- Email: [email protected]
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora infestans
Journal of Integrative Agriculture 2014, 13(8): 1662-1671
August 2014
RESEARCH ARTICLE
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora infestans ZHANG Kun, XU Jian-fei, DUAN Shao-guang, PANG Wan-fu, BIAN Chun-song, LIU Jie and JIN Li-ping Institute of Vegetables and Flowers, Chinese Academy of Agriculture Sciences/Key Laboratory of Biology and Genetic Improvement of Tuber and Root Crop, Ministry of Agriculture, Beijing 100081, P.R.China
Abstract Potato late blight, caused by the oomycete pathogen Phytophthora infestans, is the most serious disease of potato worldwide. The adoption of varieties with resistance genes, especially broad-spectrum resistance genes, is the most efficient approach to control late blight. Solanum demissum is a well-known wild potato species from which 11 race-specific resistance genes have been identified, however, no broad-spectrum resistance genes like RB have been reported in this species. Here, we report a novel reisistance locus from S. demissum that potentially confer broad-spectrum resistance to late blight. A small segregating population of S. demissum were assessed for resistance to aggressive P. infestans isolates (race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11). This coupled with nucleotide binding site (NBS) profiling analyses, led to the identification of three fragments that linked to the potential candidate resistance gene(s). Cloning and sequence analysis of these fragments suggested that the identified resistance gene locus is located in the region containing R2 resistance gene at chromosome 4. Based on the sequences of the cloned fragments, a co-segregating sequence characterized amplified region (SCAR) marker, RDSP, was developed. The newly identified marker RDSP will be useful for marker assisted breeding and further cloning of this potential resistance gene locus. Key words: potato, late blight, resistance gene, NBS profiling , broad-spectrum resistance
INTRODUCTION Potato (Solanum tuberosum L.) is the fourth most largest food crop in the world (Bhaskar et al. 2009). Potato is susceptible to various pests and diseases, among which late blight is the most devastating disease in potato crops worldwide (Kamoun 2001). Late blight is caused by Phytophthora infestans, an oomycete pathogen that has many different races (EI-Kharbotly et al. 1996). Since the Irish potato famine in the 1840s, breeders have begun
to search for resistant germplasm. Solanum demissum (2n=6x=72) was the first wild species identified to possess inherited resistance to the disease (Gebhardt et al. 2004), and thus has been used for breeding late blight resistance in cultivated potato by crossing or backcrossing (Jo et al. 2011). The resistance genes R1 to R11 were mostly characterized as single dominant loci in S. demissum, and were mapped on different chromosomes (Leonards-Schippers et al. 1992; EI-Kharbotly et al. 1996; Li et al. 1998; Huang et al. 2004; Bradshaw et al. 2006). In the past decade, R1, R2, R3a, and R3b have been cloned using different strategies such as
Received 15 April, 2013 Accepted 17 June, 2013 Correspondence XU Jian-fei, Tel: +86-10-82109543, E-mail: [email protected]; JIN Li-ping, Tel: +86-10-82105943, E-mail: [email protected]
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd. doi: 10.1016/S2095-3119(14)60759-0
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora
positional cloning and allele mining (Ballvora et al. 2002; Huang et al. 2005; Li et al. 2011; Lokossou et al. 2009). However, due to the super resistance spectrum of these 11 R genes and high evolutionary potential of P. infestans, R genes introgressed into potato cultivars from S. demissum have been overcome by new strains of the pathogen (McDonald and Linde 2002). Therefore, broad-spectrum resistance genes offer a new hope for breeding durable late blight-resistant potato varieties. Recently, RB (Rpi-blb1) and Rpi-blb2 conferring broad-spectrum resistance to a wide range of known P. infestans races have been cloned from S. bulbocastanum (Song et al. 2003; van der Vossen et al. 2003, 2005). Somatic hybrids with RB (Rpi-blb1) have been developed and used in potato breeding programs. Several potato lines derived from these hybrids exhibit a remarkably high level of resistance to late blight (Colton et al. 2006). Rpi-blb2 has also been introgressed into potato cultivars (Haverkort et al. 2009). With the identification of many plant R genes, the conserved domains of the corresponding resistance proteins have been uncovered and used to develop new strategies for isolation of new R genes. Most of the cloned R genes can be categorized into five classes: nucleotide-binding site-leucine-rich repeat (NBS-LRR), LRR, LRR-kinase, serine-threonine kinase, coiled-coil (CC) motif (Martin et al. 2003). To date, all the cloned late blight-resistant genes, including R1, R3a, R3b, RB, and Rpi-blb2, are members of the NBS-LRR gene family, the largest of the five classes of R genes. Based on amplification from the conserved sequence of NBS motifs towards restriction enzyme sites, an approach termed NBS profiling to target molecular markers tightly linked to R genes and resistance gene analogs (RGAs) is developed (van der Linden et al. 2004). NBS profiling with little or no modifications across species can be applied on R gene mining, germplasm characterization and biodiversity studies. In potato, several new late blight resistance genes have been identified and mapped by NBS profiling (Brugmans et al. 2008; Jacobs et al. 2010; Jo et al. 2011). Despite progress, identification of new R genes, especially novel R genes conferring broad spectrum resistance to P. infestans complex races, is still needed for breeding potato varieties possessing a durable and high level of resistance to late blight. Wild potato species are valuable sources to explore resistance to late blight. Here, we evaluated a small
1663
segregating population from S. demissum for resistance to P. infestans pathotype that virulent to all 11 differential R genes (race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11). Several RGAs were identified in bulked DNA samples prepared from resistant and susceptible progenies using nucleotide binding site (NBS) profiling. The cloned RGAs were mapped to the chromosome 4 by sequence and genome analysis with the complete potato genome sequence (http://www.potatogenome.net). A novel resistance locus that may be associated with broad-spectrum resistance to P. infestans, was identified in S. demissum.
