoexcitation process, indicating that this PEC aptasensor had good performance in stability. The PEC sensor for Tc showed good fabrication reproducibility with a relative standard deviation of 4.8% estimated from the slopes of the calibration plots of five freshly prepared PEC aptasensors. When the PEC sensor was not in use, it was stored in refrigerator at 4◦C and measured every few weeks. No obvious decrease in the photocurrent response to Tc was observed after two weeks, and 94.6% of the initial photocurrent response was maintained after four weeks. This implies that the structure of aptamer/Au/TiO2/ITO is efficient for retaining the activity of the PEC aptasensor. The selectivity of the fabricated PEC aptasensor for Tc was also investigated by comparison with other conventional species, such as doxycycline, kanamycin, oxytetracycline and diclofenac at the same concentration of 100 nmol L-1. As shown in Fig. 5, the interference ratios of the above conventional species for the determination of Tc were no more than 7%, indicating the prepared PEC aptasensor had high selectivity, which can be attributed to the specificity of Tc to its aptamer. Fig. 5 is here. 14

To estimate the feasibility of the PEC aptasensor for the real samples, the liquid milk from Wenfeng supermarket (Yancheng, PR China) was chosen as real samples (see Table 1). The liquid milk samples were pretreated according to the reference [48] with some modification. Briefly, the mixture of 20 mL milk and 40 mL anhydrous alcohol was sonicated for 15 min and then 10 min shaking. Next, the mixture was centrifuged for 10 min, and then the supernatant was collected for constant volume of 100 mL by addition of ultrapure water. Finally, the above solution was mixed with 0.2 mol L-1 PBS (pH 7.0) at a ratio of 1 : 1. Table 1 is here.

4. Conclusions Briefly, a label-free and novel "signal-off" PEC aptasensor for selective detection of Tc was successfully constructed based on the sensitized strategy of nano-Au and dual-function quercetin. The pure TiO2 and Au/TiO2 nanoparticles were characterized by TEM, XRD, XPS, and UV-Vis DRS. Meanwhile, the fabricated PEC aptasensor exhibited good performance in stability, reproducibility, selectivity, sensitivity and wide linear range. Moreover, the PEC aptasensor has been successfully applied to detect Tc in liquid milk samples. The platform based on this enhanced strategy is beneficial to develop other PEC sensing.

15

Acknowledgements We gratefully acknowledge the financial support from the Natural Science Foundation of China (21305123, 21505117, 21575123), the Natural Science Foundation of Jiangsu Province (BK20161309, BK2012247, BK20131218), the Foundation of Jiangsu Key Laboratory of Environmental Material and Environmental Engineering (K13064), the Foundation of Key Laboratory for Advanced Technology in Environmental Protection of Jiangsu Province (AE201162, AE201017), the research fund of Jiangsu Collaborative Innovation Center for Ecological Building Materials and Environmental Protection Equipments

(GX2015103).

References [1] W.W. Zhao, J.J. Xu, H.Y. Chen, Photoelectrochemical bioanalysis: the state of the art, Chem. Soc. Rev. 44 (2015) 729-741. [2] W.W. Zhao, J.J. Xu, H.Y. Chen, Photoelectrochemical DNA biosensors, Chem. Rev. 114 (2014) 7421-7441. [3] W. Tu, Y. Dong, J. Lei, H. Ju, Low-potential photoelectrochemical biosensing using porphyrin-functionalized TiO2 nanoparticles, Anal. Chem. 82 (2010) 8711-8716. [4] Z. Yan, Z. Wang, Z. Miao, Y. Liu, Dye-sensitized and localized surface plasmon resonance enhanced visible-light photoelectrochemical biosensors for highly sensitive analysis of protein kinase activity, Anal. Chem. 88 (2016) 922-929. 16

