Naturally Occurring Hepatitis B Virus Genomes Bearing the Hallmarks of Retroviral G → A Hypermutation

VIROLOGY

235, 104–108 (1997) VY978676

ARTICLE NO.

Naturally Occurring Hepatitis B Virus Genomes Bearing the Hallmarks of Retroviral G r A Hypermutation Stephan Gu¨nther,* Gunhild Sommer,* Uwe Plikat,† Alicja Iwanska,* Simon Wain-Hobson,‡ Hans Will,* and Andreas Meyerhans†,1 *Heinrich-Pette-Institut fu¨r Experimentelle Virologie und Immunologie, D-20251 Hamburg, Germany; †Abteilung Virologie, Institut fu¨r Medizinische Mikrobiologie und Hygiene, Universita¨t Freiburg, D-79104 Freiburg, Germany; and ‡Unite´ de Re´trovirologie Mole´culaire, Institut Pasteur, F-75724 Paris Cedex 15, France Received March 27, 1997; returned to author for revision May 7, 1997; accepted June 9, 1997 Two hypermutated genomes of hepatitis B virus (HBV) were cloned from sera of chronic virus carriers. Twelve percent and 26% of guanosine residues were replaced by adenosine, with the transitions being erratically distributed along the genome. G r A substitutions showed a strong dinucleotide preference, decreasing in the order GpA ú GpG @ GpC § GpT. Such traits are typical of retroviral G r A hypermutation which results from cDNA synthesis coinciding with fluctuations in the intracellular [dTTP]/[dCTP] ratio. The observations offer an explanation for the high prevalence of HBV variants bearing a tryptophan 28 r stop codon in the pre-core region of carriers with chronic active or fulminant hepatitis. The HBV hypermutants indicate that a small proportion of hepatocytes have distorted dNTP pools, which might have implications for the fidelity of hepatocyte DNA replication or repair. q 1997 Academic Press

INTRODUCTION

rG:dT mismatches, which are not only the most stable of mismatches but also the most readily accommodated by reverse transcriptases (Sala et al., 1995; Mendelman et al., 1990). Such large numbers of transitions may indeed be produced in a single cycle of replication in vivo and reproduced in vitro (Martinez et al., 1994; Pathak and Temin, 1990; Vartanian et al., 1997). The extent of G r A hypermutation is most pronounced for the lentiviral subset of retroviruses which includes the human and simian immunodeficiency viruses. Of the few examples described for the oncoretroviruses, the mutation rates are an order of magnitude lower, suggesting that the lentiviral reverse transcriptase influences the mutation rate, perhaps by efficient elongation beyond repetitive rG:dT mismatches (Martinez et al., 1995; Sala et al., 1995; Mendelman et al., 1990). The hepadnaviruses and badnaviruses are distinct mammalian and plant viruses, respectively, sharing a unique trait with the classical retroviruses (Covey, 1991; Nassal and Schaller, 1993). Although virion-associated nucleic acid is DNA, a more than full-length RNA transcript (RNA pregenome) is reverse transcribed into a partially double-stranded DNA genome. Because reverse transcription in hepadnavirus and badnavirus, like that in their retroviral counterpart, is presumed not to be subject to 3* exonucleolytic editing or proofreading, it is possible that their replication fidelity might also be sensitive to fluctuations in intracellular hepatocyte dNTP concentrations. Although there is a considerable sequence da-