RESULTS Evaluation of S. demissum population for resistance to P. infestans The S. demissum population 03129 containing 21 progenies were evaluated for resistance against twelve P. infestans isolates. Cultivars Désirée and RB-3 were included as susceptible and resistant controls, with the latter showing broad-spectrum resistance to P. infestans. Similar to the resistant RB-3 and the susceptible Desiree, the resistant S. demissum plants developed localized necrosis while the susceptible plants developed systemic symptoms (massive sporulation) (Fig. 1). Among the 21 genotypes analyzed, 18 were deemed as resistant whereas three as susceptible to P. infestans.
NBS profiling and sequences analysis NBS profiling experiments were carried out using combinations of the NBS primers (NBS1, NBS2, NBS3, NBS5a6 and NBS9) and restriction enzymes (Alu I, Hae III, Mse I and Rsa I) on both resistant (BR) and susceptible (BS) bulks. Fragments NBS2-AluI-210 and NBS2Hae III-185/194 were identified to be present in BR but absent in BS (Fig. 2). Further analysis on the individual progenies showed that they were consistenly only present in resistant ones (Fig. 2), suggesting their co-segregation with the resistant phenotypes. These fragments were excised from the gel, cloned and sequenced. Sequence analysis and database search against NCBI (National Center of Biotechnology Information) and PGSC (Potato Genome Sequencing Consortium) showed that all three © 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
1664
ZHANG Kun et al.
Fig. 1 Pathogenicity assays of potato with Phytophthora infestans. Three isolates, CN152, NL10147 and S08-02, that are virulent on all R1R11 differentials were used. Negative control: large necrotic lesions and massive sporulation were typical for the susceptive genotypes and the susceptible cultivar Desiree, which was used as the susceptible control. Positive control: typical resistant phenotype (i.e., hypersensitive response) was observed for resistant genotypes and the potato line that expresses broad-spectrum resistance gene RB, which was used as the resistant control. Photographs were taken six days postinoculation.
Fig. 2 Gel electrophoresis of NBS profiling amplified with combination NBS2-Alu I. The black arrow indicates a polymorphic and potential RGA band to be recovered, cloned and sequenced. BR, bulk of seven resistant plants; BS, bulk of three susceptible plants.
sequences had good hits (high level of identities and low error (E) values) with NBS-related sequences, so they were regarded as resistance gene analogs (RGAs) (Table 1). Good hits were found with Lycopersicon esculentum BAC clone Clemson_Id 127E11, complete sequence (GenBank accession: AF411807) which contains some RGAs similar to Rpi-blb3 gene of S. bulbocastanum on chromosome 4 (Park et al. 2005). Another good hits were with Solanum demissum R2 protein gene, complete cds (GenBank accession: FJ536325) on chromosome 4 (Li et al. 1998). All the max identities were more than 88% with E value of 6.00E-40 or lower. For comparison to PGSC database (S. phureja DM superscaffolds, V3). These three types of sequences gave good hits with superscaffold PGSC0003DMB000000296 on chromosome 4 with identities more than 84% and E value of 1.2E-25 or lower.