[5] H. Li, J. Li, Q. Xu, Z. Yang, X. Hu, A derivative photoelectrochemical sensing platform for 4-nitrophenolate contained organophosphates pesticide based on carboxylated perylene sensitized nano-TiO2, Anal. Chim. Acta 766 (2013) 47-52. [6] J. Li, W. Tu, H. Li, M. Han, Y. Lan, Z. Dai, J. Bao, In situ-generated nano-gold plasmon-enhanced photoelectrochemical aptasensing based on carboxylated perylene-functionalized graphene, Anal. Chem. 86 (2014) 1306-1312. [7] H. Li, Y. Mu, J. Yan, D. Cui, W. Ou, Y. Wan, S. Liu, Label-free photoelectrochemical immunosensor for neutrophil gelatinase-associated lipocalin based on the use of nanobodies, Anal. Chem. 87 (2015) 2007-2015. [8] J. Zhuang, D. Tang, W. Lai, M. Xu, D. Tang, Target-induced nano-enzyme reactor mediated hole-trapping for high-throughput immunoassay based on a split-type photoelectrochemical detection strategy, Anal. Chem. 87 (2015) 9473-9480. [9] S. Zhou, Y. Kong, Q. Shen, X. Ren, J.R. Zhang, J.J. Zhu, Chronic myeloid leukemia drug evaluation using a multisignal amplified photoelectrochemical sensing platform, Anal. Chem. 86 (2014) 11680-11689. [10] M. Zhao, G.C. Fan, J.J. Chen, J.J. Shi, J.J. Zhu, Highly sensitive and selective photoelectrochemical biosensor for Hg2+ detection based on dual signal amplification by exciton energy transfer coupled with sensitization effect, Anal. Chem. 87 (2015) 12340-12347. [11] X. Zhang, S. Li, X. Jin, S. Zhang, A new photoelectrochemical aptasensor for the detection of thrombin based on functionalized graphene and CdSe nanoparticles multilayers, Chem. Commun. 47 (2011) 4929-4931. 17

[12] W.W. Zhan, Q. Kuang, J.Z. Zhou, X.J. Kong, Z.X. Xie, L.S. Zheng, Semiconductor@metal–organic framework core–shell heterostructures: a case of ZnO@ZIF-8 nanorods with selective photoelectrochemical response, J. Am. Chem. Soc. 135 (2013) 1926-1933. [13] J. Tang, J. Li, Y. Zhang, B. Kong, Y. Wang, Y. Quan, H. Cheng, A.M. Al-Enizi, X. Gong, G. Zheng, Mesoporous Fe2O3–CdS heterostructures for real-time photoelectrochemical dynamic probing of Cu2+, Anal. Chem. 87 (2015) 6703-6708. [14] Q. Shen, L. Han, G. Fan, J.R. Zhang, L. Jiang, J.J. Zhu, “Signal-on” photoelectrochemical biosensor for sensitive detection of human T-cell lymphotropic virus type II DNA: dual signal amplification strategy integrating enzymatic amplification with terminal deoxynucleotidyl transferase-mediated extension, Anal. Chem. 87 (2015) 4949-4956. [15] H. Li, Y. Qiao, J. Li, H. Fang, D. Fan, W. Wang, A sensitive and label-free photoelectrochemical aptasensor using Co-doped ZnO diluted magnetic semiconductor nanoparticles, Biosen. Bioelectron. 77 (2016) 378-384. [16] G.C. Fan, L. Han, H. Zhu, J.R. Zhang, J.J. Zhu, Ultrasensitive photoelectrochemical immunoassay for matrix metalloproteinase-2 detection based on CdS: Mn/CdTe cosensitized TiO2 nanotubes and signal amplification of SiO2@Ab2 conjugates, Anal. Chem. 86 (2014) 12398-12405. [17] Y. Xin, Z. Li, Z. Zhang, Photoelectrochemical aptasensor for the sensitive and selective detection of kanamycin based on Au nanoparticle functionalized self-doped TiO2 nanotube arrays, Chem. Commun. 51 (2015) 15498-15501. 18

