Nasal carriage of enterotoxigenic Staphylococcus aureus among food handlers in Kerbala city

+

MODEL

Available online at www.sciencedirect.com

H O S T E D BY

ScienceDirect Karbala International Journal of Modern Science xx (2017) 1e6 http://www.journals.elsevier.com/karbala-international-journal-of-modern-science/

Nasal carriage of enterotoxigenic Staphylococcus aureus among food handlers in Kerbala city Hiba Mahdi Mahmood Alhashimi a,*, Mohanad Mohsin Ahmed b, Jassim Mohamed Mustafa a b

a Department of Biology, College of Sciences, University of Kerbala, Kerbala, Iraq Department of Microbiology, College of Medicine, University of Kerbala, Kerbala, Iraq

Received 17 September 2016; revised 10 February 2017; accepted 10 February 2017

Abstract Background: Staphylococcal Food Poisoning (SFP) is an intoxication caused by consumption of improperly prepared or stored foods containing adequate amounts of one (or more) preformed enterotoxin. Previous studies demonstrated that employees who working in the food industry are the main source for spreading foodborne diseases. Aims: To study the prevalence of the staphylococcal enterotoxin genes among the isolates from the food handlers in Holy Kerbala city. Materials and methods: Nasal swabs were collected from 332 food handlers. Standard microbiological methods were used to isolate Staphylococcus aureus including, culturing on selective media (mannitol salt agar), coagulase test and API-staph. Multiplex PCR (Polymerase Chain Reaction) using specific primers was used for the detection of staphylococcal enterotoxin genes. Result and discussion: 100 food handlers out of 332 (30.1%) were found to carry S. aureus, 38 (38%) isolates were found positive in Multiplex PCR for one or more enterotoxin: 16 (16%) were positive for sea, 18 (18%) were positive for seb, 8 (8%) were positive for sec, 6 (6%) were positive for sed and 8 (8%) were positive for see. Conclusion: The prevalence of nasal carriage of S. aureus is high among food handlers in Holy Kerbala city, as well as the percentage of enterotoxin genes among the S. aureus isolates. Therefore, strict measures are necessary to prevent contamination of food with S. aureus isolates during food handling. © 2017 The Authors. Production and hosting by Elsevier B.V. on behalf of University of Kerbala. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Keywords: Food poisoning; Staphylococcus aureus; Enterotoxin

1. Introduction Staphylococcus aureus is Gram-positive bacterium belonging to the family Staphylococcaceae and is often found as a commensal on the skin, skin glands and * Corresponding author. E-mail address: [email protected] (H.M.M. Alhashimi). Peer review under responsibility of University of Kerbala.

mucous membranes particularly in the nose of healthy individuals [1]. There is a large number of carriers (more than 30e50% of the population), with S. aureus carried persistently or temporarily in human nasal microbiota, without causing any symptoms. The presence of these bacteria in food occurs frequently due to inappropriate manipulation of food by carriers of this microorganism [2].

http://dx.doi.org/10.1016/j.kijoms.2017.02.003 2405-609X/© 2017 The Authors. Production and hosting by Elsevier B.V. on behalf of University of Kerbala. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Please cite this article in press as: H.M.M. Alhashimi et al., Nasal carriage of enterotoxigenic Staphylococcus aureus among food handlers in Kerbala city, Karbala International Journal of Modern Science (2017), http://dx.doi.org/10.1016/j.kijoms.2017.02.003

+ 2

MODEL

H.M.M. Alhashimi et al. / Karbala International Journal of Modern Science xx (2017) 1e6