Chromosome position validation of gene candidates To verify the chromosome position of the identified
novel R gene locus, Th21, a marker on chromosome 4 was used to screen all the genotypes of family 03129 (18 resistant and 3 susceptible). The result revealed the presence of 2 specific bands in resistant genotypes but absent from susceptible genotypes (Fig. 3-A). Since marker Th21 is linked to R2 and Rpi-blb3, primer set was designed using R2 gene sequence (GenBank accession number FJ536325) to develop PCR marker RDSP. PCR amplification of RDSP resulted in two bands, with one co-segregated with resistant genotypes and one non-specific band present in all genotypes (Fig. 3-B). Cloning and sequencing of these two amplicons revealed that a total of 85 bp deletion was present and dispersed in four sites of the specific band in comparison with the non-specific band (Fig. 4). Eighteen cloned sequences obtained from the specific band can be categorized into three types: 15 out of 18 show 99.46% similarity in the overlapping regions, the other two were almost identical (99.46%) to each other but different from the others and the last one was different from all, which might be produced by sequencing error (Figs. 4 and 5). The sequence in the overlapping region of the 15 cloned ones was all present in three resistant genotypes, and was likely a © 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora
1665
Table 1 Two types blast results of NBS bands against NCBI and PGSC database, respectively1) NBS band
Length (bp) Accession
NCBI BLASTn
E value
N2A-1
210
JX313794 1.00E-51
N2A-1
210
JX313794 1.00E-62
N2H-2
215
JX313795 7.00E-50
N2H-2
215
JX313795 5.00E-56
N2H-3
206
JX313796 2.00E-59
N2H-3
206
JX313796 1.00E-51
1)
PGSC BLAST Accession from Max identity Top identity Description E value Scaffold NCBI (%) (%) Solanum demissum R2 protein gene, FJ536325 89 4.8E-27 PGSC0003DMB000000296 84.36 complete cds Lycopersicon esculentum BAC AF411807 92 clone Clemson_Id 127E11, complete sequence Solanum demissum R2 protein gene, FJ536325 90 5.2E-26 PGSC0003DMB000000296 89.07 complete cds Lycopersicon esculentum BAC AF411807 89 clone Clemson_Id 127E11, complete sequence Solanum demissum R2 protein gene, FJ536325 92 1.20E-25 PGSC0003DMB000000296 90.75 complete cds Lycopersicon esculentum BAC AF411807 91 clone Clemson_Id 127E11, complete sequence
Chr. No. 4
4
4
NBS, nucleotide binding site; NCBI, National Center of Biotechnology Information; PGSC, Potato Genome Sequencing Consortium.
A
B
C
Fig. 3 Development of molecular marker RDSP linked to the RD locus. A, PCR amplification with primer Th21, resulted in three bands for the resistant genotypes while only one for the susceptible ones. B, PCR amplification with primer set RDSP produced two fragments, with one polymorphic while the other present in both resistant and susceptible plants. C, PCR analysis of the segregating population 03129 with primer set RDSPRV, showing specific amplification of a 288 bp band from resistant genotypes. R, resistant genotypes; S, susceptible genotypes; DL, DNA size markers (in bp), from top to the bottom, 1 200, 900, 700, 500, 300, and 100, respectively.
candidate fragment linked to the novel R gene locus. To eliminate the non-specific band, primer set RDSPRV was developed based on the specific band of RDSP. Using the designed primer set RDSPRV, a specific fragment (288 bp) was amplified only in the resistant genotypes (Fig. 3-C), and could be a marker linked to the potential novel R gene locus.
DISCUSSION In this study, we report the discovery of a novel resistance gene locus conferring broad-spectrum resistance to P. infestans and the determination of its location on the potato chromosome 4 using NBS profiling. Some late blight resistance genes, such as Rpi-blb3, R2, R2-
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
ZHANG Kun et al.