[18] Y.C. Zhu, N. Zhang, Y.F. Ruan, W.W. Zhao, J.J. Xu, H.Y. Chen, Alkaline phosphatase tagged antibodies on gold nanoparticles/TiO2 nanotubes electrode: a plasmonic strategy for label-free and amplified photoelectrochemical immunoassay, Anal. Chem. 88 (2016) 5626-5630. [19] W.W. Zhao, P.P. Yu, Y. Shan, J. Wang, J.J. Xu, H.Y. Chen, Exciton-plasmon interactions between CdS quantum dots and Ag nanoparticles in photoelectrochemical system and its biosensing application, Anal. Chem. 84 (2012) 5892-5897. [20] K.M. Mayer, J.H. Hafner, Localized surface plasmon resonance sensors, Chem. Rev. 111 (2011) 3828-3857. [21] M. Ramezani, N.M. Danesh, P. Lavaee, K. Abnous, S.M. Taghdisi, A novel colorimetric triple-helix molecular switch aptasensor for ultrasensitive detection of tetracycline, Biosen. Bioelectron. 70 (2015) 181-187. [22] J. Hou, H. Zhang, Q. Yang, M. Li, L. Jiang, Y. Song, Hydrophilic-hydrophobic patterned molecularly imprinted photonic crystal sensors for high-sensitive colorimetric detection of tetracycline, Small 11 (2015) 2738-2742. [23] S.M. Taghdisi, N.M. Danesh, M. Ramezani, K. Abnous, A novel M-shape electrochemical aptasensor for ultrasensitive detection of tetracyclines, Biosen. Bioelectron. 85 (2016) 509-514. [24] M. Jeon, I.R. Paeng, Quantitative detection of tetracycline residues in honey by a simple sensitive immunoassay, Anal. Chim. Acta 626 (2008) 180-185. [25] M.X. Feng, G.N. Wang, K. Yang, H.Z. Liu, J.P. Wang, Molecularly imprinted polymer-high performance liquid chromatography for the determination of 19

tetracycline drugs in animal derived foods, Food Control 69 (2016) 171-176. [26] A.Y. Udalova, S. Dmitrienko, S. Natchuk, V. Apyari, Y.A. Zolotov, Preconcentration of tetracycline antibiotics on a hyper-crosslinked polystyrene and their determination in waters by high-performance liquid chromatography, J. Anal. Chem. 70 (2015) 292-297. [27] F. Idowu, K. Junaid, A. Paul, O. Gabriel, A. Paul, N. Sati, M. Maryam, U. Jarlath, Antimicrobial screening of commercial eggs and determination of tetracycline residue using two microbiological methods, Int. J. Poultry Sci. 9 (2010) 959-962. [28] A. Townshend, W. Ruengsitagoon, C. Thongpoon, S. Liawruangrath, Flow injection chemiluminescence determination of tetracycline, Anal. Chim. Acta 541 (2005) 103-109. [29] P. Kowalski, Capillary electrophoretic method for the simultaneous determination of tetracycline residues in fish samples, J. Pharmaceut. Biomed. Anal. 47 (2008) 487-493. [30] S. Jahanbani, A. Benvidi, Comparison of two fabricated aptasensors based on modified carbon paste/oleic acid and magnetic bar carbon paste/Fe3O4@oleic acid nanoparticle electrodes for tetracycline detection, Biosen. Bioelectron. 85 (2016) 553-562. [31] R.T. Kushikawa, M.R. Silva, A.C. Angelo, M.F. Teixeira, Construction of an electrochemical sensing platform based on platinum nanoparticles supported on carbon for tetracycline determination, Sens. Actuators, B: Chem. 228 (2016) 207-213. [32] A. Wong, M. Scontri, E.M. Materon, M.R. Lanza, M.D. Sotomayor, 20