Staphylococcal Food Poisoning (SFP) is an intoxication caused by consumption of improperly prepared or stored foods containing adequate amounts of one (or more) preformed enterotoxin [3,4]. Staphylococcal intoxication is often associated with the kinds of foods that include poultry and egg products, meat and meat products, milk and dairy products, bakery products, especially cream-filled pastries and cakes, sandwich fillings and salads [5]. S. aureus is able to grow at relatively low water activity (aw ¼ 0.86) so it has been implicated in food poisoning associated with consumption of salted food products [5], though the contamination of food or one of its ingredients during handling. There are several epidemiological features that create the ideal conditions for an outbreak of SFP which include: storage at unsuitable temperatures and the capacity of the microorganism to develop in a wide range of pH, free water concentrations, and sodium chloride concentrations [6]. Previous studies demonstrated that employees working in the food industry are the main source for spreading foodborne diseases [7,8]. Food handlers have been implicated in a plethora of foodborne diseases, and it has been reported that one of the important pathogens often transmitted via food contaminated by infected food handlers is S. aureus [9,10]. Nasal and hand carriage of enterotoxigenic S. aureus by food handlers is an important source of staphylococcal food contamination in restaurants and fast food outlets, therefore it is important to detect asymptomatic S. aureus carriers among food handlers to prevent possible food contamination by them resulting in food poisoning [11,12]. Genes encoding for staphylococcal enterotoxins (SE) have different genetic supports, most of which are mobile genetic elements. Sea gene, composed of 771 base pairs, encodes an enterotoxin A precursor of 257 amino acid residues and is carried by a family of temperate phages. Seb is an open reading frame encoding the enterotoxin B precursor that consisted of 266 amino acids and is chromosomally located in some clinical isolates, whereas it has been found in a 750 kb plasmid in other S. aureus strains. Enterotoxin C is encoded by a gene located on a pathogenicity island containing a 798-base-pair open reading frame that encodes a protein of 266 amino acid residues. Sed is located on a plasmid and see is carried by a defective phage. The main regulatory system controlling the gene expression of virulence factors in S. aureus is the accessory gene regulator that acts in combination with the staphylococcal accessory

regulator. Not all of the SE genes are controlled by the agr system: the seb, sec and sed genes were shown to be agr dependent, whereas sea and sej are agr independent [13]. In Tehran, Iran multiplex PCR was used to detect sea, seb, sec, and seq genes in S. aureus isolated from nasal carriers. In an attempt to determine the incidence of newly identified enterotoxins in SFP outbreaks in Iran; in this study, 150 S. aureus strains were isolated from nasal carriers by using cotton swabs. Of these, 56 strains were positive for classical enterotoxins, sea, seb, sec, and seq. Results showed that 24 (25.3%) isolates were associated with the sea gene, 15 (15.8%) isolates were associated with the seb gene, 9 (9.5%) isolates were associated with the sec gene, 8 (8.4%) isolates were associated with the seq gene and 39 (41%) of these isolates might have possessed other se genes but which were not see and sed (319 genes). Only one of these 95 isolates harbored sec and sea [14]. Many methods have been developed in order to detect the toxins quickly with specificity and sensitivity which include: an immunoassay single diffusion tube test, polymerase chain reaction (PCR), an enzyme-linked immunosorbent assay (ELISA), a reversed passive latex agglutination assay (RPLA), and the Ouchterlony double diffusion method (ODD) [15,16]. Several factors must be considered when choosing a method for enterotoxin detection, such as sensitivity, specificity, reproducibility, cost, labor, rapidity, convenience, and the number of samples [17]. 1.1. Aims To study the prevalence of the staphylococcal enterotoxin genes among the isolates from the food handlers in Holy Kerbala city by using multiplex polymerase chain reaction. 2. Materials and methods 2.1. Specimen collection

Nasal swabs from food handlers were examined for S. aureus isolation; the nasal swabs were collected in collaboration with the Public Health Laboratory belonging to the Health Directorate of Holy Kerbala Province. Nasal swab specimens were obtained by using sterile dry cotton-wool swabs, and both anterior nares (left and right) were swabbed by rubbing the swab four times around the inside of each nostril while

Please cite this article in press as: H.M.M. Alhashimi et al., Nasal carriage of enterotoxigenic Staphylococcus aureus among food handlers in Kerbala city, Karbala International Journal of Modern Science (2017), http://dx.doi.org/10.1016/j.kijoms.2017.02.003

+

MODEL

H.M.M. Alhashimi et al. / Karbala International Journal of Modern Science xx (2017) 1e6

applying an even pressure and rotating the swab without interruption. 2.2. Culturing of swabs for S. aureus isolation

After swabs were collected from people working as food handlers, each swab was cultured on selective media Mannitol salt agar then incubated at 37  C for 24 h. If the color changed from pink to bright yellow when the bacteria was mannitol fermented this shows a positive result, while the unchanging color of the medium was a negative result [18]. Identification depended on colony morphological and cultural characteristics (mannitol fermentation, colony shape, size, color, borders, and texture); it was then examined under the microscope after making a smear from the pure colony on a clean slide and stained with Gram's stain for observing the reaction of bacteria with stain.