RNA virus and retroviral mutation rates are the highest for any replicon, being on the order of 1004 to 1005 per base per cycle (Drake, 1993; Preston and Dougherty, 1996; Williams and Loeb, 1992). Although certainly incompatible with survival, higher rates do exist, with retroviral G r A hypermutation being a case in point (Pathak and Temin, 1990; Vartanian et al., 1991). In some cases, many hundreds of Gs may be replaced by As throughout the entire 10-kb retroviral genome, while for others it may be erratic or confined to a small isolated segment (Borman et al., 1995; Gao et al., 1992; Johnson et al., 1991; Vartanian et al., 1991; Pathak and Temin, 1990; Perry et al., 1992; Vartanian et al., 1994; Wain-Hobson et al., 1995). Locally the mutation rate can attain values as high as 0.6 per G per cycle, although the usual range is more on the order of 0.1–0.3 per G. Transitions are strongly coupled to the local dinucleotide context, decreasing in the order GpA ú GpG ú GpT Ç GpC. G r A hypermutation arises when reverse transcription of single-stranded genomic RNA into the complementary DNA strand occurs at the same time as fluctuations in the intracellular [dTTP]/[dCTP] ratio (Vartanian et al., 1994, 1997). Such biases are conducive to the formation of 1 To whom correspondence and reprint requests should be addressed at Abteilung Virologie, Institut fu¨ r Medizinische Mikrobiologie und Hygiene, Universita¨ t Freiburg, Herman-Herder-Strasse 11, D-79104 Freiburg, Germany. Fax: 49 761 203 6639. E-mail: andreas@ sun1.ukl.uni-freiburg.de.

0042-6822/97 $25.00

104

Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.

AID

VY 8676

/

6a3e$$$541

07-22-97 09:49:12

viras

AP: VY

HBV HYPERMUTATION

105

tabase for human hepatitis B virus (HBV), the prototype hepadnavirus, hypermutants have not been hitherto reported. MATERIALS AND METHODS HBV genomes were amplified by polymerase chain reaction (PCR) from sera of eight chronic HBV carriers. Briefly, 300 ml serum was incubated at 657 for 4 hr in 20 mM Tris–HCl (pH 8.0), 10 mM EDTA, 0.1% SDS, and 0.8 mg/ml proteinase K. The DNA was extracted with phenol/ chloroform and precipitated with ethanol using 20 mg tRNA as carrier. HBV DNA was amplified by PCR with primers 5*-CCGGAAAGCTTGAGCTCTTCTTTTTCACCTCTGCCTAATCA and 5*-CCGGAAAGCTTGAGCTCTTCAAAAAGTTGCATGGTGCTGG, which hybridize to the nick region of HBV, allowing amplification of the complete genomic (0) DNA strand (Gu¨nther et al., 1995). The SstI cloning sites are underlined. Reaction buffer was 50 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 200 mM dNTPs, 0.01% gelatin, and 5U Taq DNA polymerase (Boehringer-Mannheim, Mannheim, Germany). The reaction was hot started, with the cycling parameters being 40 sec at 947, 1 min at 607, and 4 min at 727 for 25 cycles. PCR products were digested with SstI and purified on agarose gels. The DNA fragments were extracted with phenol/chloroform and cloned into the pUC19 vector. Sequence reactions were performed with the SequiTherm Long-Read kit (Epicentre Technologies, Madison, WI), fluorescent dye-labeled M13 forward and reverse primers, and HBV-specific primers 5* TTACACAAGAAAGGCCTTGTAAGTTGGCG, 5* GGTGAAAAAGTTGCATGGTGCTGGTG, 5* TTTACTAGTGCCATTTGGTTCAGTGG, and 5* GAGGCAGGTCCCCTAGAAGAAGAACTCC. Products were resolved on an automated sequencer (LI-COR, Lincoln, NE). The PCR error rate was approximately 1 per kilobase sequenced. The GenBank accession numbers are U73608 and U73609.

FIG. 1. Segments of G r A hypermutated HBV subgenomes. Mutations are given with respect to the reference sequence above. Dots represent nucleotide identity. Nucleotide positions correspond to those of an HBV ayw sequence (Galibert et al., 1979).

Of a total of 92 partly or completely sequenced HBV genomes from eight HBV carriers, 2 were found to be G r A hypermutated; some representative segments are given in Fig. 1. Clone 7720 was one of 9 clones derived from a chronic HBV carrier who was under immunosuppressive therapy following a kidney transplantation, while clone 7468 was among 24 from a patient with chronic active hepatitis. Both clones represented subgenomes arising from reverse transcription of packaged spliced mRNA for which there are precedents (Terre et al., 1991). The hypermutated genomes were not generated during PCR. Otherwise, given that PCR involves complementary