1666 NS1-1.seq NS1-2.seq NS1-3.seq NS1-4.seq NS1-5.seq NS1-6.seq NS2-3.seq NS2-6.seq NS2-7.seq NS2-8.seq NS2-9.seq NS2-10.seq NS3-1.seq NS3-3.seq NS3-4.seq NS3-6.seq NS3-7.seq NS3-10.seq S1 S1-2.seq S1-3.seq S1-4.seq S2-1.seq S2-2.seq S2-3.seq S2-4.seq S2-5.seq S2-10.seq S3-2.seq S3-3.seq S3-4.seq S3-7.seq S1-5.seq S3-5.seq S3-6.seq Consensus NS1-1.seq NS1-2.seq NS1-3.seq NS1-4.seq NS1-5.seq NS1-6.seq NS2-3.seq NS2-6.seq NS2-7.seq NS2-8.seq NS2-9.seq NS2-10.seq NS3-1.seq NS3-3.seq NS3-4.seq NS3-6.seq NS3-7.seq NS3-10.seq S1 S1-2.seq S1-3.seq S1-4.seq S2-1.seq S2-2.seq S2-3.seq S2-4.seq S2-5.seq S2-10.seq S3-2.seq S3-3.seq S3-4.seq S3-7.seq S1-5.seq S3-5.seq S3-6.seq Consensus catttttgttgg
c gagaag
tcaggat ttgtac a attgcta t aa ttctca agca a
NS1-1.seq NS1-2.seq NS1-3.seq NS1-4.seq NS1-5.seq NS1-6.seq NS2-3.seq NS2-6.seq NS2-7.seq NS2-8.seq NS2-9.seq NS2-10.seq NS3-1.seq NS3-3.seq NS3-4.seq NS3-6.seq NS3-7.seq NS3-10.seq S1 S1-2.seq S1-3.seq S1-4.seq S2-1.seq S2-2.seq S2-3.seq S2-4.seq S2-5.seq S2-10.seq S3-2.seq S3-3.seq S3-4.seq S3-7.seq S1-5.seq S3-5.seq S3-6.seq Consensus tgt tc caag tacaaca a gg tct ct DZ3 ata a t NS1-1.seq NS1-2.seq NS1-3.seq NS1-4.seq NS1-5.seq NS1-6.seq NS2-3.seq NS2-6.seq NS2-7.seq NS2-8.seq NS2-9.seq NS2-10.seq NS3-1.seq NS3-3.seq NS3-4.seq NS3-6.seq NS3-7.seq NS3-10.seq S1 S1-2.seq S1-3.seq S1-4.seq S2-1.seq S2-2.seq S2-3.seq S2-4.seq S2-5.seq S2-10.seq S3-2.seq S3-3.seq S3-4.seq S3-7.seq S1-5.seq S3-5.seq S3-6.seq Consensus aga agaa c tggga gtttgaaa agcattc at gcaa aatggcagcagagt attattaccac
DZ2
DZ4
caaacaggatgtcgctgaaagagcaga
caag aatc
g a a attgaggagaac
a tcc
at
DZ1
c
a t
ag
acac
gat
c tggatat
aa tac tt tggtggt gat atgt t g
162 159 162 171 168 168 156 162 159 162 171 171 171 156 171 162 171 162 153 153 153 153 153 153 153 153 153 153 153 153 153 153 70 162 162 341 338 341 349 347 347 336 341 338 341 350 350 350 336 350 341 350 341 256 256 256 256 256 256 256 256 256 256 256 256 256 256 249 341 341 518 515 518 526 524 524 513 517 515 518 527 527 527 513 530 518 527 518 433 433 433 433 433 433 433 433 433 433 433 433 433 433 426 417 417 621 618 621 629 627 627 616 620 618 621 630 630 630 616 633 621 630 621 536 536 536 536 536 536 536 536 536 536 536 536 536 536 529 520 520
Fig. 4 Multiple sequence alignment of NS and S fragments amplified with primer RDSP. The alignment was generated by DNAMAN using the default parameter. Positions of the four differential zones (DZ1 to DZ4) are indicated by bars above and below the sequences. DZ1 & DZ2 and DZ3 &DZ4 separate one type of S sequence from the other. The single S1-5 was likely produced by sequencing error. The prefixes NS and S refer to none-specific and specific sequences to resistant plants, respectively. Each type are represented with 18 sequences obtained from three resistant genotypes.
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora NS1-3 NS2-8 NS1-1 NS3-6 NS3-10 NS2-6 NS1-2 NS2-7 NS2-3 NS3-3 NS1-4 NS3-1 NS3-4 NS2-9 NS2-10 NS3-7 NS1-5 NS1-6 S2-1 S3-4 S1-4 S1-7 S1-1 S1-5 S3-3 S2-5 Ⅰ S1-3 S3-7 S1-2 S2-2 S3-2 S2-3 S2-4 S2-10 S3-5 S3-6 Ⅱ 1.5
1.0
0.5
0.0
Fig. 5 Phylogenetic analysis of cloned sequences. The unrooted rectangular tree was established on the basis of an optimized multiple-sequence alignment using the MEGA 5.05 software package (bootstrap reps=1 000). The scale down the tree indicates expected number of substitutions per site. The boxed clade shaded in light gray harbors the two types of co-paralogs for the resistance-specific (S) sequences.