3

total volume of 20 mL including 5 mL of PCR premix, 0.5 mL of each primer and 3 mL of template DNA. The remaining volume was completed by addition of sterile de-ionized distilled water, then vortexed and finally 3 mL of template DNA was added. Negative control contained all material except template DNA, so instead of that distilled water was added. PCR reaction tubes were centrifuged briefly to mix and bring the contents to the bottom of the tubes, and placed into a thermo cycler PCR instrument (Cleaver Scientific Ltd., UK) where DNA was amplified; the thermo cycling parameters included an initial denaturation at 94  C for 5 min, 35 cycles of 94  C for 2 min, 57  C for 2 min and 72  C for 1 min, and a final extension at 72  C for 7 min. The PCR product was examined for banding patterns by 1.5% agarose gel electrophoresis in 0.5X Tris-borate-EDTA buffer using 70 V for 1 h. 3. Results

2.3. Genomic DNA preparation

Around 5 colonies from overnight bacterial culture on brain heart infusion agar were transferred into a microfuge tube containing 100 mL distilled water. Each tube was then incubated in boiling water bath for 5e10 min. Tubes were centrifuged for 10 min at 1200 rpm. Supernatant was transferred into new sterile tubes and kept frozen until used in PCR amplification [19]. 2.4. Detection of enterotoxin genes by multiplex PCR

The extracted DNA, the primers in Table 1 and PCR premix (AccuPower, Bioneer), were thawed at 4  C, vortex and centrifuged briefly to bring the contents to the bottom of the tubes. PCR Mixture was set up in a

Out of 332 food handlers.100 (30.1%) were found to carry S. aureus, and 38 (38%) isolates were positive for one or more enterotoxin genes. The frequencies of the enterotoxin genes we observed are shown in Table 2. To ensure that all the target gene sequences were satisfactorily amplified, the reaction conditions for the multiplex PCR assay were optimized. To reduce the possibility of occurrence of unwanted bands originating from nonspecific amplification, the primers used in each set had almost equal annealing temperatures. Fig. 1 shows the presence of the amplified products of three bands (for sea, seb, and see) obtained when DNAs was extracted from different isolates. Fig. 2 shows the presence of the amplified products of three bands (Form sea, seb, sec and sed)

Table 1 The primer sequences. Gene

Primer sequences (50 e30 )

Size of amplified product (bp)

References

sea

Fa Rb Fa Rb Fa Rb Fa Rb Fa Rb

102

[24]

seb sec sed see a b

GGTTATCAATGTGCGGGTGG CGGCACTTTTTTCTCTTCGG GTATGGTGGTGTAACTGAGC CCAAATAGTGACGAGTTAGC AGATGAAGTAGTTGATGTGTATGG CACACTTTTAGAATCAACCG CCAATAATAGGAGAAAATAAAAG ATTGGTATTTTTTTTCGTTC AGGTTTTTTCACAGGTCATCC CTTTTTTTTCTTCGGTCAATC

164 451 278 209

Forward. Reverse.

Please cite this article in press as: H.M.M. Alhashimi et al., Nasal carriage of enterotoxigenic Staphylococcus aureus among food handlers in Kerbala city, Karbala International Journal of Modern Science (2017), http://dx.doi.org/10.1016/j.kijoms.2017.02.003

+ 4

MODEL

H.M.M. Alhashimi et al. / Karbala International Journal of Modern Science xx (2017) 1e6

Table 2 The frequency of enterotoxin genes. Multiple enterotoxin genes

Percentage % Enterotoxin Percentage % genes

(sea, seb, sec, sed, see)

1

(sec, sed), (sed, see) 1 (sea, seb, sec), (seb, sed) 1 (sea, seb, see) 2 (sea, sec, sed), (seb, see) 1 (sea, seb) 2

(sea, seb, sec, sed and see) seb sea see sec sed

38

18 16 8 8 6

obtained when DNAs was extracted from different isolates. 4. Discussion In this study, we found that 30.1% food handlers were positive for S. aureus which in agreement with Vanderbergh et al. in Netherlands (1999) who reported

Fig. 1. PCR amplification for detection of Staphylococcus aureus enterotoxin genes. Lane 1: 50 bp DNA ladder (visualized by 1.5% agarose electrophoresis and ethidium bromide staining for 1 h at 70 V); Lanes 2_8: isolates from food handlers.