strand synthesis, both G r A and C r T transitions would have been anticipated. The overall G r A transition frequencies (fGrA) were 0.12 (55/1978 bp) for 7720 and 0.26 (96/1622 bp) for 7648 when compared to non-hypermutated sequences from the same patient (Fig. 2). The two sequences revealed multiple stop codons in most reading frames, and in the case of 7720 a deletion of a single G in a run of six Gs (Figs. 2B and 2C). The distribution of transitions was highly erratic along the genome (Figs. 2D and 2E). In the case of 7648 the YMDD amino acid motif, typical of the catalytic site of most retroviral reverse transcriptases, was mutated to YINN. Analysis of the context surrounding G r A transitions revealed a strong dinucleotide preference, namely GpA ú GpG ú GpC Ç GpT (Fig. 3A). No significant dinucleotide context was apparent for the 5* nucleotide, i.e., NpG (Fig. 3B). Given the sense of reverse transcription of RNA, this 5* nucleotide is downstream to the site of rG:dT misincorporation. There are two forms of the core (C) protein, resulting from two sites of translation initiation. The pre-C product encodes an additional 29 residues and is involved in the synthesis and secretion of HBeAg. The second ATG (codon 30) is used when there is a G r A transition (Trp r stop) at codon 28. Such a Trp28stop mutant is frequently found after seroconversion to anti-HBe (Gu¨nther et al., 1992; Hadzyannis, 1995; Okamoto et al., 1990). Interestingly the transition occurs in a run of Gs, TGG GGC, with the most frequently substituted site being underlined. In light of the link between HBV replication fidelity and fluctuations in the intracellular [dTTP]/[dCTP] ratio, this finding may be rationalized as follows: reverse

AID

viras

RESULTS AND DISCUSSION G r A hypermutation in natural HBV infection

VY 8676

/

6a3e$$$541

07-22-97 09:49:12

AP: VY

¨ NTHER ET AL. GU

106

FIG. 2. Genomic organization of two G r A hypermutated deletion mutants of HBV and distribution of the G r A transitions. (A) Hypermutated clones 7648 and 7720 are shown in comparison to a full-length HBV genome. The four open reading frames are denoted C, P, S, and X. For simplicity the pre-C, pre-S1, and pre-S2 are omitted. (B and C) The deletions of 1583 and 1223 nucleotides in clones 7648 and 7720, respectively, derive from splicing of the RNA pregenome and are marked with lines. Clone 7648 bore G r A transitions across the splice junction, indicating that the mutations occurred at the level of reverse transcription of a spliced RNA pregenome (C). Vertical bars within the four open reading frames denote stop codons. (D and E) Distribution of G r A substitutions along the hypermutated HBV genomes. Individual intrapatient consensus sequences were used as reference sequences. The %G r A/G was scored by sliding a 100-bp window at 50-bp intervals. Average substitution frequencies were 26% and 12% for clones 7648 and 7720 as noted. In addition to the 98 G r A transitions for clone 7648 there were 5 other mutations with respect to the reference sequence (3 A r G, 1 A r T, and 1 T r C). For 7720 the numbers are: 55 G r A, 1 G r T, 2 A r G, 2 A r T, 2 T r C, 1 C r T, and 1 C r A. It has previously been shown in vitro that a small number (usually £5%) of other substitutions may accompany G r A hypermutation (Martinez et al., 1994). The EcoRI restriction site used as reference origin is indicated by an arrowhead.

AID

VY 8676

/

6a3e$$8676

07-22-97 09:49:12

viras

AP: VY

HBV HYPERMUTATION

107

from the Wilhelm-Sander Stiftung. U.P. and A.M. were supported by the Deutsche Forschungsgemeinschaft. The Heinrich-Pette Institut fu¨r Experimentelle Virologie und Immunologie is supported by the Bundesministerium fu¨r Gesundheit and the Hansestadt Hamburg.