like, Rpi-abpt and Rpi-mcd1 from S. bulbocastanum, S. demissum, RHAM026 (various wild Solanum species in its pedigree), ABPT clone (quadruple hybrid of S. acaule, S. bulbocastanum, S. phureja and S. tuberosum) and S. microdontum, respectively, are also located at the same locus but they confer resistance to isolates of limited race combinations. Conclusively, until now there has been no new resistance gene cluster detected in the materials but in the traditional “hot spot” of chromosome 4, which corroborates one theory that the Solanum genome is rather exhaustive and that most resistance gene
1667
clusters are already known (Jacobs et al. 2010). S. demissum is deemed to be the ancestry wild species for late blight resistance breeding. However, after decades of exploration, it seems to have been worn out, leaving its 11 (R1-R11) masterpieces which confer limited resistance to late blight pathogen. There has been no report about R genes from S. demissum capable of conquering P. infestans isolates virulent on all 11 R genes in the differentials. In this research, we discovered such a locus from S. demissum, which may confer broad-spectrum resistance to P. infestans. The resistance-specific fragments produced by NBS profiling showed a 92% sequence identity with R2 gene sequence. The materials showed broad-spectrum resistance, like RB/Rpi-blb1, but they are different from R2, as confirmed by repeated pathogenicity tests with three virulent isolates (race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11). The identified locus may therefore confers distinct function from that of R2 gene, consistent with the suggestion that new alleles exist at the loci of already known genes (Vleeshouwers et al. 2008). P. infestans evolves very fast due to its mixed reproduction. Deployment of single or several resistance genes in potato has not catched up with evolution potential of the pathogen. It’s therefore urgent for efficient potato late blight control to discover and release new genes, especially the genes with broad-spectrum resistance, so as to artificially create resistance diversity in the field. It is relatively easy for S. demissum to introgress resistance genes into cultivated potatoes by crossing and backcrossing. The discovery and further isolation of this novel broad-spectrum resistance gene locus from S. demissum will facilitate efficient late blight control and understanding of disease resistance to P. infestans.
CONCLUSION A novel disease resistance locus from S. demissum that potentially confers broad-spectrum resistance to late blight pathogen has been identified and a linked molecular marker developed in this study. The results will be useful to breed for disease resistance in potato to P. infestans by marker assisted approach and to the understanding of disease resistance mechanisms by further cloning of the gene locus.
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
ZHANG Kun et al.
1668
The hexaploid S. demissum population (Code 03129) contains 50 seeds, which were introduced from NRSP-6 (United States Potato Genebank, Sturgeon Bay, US). The seeds were sown in the pot in 2003 and 21 plants containing 18 resistant and 3 susceptible genotypes were routinely maintained.
on the abaxial side. The detached leaves were incubated in the artificial climate box with the 16/8 h photoperiod and 15°C constant temperature. The phenotypes were determined at six days post inoculation and the evaluation criteria were in accordance with that described by van der Lee et al. 2001, being classified from the deadly susceptible (rank 1) to the most resistant (rank 5) phenotypes. Potato cultivar Desiree and somatic hybrid RB-3 line containing broad-spectrum resistance gene RB (kindly provided by Professor Jiming Jiang, University of Wisconsin, Madison, USA) were included as susceptible and resistant controls, respectively.
P. infestans isolates and pathogenicity assay
DNA isolation and NBS profiling
Twelve P.infestans isolates (Table 2) including three aggressive ones (S08-02, CN152 and NL10147) were used in detached leaf assays as described (Vleeshouwers et al. 1999). The isolates were activated on fresh Rye B medium and spores were washed off to prepare a spore suspension in large tubes after 7-10 days. Then the suspension was incubated at 4°C for 3-5 h to release the zoospore and the inoculum concentration was adjusted to 5×104 zoospores mL-1. For disease testing, the third or fourth fully-expanded leaves counted from the top were detached from 8-10 weeks old plants and placed into water-saturated florists foam through petioles. Nine leaflets of three compound leaves from three different replicate plants per genotype were inoculated with 10 µL zoospore suspension
Genomic DNA from plants grown in a greenhouse was isolated as described previously (van der Beek et al. 1992). The resistant and susceptible bulks (BR and BS) were constructed from 7 resistant and all the 3 susceptible genotypes from population 03129, respectively. DNA samples were pooled in equal amounts to form the bulks. NBS profiling procedure was as described (Wang et al. 2008) and modified by van der Linden et al. (2004) (personal communication with Prof. Ben Vosman). The modifications were as follows: polyacrylamide gels were silver stained instead of autoradiography, resulting in the difference of the second round PCR reaction: a 0.1 µmol L-1: 0.2 µmol L-1 final concentration ratio between NBS-specific primer and adapter primer. Totally, five NBS-specific primers targeting different parts of the conservative sequence of NBS regions (Table 3) and four restriction enzymes (AluⅠ, Hae Ⅲ, MseⅠand RsaⅠ) were chosen (Jacobs et al. 2010), accounting to 20 primerenzyme combinations. The first round of NBS profiling was performed on BR and BS to determine which combination worked. The second round NBS profiling was performed on both bulks and individuals which constituted the bulks.