Fig. 2. PCR amplification for detection of Staphylococcus aureus enterotoxin genes. Lane 1: 50 bp DNA ladder (visualized by 1.5% agarose electrophoresis and ethidium bromide staining for 1 h at 70 V); lanes 2_9: isolates from food handlers.

that the isolation of S. aureus from nasal cavities, could vary from 20 to 55% in a healthy adult population [20]. This is the first study to detect sea, seb, sec, sed and see genes in S. aureus strains isolated from food handlers in Kerbala city. The predominant enterotoxin genes in this study were seb followed by sea in all isolates. In Kuwait, S. aureus strains isolated from food handlers were shown to produce SEB toxin followed by SEA, SEC and SED [21,22]. The occurrence of multiple genes carried by the same isolate indicated the pathogenic potential of S. aureus. In this study, sea gene was detected in 16 (16%) out of 100 strains isolated. However, in other studies, the percentages of the gene were variable and vary according to the setting and geographic region of the strains. Sea was studied in Switzerland and was detected in 13 (26%) of strains isolated from 50 nasal swabs, in 10 (20%) (out of 50 strains) strains isolated from clinical cases of infection and in 6 (30%) strains isolated from 20 food poisoning cases [23]. Sea was detected in 7 (8.75%) strains isolated from 80 nasal carriers in Poland [24], and in The Netherlands sea was detected in 20.97 (19.6%) strains isolated from 107 nasal swabs of a control (healthy) population [25]. Sea was studied in a tertiary-care hospital (Samsung Medical Center) in Seoul, Korea and was detected in 45.03 (47.4%) strains isolated from 95 nasal swabs of children, and in 14.98 (21.4%) of 70 strain isolated from blood [26]. In the current study, seb gene was detected in 18 (18%) out of 100 strains of S. aureus isolate. In Switzerland seb gene was detected in 8% of strains isolated from 50 nasal swabs, in 22% (out of 50 strains) of strains isolated from clinical cases of infection and in 5% of strains isolated from 20 samples of food poisoning cases [19]. In Poland, seb gene was detected in 5% of strain isolated from 80 nasal carriers [24]. In Korea it was detected in 4 (5.8%) strains isolated from 70 from blood [22]. In The Netherlands, seb gene was detected in 5.6% of strain isolated from 107 nasal swabs of a control (healthy) population [25]. In the current study, sec was detected in 8 (8%) out of 100 strains of S. aureus isolates. Sec gene was reported in Switzerland in 16% of strains isolated from 50 nasal swabs, in 26% (out of 50 strains) strains isolated from clinical cases of infection and in 20% of strains isolated from food poisoning cases [19]. In Poland, Sec gene was detected in 17.5% of strains isolated from 80 nasal carriers [24]. Sec gene was studied in a tertiary-care hospital (Samsung Medical Center) in Seoul, Korea and was detected in 2.1% of strains isolated from 95 nasal swabs of children, and in

Please cite this article in press as: H.M.M. Alhashimi et al., Nasal carriage of enterotoxigenic Staphylococcus aureus among food handlers in Kerbala city, Karbala International Journal of Modern Science (2017), http://dx.doi.org/10.1016/j.kijoms.2017.02.003

+

MODEL

H.M.M. Alhashimi et al. / Karbala International Journal of Modern Science xx (2017) 1e6

34.3% of 70 strains isolated from blood [22]. In The Netherlands, sec gene was detected in 7.5% of strains isolated from 107 nasal swabs of a control (healthy) population [25]. The sed gene was detected in 6 (6%) out of 100 strains of S. aureus isolates. In Switzerland sed gene was detected in 2% of strains isolated from 50 nasal swabs, in 6% (out of 50 strains) strains isolated from clinical cases of infection and 15% of strains isolated from food poisoning cases [19]. In Poland sed gene was detected in 5% of strain isolated from 80 nasal carriers [24]. In Korea sed gene was detected in (2.9%) strains isolated from 70 from blood [22]. In The Netherlands, sed gene was detected in 1.9% of strain isolated from 107 nasal swabs of a control (healthy) population [25]. The see gene was detected in 8 (8%) out of 100 strains of S. aureus isolates. This result is important because the previous studies showed the presence of this gene only in strains from food. In Switzerland, see gene was found to be absent in the strains isolated from nasal swabs (n ¼ 50), clinical cases of infection (n ¼ 50) and from food poisoning cases [19]. See gene was studied in a tertiary-care hospital (Samsung Medical Center) in Seoul, Korea and it was absent in the strains isolated from nasal swabs of children (n ¼ 95), and strain isolated from blood (n ¼ 70) [22]. In The Netherlands, see gene was not detected in any strains isolated from 107 nasal swabs of a control (healthy) population [25]. On the other hand, in Brazil, see was detected in 5.1% of strain isolated from 54 raw milk samples [27]. The variation in reported rates results, at least partly, from differences in study populations, sampling and culture techniques, and criteria for the definition of persistent or intermittent carriers [19]. This study offered novel PCR primers specific for the detection of sea, seb, sec, sed, and see genes of S. aureus. These primers could be used for an epidemiological study of the hazardous S. aureus in foodpoisoning outbreaks. The identification of staphylococcal toxin genes in strains of S. aureus by PCR offers a very specific, sensitive, relatively rapid, and inexpensive alternative to traditional immunological assays which depend on adequate gene expression for reliability and sensitivity. 5. Conclusion 1. The prevalence of nasal carriage of S. aureus is high among food handlers in Holy Kerbala city,