Development and application of an electrochemical sensor modified with multi-walled carbon nanotubes and graphene oxide for the sensitive and selective detection of tetracycline, J. Electroanal. Chem. 757 (2015) 250-257. [33] M.R. Chao, C.W. Hu, J.L. Chen, Glass substrates crosslinked with tetracycline-imprinted polymeric silicate and CdTe quantum dots as fluorescent sensors, Anal. Chim. Acta 925 (2016) 61-69. [34] J. Hou, H. Li, L. Wang, P. Zhang, T. Zhou, H. Ding, L. Ding, Rapid microwave-assisted synthesis of molecularly imprinted polymers on carbon quantum dots for fluorescent sensing of tetracycline in milk, Talanta 146 (2016) 34-40. [35] R. Sharma, K. Ragavan, M. Thakur, K. Raghavarao, Recent advances in nanoparticle based aptasensors for food contaminants, Biosen. Bioelectron. 74 (2015) 612-627. [36] S. Wang, J. Liu, W. Yong, Q. Chen, L. Zhang, Y. Dong, H. Su, T. Tan, A direct competitive assay-based aptasensor for sensitive determination of tetracycline residue in honey, Talanta 131 (2015) 562-569. [37] M. Yan, W. Bai, C. Zhu, Y. Huang, J. Yan, A. Chen, Design of nuclease-based target recycling signal amplification in aptasensors, Biosen. Bioelectron. 77 (2016) 613-623. [38] W.W. Zhao, J.J. Xu, H.Y. Chen, Photoelectrochemical aptasensing, TrAC, Trends Anal. Chem. 82 (2016) 307-315. [39] H. Li, J. Li, W. Wang, Z. Yang, Q. Xu, X. Hu, A subnanomole level photoelectrochemical sensing platform for hexavalent chromium based on its 21

selective inhibition of quercetin oxidation, Analyst, 138 (2013) 1167-1173. [40] D. Sun-Waterhouse, B.G. Smith, C.J. O’Connor, L.D. Melton, Effect of raw and cooked onion dietary fibre on the antioxidant activity of ascorbic acid and quercetin, Food Chem. 111 (2008) 580-585. [41] S. Wang, W. Yong, J. Liu, L. Zhang, Q. Chen, Y. Dong, Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey, Biosen. Bioelectron. 57 (2014) 192-198. [42] Y. Masuda, M. Bekki, S. Sonezaki, T. Ohji, K. Kato, Dye adsorption characteristics of anatase TiO2 film prepared in an aqueous solution, Thin Solid Films 518 (2009) 845-849. [43] H. Pan, R. Cui, J.J. Zhu, CdTe quantum dots as probes for near-infrared fluorescence biosensing using biocatalytic growth of Au nanoparticles, J. Phys. Chem. B 112 (2008) 16895-16901. [44] Z. Bian, J. Zhu, F. Cao, Y. Lu, H. Li, In situ encapsulation of Au nanoparticles in mesoporous core–shell TiO2 microspheres with enhanced activity and durability, Chem. Commun. 25 (2009) 3789-3791. [45] J. Li, H.C. Zeng, Preparation of monodisperse Au/TiO2 nanocatalysts via self-assembly, Chem. Mater. 18 (2006) 4270-4277. [46] H. Li, Z. Bian, J. Zhu, Y. Huo, H. Li, Y. Lu, Mesoporous Au/TiO2 nanocomposites with enhanced photocatalytic activity, J. Am. Chem. Soc. 129 (2007) 4538-4539. [47] Y. Qiao, J. Li, H. Li, H. Fang, D. Fan, W. Wang, A label-free 22

photoelectrochemical aptasensor for bisphenol A based on surface plasmon resonance of gold nanoparticle-sensitized ZnO nanopencils, Biosen. Bioelectron. 86 (2016) 315-320. [48] H. Yin, L. Cui, Q. Chen, W. Shi, S. Ai, L. Zhu, L. Lu, Amperometric determination of bisphenol A in milk using PAMAM–Fe3O4 modified glassy carbon electrode, Food Chem. 125 (2011) 1097-1103.