MATERIALS AND METHODS Plant materials
Table 2 P. infestans isolates used in late blight resistance evaluation Isolate M08-04 M08-09 HK06-09 HK06-21 HK06-59 JW07-14 JW07-38 JW07-43 I08-01 S08-02 CN152 NL10147
Collecting location Fujian, China Fujian, China Heilongjiang, China Heilongjiang, China Heilongjiang, China Hebei, China Hebei, China Hebei, China Inner Mongolia, China Sichuan, China China Netherlands
Mating type Race ND 6, 8, 11 ND 3, 4, 10 A1 3, 4, 7, 9 A1 2, 3, 4, 9, 10 A1 3, 4, 6, 9, 11 A1 3, 4, 6, 8, 10, 11 A1 2, 3, 4, 6, 8, 10 A1 1, 3, 4, 9, 10 ND 3, 4, 6, 8, 9, 10, 11 ND 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 A2 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 A2 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
Sequencing and analysis of NBS fragments Bands that were present in both resistant bulk and individuals were excised with a sharp razor blade, eluted in 100 µL TE
Table 3 Overview of primers used in this study Primers NBS1 NBS2 NBS3 NBS5a6 NBS9 Th21 RDSP RDSP
RV
Sequences GCIARWGTWGTYTTICCYRAICC GTWGTYTTICCYRAICCISSCAT GTWGTYTTICCYRAICCISSCATICC YYTKRTHGTMITKGATGAYRTITGG TGTGGAGGRTTACCTCTAGC F: ATTCAAAATTCTAGTTCCGCC R: AACGGCAAAAAAGCACCAC F: TGTTGCCGAGGAGATCCAATCACT R: TCTGCTCTTTCAGCGACATCCTGT F: CTCAACTTCTCAAAGCACAAGTCCT R: TTCTTGCTATCTGGGAATGCTCT
Temperature (°C) 55 60 60 55 55
Fragment length (bp)
References Mantovani et al. (2006) van der Linden et al. (2004) Wang et al. (2008) Brugmans et al. (2008) Wang et al. (2008) Park et al. (2005)
48 58
621
Designed in this paper
68
288
Designed in this paper
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora
buffer for 10 min at 100°C and then centrifuged at 13 200×g for 5 min. The resulting supernatant was used as template for the re-amplification with the NBS-specific and the adapter primers. The PCR condition was identical to the first step of NBS profiling. PCR products were examined on agarose gels and purified with QIAquick spin columns (Qiagen Benelux, The Netherlands). Fragments were cloned into the pGM-T vector (TIANGEN Biotech (Beijing) Co.,Ltd., China) according to the manufacturer’s manual, and the resulting plasmid was transformed into E. coli Top 10 (TIANGEN). Twelve positive colonies per fragment, confirmed by colony PCR with universal primers T7 and SP6, were chosen randomly for sequencing using the ABI 3730 automatic sequencer. All the sequences were analyzed with DNASTAR modules (Burland 2000). The adapter-adapter sequences were discarded, leaving only the adapter-primer ones. The potential RGA sequences were analyzed with BLASTn to NCBI GenBank (http://www. ncbi.nlm.nih.gov/) and PGSC database (http://potatogenomics. plantbiology.msu.edu/blast.html) using the discontinuous megablast option of the BLASTn suite (Altschul et al. 1997).