5

and prevalence of enterotoxin genes among this group of isolates is also high. Therefore, strict measures are necessary to prevent the contamination of food with S. aureus isolates during food handling. 2. Multiplex PCR is a feasible and cost-effective assay to detect enterotoxigenic strains and thus, it is recommended to be used for routine and surveillance purposes.

Acknowledgment I express my deepest gratitude to my supervisor, Assistant professor Dr. Jassim Mohamed Mustafa and Professor Dr. Mohanad Mohsen Ahmed, for their great support and expert guidance at various stages of my study. References [1] K. Plata, A.E. Rosato, Wegrzyn, Staphylococcus aureus as an Infectious Agent: overview of Biochemistry and Molecular Genetics of its Pathogenicity, 2009. [2] M. Hatakka, K. Bj€orkroth, K. Asplund, N. M€aki-Pet€ays, H. Korkeala, Genotypes and enterotoxicity of Staphylococcus aureus isolated from the hands and nasal cavities of flight-catering employees, J. Food Prot.® 63 (2000) 1487e1491. [3] J. Schelin, N. Wallin-Carlquist, M.T. Cohn, R. Lindqvist, G.C. Barker, P. Radstrom, The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment, Virulence 2 (2011) 580e592. [4] F. Tasci, F. Sahindokuyucu, D. Ozturk, Detection of Staphylococcus species and staphylococcal enterotoxins by ELISA in ice cream and cheese consumed in Burdur province, Afr. J. Agric. Res. 6 (2011) 937e942. [5] S. Niveditha, R. Shylaja, H.S. Murali, H.V. Batra, A novel MPCR for the detection of prominent toxins in MRSA strains of S. aureus recovered from diverse sources, Int. J. Res. Biol. Sci. 2 (2012) 26e32. [6] E. Di Giannatale, V. Prencipe, A. Tonelli, C. Marfoglia, G. Migliorati, Characterisation of Staphylococcus aureus strains isolated from food for human consumption, Vet. Ital. 47 (2011) 165e173. [7] R. Girish, S. Broor, L. Dar, D. Ghosh, Foodborne outbreak caused by a Norwalk-like virus in India, J. Med. Virol. 67 (2002) 603e607. [8] U. Parashar, L. Dow, R. Fankhauser, C. Humphrey, J. Miller, T. Ando, K. Williams, C. Eddy, J. Noel, T. Ingram, An outbreak of viral gastroenteritis associated with consumption of sandwiches: implications for the control of transmission by food handlers, Epidemiol. Infect. 121 (1998) 615e621. [9] N. Verkaik, M. Benard, H. Boelens, C. De Vogel, J. Nouwen, H. Verbrugh, D. Melles, A. Van Belkum, W. Van Wamel, Immune evasion cluster-positive bacteriophages are highly prevalent among human Staphylococcus aureus strains, but they are

Please cite this article in press as: H.M.M. Alhashimi et al., Nasal carriage of enterotoxigenic Staphylococcus aureus among food handlers in Kerbala city, Karbala International Journal of Modern Science (2017), http://dx.doi.org/10.1016/j.kijoms.2017.02.003

+ 6

[10]

[11]

[12]

[13] [14]

[15]

[16]

[17]

[18] [19]