Biographies Hongbo Li is an associate professor in School of Chemistry and Chemical Engineering, Yancheng Institute of Technology, PR China. He received his MS in applied chemistry from University of Science and Technology Liaoning, PR China in 2007, and his Ph.D. in analytical chemistry from Yangzhou University, PR China in 2011. His current fields of interest include photoelectrochemical and electrochemical sensors. Jing Li received her Ph.D. in biophysical chemistry from Nanjing Normal University, PR China in 2016. Now she is an associate professor of Yancheng Institute of Technology, PR China. Her research interest is in the area of photoelectrochemical biosensor. Yunfei Qiao received her BS degree from Yancheng Institute of Technology, PR China in 2013. He entered the MS course in Jiangsu University and Yancheng Institute of Technology, PR China in 2013, majored in analytical chemistry. Now, he is engaged in photoelectrochemical sensor. Hailin Fang received her B.S. and M.S. degrees in chemistry from Qingdao University of Science and Technology (China) in 1987 and Nanjing University of Technology (China) in 2000, respectively. Now she is a professor of Yancheng Institute of Technology, China. Her research interests are in the areas of organic and 23

analytical chemistry. Dahe Fan received his MS degree in chemistry from Nanjing University of Technology (China) in 2000. Now he is a full professor of Yancheng Institute of Technology (China). His research interests are in the areas of chromatography. Wei Wang received his BS and PhD degree in analytical chemistry from Nanjing University, PR China in 1991 and 2007, respectively. Now he is a full professor of Yancheng Institute of Technology, PR China. His research interests are in the areas of microfluidics and electrochemical detection.

24

Fig. 1. (A) X-ray diffraction patterns and (B) UV-Vis diffuse reflection of TiO2 (a) and Au/TiO2 nanoparticles (b). Fig. 2. XPS spectrum of Au/TiO2 nanoparticles, (A) XPS survey; (B), (C), (D) and (E) correspond to the high-resolution XPS at Ti 2p, Au 4f, C 1s and O 1s, respectively. Fig. 3. Photocurrent response of TiO2/ITO (a, b) and Au/TiO2/ITO (c, d) in the absence (a, c) and presence (b, d) of 200 μL of 0.1 mol L-1 quercetin; Aptamer-based Au/TiO2/ITO in the absence (e) and presence (f) of 100 nmol L-1 Tc in 0.1 mol L-1 PBS (pH 7.0) containing 200 μL of 0.1 mol L-1 quercetin at a bias voltage of 0.2 V with simulated sunlight irradiation (150 W Xe lamp). Fig. 4. (A) Photocurrent responses of the prepared aptamer-based nano Au/TiO2 photoanode in 0.1 mol·L-1 PBS (pH 7.0) containing 0, 0.3, 0.6, 1, 5, 10, 30, 60, 100, 300, 600, 1000, 1300 and 1600 nmol·L-1 (from a to n) Tc with 200 μL of 0.1 mol L-1 quercetin at a bias potential of 0.2 V under the simulated sunlight irradiation and (B) the linear calibration curve. Fig. 5. Selectivity of the prepared PEC aptasensor for Tc detection, the concentration of other conventional species was the same as that of Tc (100 nmol L-1).

25

Figure 1

26

Figure 2

27

Figure 3

28

Figure 4

29

Figure 5

30

Scheme 1. Schematic illustration of the quercetin sensitized PEC aptasensor based on Au/TiO2 nanoparticles modified with Tc-aptamers.

31

Table 1 Analytical results of Tc in liquid milk samples using the proposed method (n=3).

Sample 1 2 3 4

Added (nmol L-1) 0 50 100 200

Found (nmol L-1) 0 48.2 93.7 210.6

32

Recovery (%) – 96.4 93.7 105.3

RSD (%) 1.7 3.9 3.3 4.2