Chromosome position validation of the gene locus The chromosomal position of the gene locus was preliminarily determined by the BLAST search against the potato genome sequence. To further verify the chromosome position of the gene locus, the chromosome-specific SCAR marker Th21 was used to screen the segregating population using PCR procedure (Hein et al. 2007; Jacobs et al. 2010; Lokossou et al. 2009; Park et al. 2005). The 10 µL PCR reaction mix included: 10 ng genomic DNA, 1× PCR buffer, 500 µmol L-1 dNTP each, 0.2 µmol L-1 of each primer and 0.5 U Taq polymerase (TIANGEN, China). The PCR condition was: 3 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 48°C and 1 min at 72°C with a 10-min final elongation step at 72°C. The band pattern was examined on 1.5% agarose gel with 5 V cm-1 voltage for 30 min. Furthermore, based on the sequences (GenBank accession No. FJ536325) with max hit in NCBI database, primer set RDSP (Table 3) was designed to specifically amplify the potential gene fragments that were verified for their map positions. In a 10-µL reaction system, approximately 5 ng genomic DNA, 1× PCR buffer, 500 µmol L-1 dNTP each, 0.4 /0.3 µmol L-1 of each primer, 0.5 U Taq polymerase were mixed and the following PCR condition was executed in Applied Biosystems: 3 min at 95°C, 35 cycles of 30 s at 95°C, 30 s at 62°C/58°C and 50 s at 72°C, with a final extention of 10 min at 72°C. After agarose electrophoresis, the two bands (621 bp and 536 bp) were excised, cloned and sequenced, respectively. Similar to the sequencing of fragments obtained from NBS profiling described above, six positive clones per band from three random resistant genotypes were sequenced. Eighteen sequences were obtained and analyzed with DNASTAR
1669
modules. Although a resistance-specific band was amplified by primer set RDSP, there was also a non-specific band present in both resistant and susceptible genotypes. Based on the fragment sequences, primer set RDSPRV (Table 3) was further designed to target the RD locus. The PCR conditions for the RDSPRV were : 40 ng genomic DNA, 0.4 µmol L-1 of each primer, 1× PCR buffer, 500 µmol L-1 dNTP each and 0.5 U Taq polymerase (TIANGEN, China), in a total volume of 10 µL. The following PCR program was used: 5 min at 94°C followed by 32 cycles of 30 s at 94°C, 30 s at 68°C, 30 s at 72°C, and a final elongation of 7 min at 72°C.
Acknowledgments
This project was supported by the Key Laboratory of Biology and Genetic Improvement of Tuber and Root Crop, Ministry of Agriculture, P.R.China and funded by the National Natural Science Foundation of China (NSFC, 31000738). We thank Dr Huang Sanwen and Li Ying from Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences for kindly providing the isolates CN152 and NL10147, Prof. Zhu Jiehua from Agricultural University of Hebei, China, for disease test with isolate S08-02. We are grateful for the patient personal communication for the NBS profiling operation from Prof. Ben Vosman of Wageningen University, the Netherlands and Prof. Nie Xianzhou from Agriculture and Agri-Food Canada (AAFC) and Xiong Xingyao from Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences for critically reading the manuscript.
References
Altschul S F, Madden T L, Schaffer A A, Zhang J, Zhang Z, Miller W, Lipman D J. 1997. Gapped BLAST and PSIBLAST: A new generation of protein database search programs. Nucleic Acids Research, 25, 3389-3402. Ballvora A, Ercolano M R, Weiss J, Meksem K, Bormann C A, Oberhagemann P, Salamini F, Gebhardt C. 2002. The R1 gene for potato resistance to late blight (Phytophthora infestans) belongs to the leucine zipper/NBS/LRR class of plant resistance genes. The Plant Journal, 30, 361-371. van der Beek J G, Verkerk R, Zabel P, Lindhout P. 1992. Mapping strategy for resistance genes in tomato based on RFLPs between cultivars: Cf9 (resistance to Cladosporium fulvum) on chromosome 1. Theoretical and Applied Genetics, 84, 106-112. Bhaskar P B, Venkateshwaran M, Wu L, Ane J M, Jiang J. 2009. Agrobacterium-mediated transient gene expression and silencing: a rapid tool for functional gene assay in potato. PLoS One, 4, e5812. Bradshaw J E, Bryan G J, Lees A K, McLean K, SolomonBlackburn R M. 2006. Mapping the R10 and R11 genes for resistance to late blight (Phytophthora infestans) present in the potato (Solanum tuberosum) R-gene differentials of
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
1670