MODEL

H.M.M. Alhashimi et al. / Karbala International Journal of Modern Science xx (2017) 1e6 not essential in the first stages of nasal colonization, Clin. Microbiol. Infect. 17 (2011) 343e348. H.F. Wertheim, D.C. Melles, M.C. Vos, W. Van Leeuwen, A. Van Belkum, H.A. Verbrugh, J.L. Nouwen, The role of nasal carriage in Staphylococcus aureus infections, Lancet Infect. Dis. 5 (2005) 751e762. V. Colombari, M.D. Mayer, Z.M. Laicini, E. Mamizuka, B.D. Franco, M.T. Destro, M. Landgraf, Foodborne outbreak caused by Staphylococcus aureus: phenotypic and genotypic characterization of strains of food and human sources, J. Food Prot.® 70 (2007) 489e493. E.E. Udo, S. Al-Mufti, M.J. Albert, The prevalence of antimicrobial resistance and carriage of virulence genes in Staphylococcus aureus isolated from food handlers in Kuwait city restaurants, BMC Res. Notes 2 (2009) 108. Y. Le Loir, F. Baron, M. Gautier, Staphylococcus aureus and food poisoning, Genet. Mol. Res. 2 (1) (2003) 63e76. M. Saadati, B. Barati, M. Doroudian, H. Shirzad, M. Hashemi, S.M. Hosseini, A.R.S. Chaleshtari, M.-K. Bahmani, S. Hosseinzadeh, S. Imani, Detection of sea, seb, sec, seq genes in Staphylococcus aureus isolated from nasal carriers in Tehran province, Iran; by multiplex PCR, J. Paramed. Sci. 2 (2011). A. Di Pinto, V. Forte, G. Ciccarese, M. Conversano, G. Tantillo, Comparison of reverse passive latex agglutination test and immunoblotting for detection of staphylococcal enterotoxin A and B, J. Food Saf. 24 (2004) 231e238. N.K. Sharma, C.E. Rees, C.E. Dodd, Development of a singlereaction multiplex Pcr toxin typing assay for Staphylococcus aureus strains, Appl. Environ. Microbiol. 66 (2000) 1347e1353. C.R. Harrison, Comparison of Three Techniques for Detecting Enterotoxin A (Sea) in Clinically Relevant Staphylococcus aureus Strains, Angelo State University, 2015. J. MacFaddin, Individual biochemical tests, Biochem. Tests Identif. Med. Bact. (2000) 1e456. K. Zhang, J. Sparling, B.L. Chow, S. Elsayed, Z. Hussain, D.L. Church, D.B. Gregson, T. Louie, J.M. Conly, New

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

quadriplex Pcr assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative Staphylococci, J. Clin. Microbiol. 42 (2004) 4947e4955. M.F. Vandenbergh, E.P. Yzerman, A. Van Belkum, H.A. Boelens, M. Sijmons, H.A. Verbrugh, Follow-up of Staphylococcus aureus nasal carriage after 8 years: redefining the persistent carrier state, J. Clin. Microbiol. 37 (10) (1999) 3133e3140. M. Al Bustan, E. Udo, T. Chugh, Nasal carriage of enterotoxinproducing Staphylococcus aureus among restaurant workers in Kuwait city, Epidemiol. Infect. 116 (1996) 319e322. A. Soto, M. Saldias, P. Oviedo, M. Fernandez, Prevalence of Staphylococcus aureus among food handlers from a metropolitan university in Chile, Rev. medica Chile 124 (1996) 1142e1146. L. Wattinger, R. Stephan, F. Layer, S. Johler, Comparison of Staphylococcus aureus isolates associated with food intoxication with isolates from human nasal carriers and human infections, Eur. J. Clin. Microbiol. Infect. Dis. 31 (2012) 455e464. J. Bania, A. Dabrowska, K. Korzekwa, A. Zarczynska, J. Bystron, J. Chrzanowska, J. Molenda, The profiles of enterotoxin genes in Staphylococcus aureus from nasal carriers, Lett. Appl. Microbiol. 42 (2006) 315e320. M. Mehrotra, G. Wang, W.M. Johnson, Multiplex Pcr for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance, J. Clin. Microbiol. 38 (2000b) 1032e1035. K.R. Peck, J.Y. Baek, J.-H. Song, K.S. Ko, Comparison of genotypes and enterotoxin genes between Staphylococcus aureus isolates from blood and nasal colonizers in a Korean hospital, J. Korean Med. Sci. 24 (2009) 585e591. V. Rall, F. Vieira, R. Rall, R. Vieitis, A. Fernandes, J. Candeias, K. Cardoso, J. Arau´jo, Pcr detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk, Vet. Microbiol. 132 (2008) 408e413.

Please cite this article in press as: H.M.M. Alhashimi et al., Nasal carriage of enterotoxigenic Staphylococcus aureus among food handlers in Kerbala city, Karbala International Journal of Modern Science (2017), http://dx.doi.org/10.1016/j.kijoms.2017.02.003