REFERENCES

We thank Otto Haller for continuous interest in the work. S.G., G.S., A.I., and H.W. were supported by grants from the Bundesministerium fu¨r Bildung, Wissenschaft, Forschung und Technologie (01KI95603) and

Borman, A. M., Quillent, C., Charneau, P., Kean, K. M., and Clavel, F. (1995). A highly defective HIV-1 group O provirus: Evidence for the role of local sequence determinants in G r A hypermutation during negative-strand viral DNA synthesis. Virology 208, 601–609. Covey, S. N. (1991). Pathogenesis of a plant pararetrovirus: CaMV. Semin. Virol. 2, 151–159. Drake, J. W. (1993). Rates of spontaneous mutation among RNA viruses. Proc. Natl. Acad. Sci. USA 90, 4171–4175. Galibert, F., Mandart, E., Fitoussi, F., Tiollais, P., and Charnay, P. (1979). Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 281, 646–650. Gao, F., Yue, L., White, A. T., Pappas, P. G., Barchue, J., Hanson, A. P., Greene, B. M., Sharp, P. M., Shaw, G. M., and Hahn, B. H. (1992). Human infection by genetically diverse SIVsm-related HIV-2 in West Africa. Nature 358, 495–499. Gojobori, T., Li, W-H., and Graur, D. (1982). Patterns of nucleotide substitution in pseudogenes and functional genes. J. Mol. Evol. 18, 360– 369. Gu¨nther, S., Meisel, H., Reip, A., Miska, S., Kru¨ger, D. H., and Will, H. (1992). Frequent and rapid emergence of mutated pre-C sequences in HBV from e-antigen positive carriers who seroconvert to anti-HBe during interferon treatment. Virology 187, 271–279. Gu¨nther, S., Li, B. C., Miska, S., Kruger, D. H., Meisel, H., and Will, H. (1995). A novel method for efficient amplification of whole hepatitis B virus genomes permits rapid functional analysis and reveals deletion mutants in immunosuppressed patients. J. Virol. 69, 5437–5444. Hadzyannis, S. J. (1995). Hepatitis B e antigen negative chronic hepatitis B: From clinical recognition to pathogenesis and treatment. Viral Hepatitis 1, 7–36. Johnson, P. R., Hamm, T. E., Goldstein, S., Kitov, S., and Hirsch, V. M. (1991). The genetic fate of molecularly cloned simian immunodeficiency virus in experimentally infected macaques. Virology 185, 217– 228. Krawczak, M., Reiss, J., and Cooper, D. N. (1992). The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: Causes and consequences. Hum. Mutat. 90, 41–54. Krawczak, M., Smith-Sorensen, B., Schmidtke, J., Kakkar, V. V., Cooper, D. N., and Hovig, E. (1995). Somatic spectrum of cancer-associated single basepair substitutions in the TP53 gene is determined mainly by endogenous mechanisms of mutation and by selection. Hum. Mutat. 5, 48–57. Li, W-H., Wu, C-I., and Luo, C-C. (1984). Nonrandomness of point mutation as reflected in nucleotide substitutions in pseudogenes and its evolutionary implications. J. Mol. Evol. 21, 58–71. Martinez, M. A., Vartanian, J. P., and Wain-Hobson, S. (1994). Hypermutagenesis of RNA using human immunodeficiency virus type 1 reverse transcriptase and biased dNTP concentrations. Proc. Natl. Acad. Sci. USA 91, 11787–11791. Martinez, M. A., Sala, M., Vartanian, J. P., and Wain-Hobson, S. (1995). Reverse transcriptase and substrate dependence of the RNA hypermutagenesis reaction. Nucleic Acids Res. 23, 2573–2578. Mendelman, L. V., Petruska, J., and Goodman, M. F. (1990). Base mispair extension kinetics. Comparison of DNA polymerase alpha and reverse transcriptase. J. Biol. Chem. 265, 2338–2346. Nassal, M., and Schaller, H. (1993). Hepatitis B virus replication. Trends Microbiol. 1, 221–228. Okamoto, H., Yotsumoto, S., Akahane, Y., Yamanaka, T., Miyazaki, Y., Sugai, Y. T., Tanaka, T., Miyakawa, Y., and Mayumi, M. (1990). Hepatitis B viruses with precore region defects prevail in persistently in-

AID

viras

FIG. 3. Preferred dinucleotide context in G r A hypermutated HBV genomes. The percentages of G r A transitions occurring within GpN (A) or NpG (B) dinucleotides are shown for 7720 and 7648 data combined. Black and gray bars represent the observed and expected frequencies, respectively. The latter were calculated assuming that G r A transitions were independent of dinucleotide composition. A significant preference (ú3 standard deviations) for G r A mutations was found only for GpA.

transcription of the three preceding Gs would consume dCTPs, leading to a local depletion. As G:T mismatches are the most stable of base mismatches, dTTP will be misincorporated with the greatest probability, leading to a G r A transition. The characteristics of these hypermutated HBV subgenomes, namely the high frequency of G r A transitions, erratic distribution, and strong dinucleotide preference, are precisely the hallmarks of retroviral G r A hypermutants, particularly those of the lentiviruses (Borman et al., 1995; Vartanian et al. 1991, 1994; Wain-Hobson et al., 1995). Their occurrence suggests that strong intracellular dNTP biases exist in a small proportion of hepatocytes, just as they do for leukocytes. An impact of such biases on the fidelity of DNA replication and repair, as well as the long-term evolution of the host cell genome, is suspected, given the excess of G r A and C r T transitions among pseudogenes and cellular genes such as TP53 or those reported as the cause of inherited disease (Gojobori et al., 1982; Krawczak et al., 1992, 1995; Li et al., 1984). ACKNOWLEDGMENTS

VY 8676

/

6a3e$$$541

07-22-97 09:49:12

AP: VY

¨ NTHER ET AL. GU

108

fected hosts along with seroconversion to the antibody against e antigen. J. Virol. 64, 1298–1303. Pathak, V. K., and Temin, H. M.(1990). Broad spectrum of in vivo forward mutations, hypermutations, and mutational hotspots in a retroviral shuttle vector after a single replication cycle: Substitutions, frameshifts, and hypermutations. Proc. Natl. Acad. Sci. USA 87, 6019– 6023. Perry, S. T., Flaherty, M. T., Kelley, M. J., Clabough, D. L., Tronick, S. R., Coggins, L., Whetter, L., Lengel, C. R., and Fuller, F. (1992). The surface envelope protein gene region of equine infectious anemia virus is not an important determinant of tropism in vitro. J. Virol. 66, 4085– 4097. Preston, B. D., and Dougherty, J. P. (1996). Mechanisms of retroviral mutation. Trends Microbiol. 4, 16–21. Sala, M., Wain-Hobson, S., and Schaeffer, F. (1995). Human immunodeficiency virus type 1 reverse transcriptase tG:T mispair formation on RNA and DNA templates with mismatched primers: A kinetic and thermodynamic study. EMBO J. 14, 4622–4627. Terre, S., Petit, M. A., and Brechot, C. (1991). Defective hepatitis B virus

particles are generated by packaging and reverse transcription of spliced viral RNAs in vivo. J. Virol. 65, 5539–5543. Vartanian, J. P., Meyerhans, A., Asjo¨, B., and Wain-Hobson, S. (1991). Selection, recombination, and G-A hypermutation of human immunodeficiency virus type 1 genomes. J. Virol. 65, 1779–1788. Vartanian, J-P., Meyerhans, A., Sala, M., and Wain-Hobson, S. (1994). G-A hypermutation of the HIV-1 genome: Evidence for dCTP pool imbalance during reverse transcription. Proc. Natl. Acad. Sci. USA 91, 3092–3096. Vartanian, J-P., Plikat, U., Henry, M., Mahieux, R., Guillemot, L., Meyerhans, A., and Wain-Hobson, S. (1997). HIV genetic variation is directed and restricted by DNA precursor availability. J. Mol Biol. 270, 139–151. Wain-Hobson, S., Sonigo, P., Guyader, M., Gazit, A., and Henry, M. (1995). Erratic G-A hypermutation within a complete caprine arthritisencephalitis virus (CAEV) provirus. Virology 209, 297–303. Williams, K. J., and Loeb, L. A. (1992). Retroviral reverse transcriptases: Error frequencies and mutagenesis. Curr. Top. Microbiol. Immunol. 176, 165–180.

AID

viras

VY 8676

/

6a3e$$$541

07-22-97 09:49:12

AP: VY