black. Theoretical and Applied Genetics, 112, 744-751. Brugmans B, Wouters D, van Os H, Hutten R, van der Linden G, Visser R G, van Eck H J, van der Vossen E A. 2008. Genetic mapping and transcription analyses of resistance gene loci in potato using NBS profiling. Theoretical and Applied Genetics, 117, 1379-1388. Burland T G. 2000. DNASTAR’s Lasergene sequence analysis software. In: Bioinformatics Methods and Protocols, Humana Press, USA. pp. 71-91. Colton L M, Groza H I, Wielgus S M, Jiang J. 2006. Markerassisted selection for the broad-spectrum potato late blight resistance conferred by gene RB derived from a wild potato species. Crop Science, 46, 589-594. EI-Kharbotly A, Palomino-Sfinchez C, Salamini F, Jacobsen E, Gebhardt C. 1996. R6 and R7 alleles of potato conferring race-specific resistance to Phytophthora infestans (Mont.) de Bary identified genetic loci clustering with the R3 locus on chromosome XI. Theoretical and Applied Genetics, 92, 880-884. Gebhardt C, Ballvora A, Walkemeier B, Oberhagemann P, Schüler K. 2004. Assessing genetic potential in germplasm collections of crop plants by marker-trait association: a case study for potatoes with quantitative variation of resistance to late blight and maturity type. Molecular Breeding, 13, 93-102. Haverkort A J, Struik P C, Visser R G F, Jacobsen E. 2009. Applied biotechnology to combat late blight in potato caused by Phytophthora infestans. Potato Research, 52, 249-264. Hein I, McLean K, Chalhoub B, Bryan G J. 2007. Generation and screening of a BAC library from a diploid potato clone to unravel durable late blight resistance on linkage group IV. International Journal of Plant Genomics. doi: 10.1155/2007/51421. Huang S, Vleeshouwers V G, Werij J S, Hutten R C, van Eck H J, Visser R G, Jacobsen E. 2004. The R3 resistance to Phytophthora infestans in potato is conferred by two closely linked R genes with distinct specificities. Molecular Plant-Microbe Interactions, 17, 428-435. Huang S, van der Vossen E A, Kuang H, Vleeshouwers V G, Zhang N, Borm T J, van Eck H J, Baker B, Jacobsen E, Visser R G. 2005. Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato. The Plant Journal, 42, 251-261. Jacobs M M, Vosman B, Vleeshouwers V G, Visser R G, Henken B, van den Berg R G. 2010. A novel approach to locate Phytophthora infestans resistance genes on the potato genetic map. Theoretical and Applied Genetics, 120, 785-796. Jo K R, Arens M, Kim T Y, Jongsma M A, Visser R G, Jacobsen E, Vossen J H. 2011. Mapping of the S. demissum late blight resistance gene R8 to a new locus on chromosome IX. Theoretical and Applied Genetics, 123, 1331-1340. Kamoun S. 2001. Nonhost resistance to Phytophthora: Novel
ZHANG Kun et al.
prospects for a classical problem. Current Opinion in Plant Biology, 4, 295-300. van der Lee T, Testa A, van ‘t Klooster J, van den BergVelthuis G, Govers F. 2001. Chromosomal deletion in isolates of Phytophthora infestans correlates with virulence on R3, R10, and R11 potato lines. Molecular Plant-Microbe Interactions, 14, 1444-1452. Leonards-Schippers C, Gieffers W, Salamini F, Gebhardt C. 1992. The R1 gene conferring race-specific resistance to Phytophthora infestans in potato is located on potato chromosome V. Molecular and General Genetics MGG, 233, 278-283. Li G, Huang S, Guo X, Li Y, Yang Y, Guo Z, Kuang H, Rietman H, Bergervoet M, Vleeshouwers V G, van der Vossen E A, Qu D, Visser R G, Jacobsen E, Vossen J H. 2011. Cloning and characterization of r3b; members of the r3 superfamily of late blight resistance genes show sequence and functional divergence. Molecular PlantMicrobe Interactions, 24, 1132-1142. van der Linden C G, Wouters D C, Mihalka V, Kochieva E Z, Smulders M J, Vosman B. 2004. Efficient targeting of plant disease resistance loci using NBS profiling. Theoretical and Applied Genetics, 109, 384-393. Li X, van Eck H J, van der Voort J R, Huigen D J, Stam P, Jacobsen E. 1998. Autotetraploids and genetic mapping using common AFLP markers: The R2 allele conferring resistance to Phytophthora infestans mapped on potato chromosome 4. Theoretical and Applied Genetics, 96, 1121-1128. Lokossou A A, Park T H, van Arkel G, Arens M, Ruyter-Spira C, Morales J, Whisson S C, Birch P R, Visser R G, Jacobsen E, van der Vossen E A. 2009. Exploiting knowledge of R/ Avr genes to rapidly clone a new LZ-NBS-LRR family of late blight resistance genes from potato linkage group IV. Molecular Plant-Microbe Interactions, 22, 630-641. Mantovani P, van der Linden G, Maccaferri M, Danguineti MC, Tuberosa R. 2006. Nucleotide-binding site (NBS) profiling of genetic diversity in durum wheat. Genome, 49, 1473-1480. Martin G B, Bogdanove A J, Sessa G. 2003. Understanding the functions of plant disease resistance proteins. Annual Review of Plant Biology, 54, 23-61. McDonald B A, Linde C. 2002. Pathogen population genetics, evolutionary potential, and durable resistance. Annual Review of Phytopathology, 40, 349-379. Palhares A C, Rodrigues-Morais T B, van Sluys M A, Domingues D S, Maccheroni W, Jordao H, Souza A P, Marconi T G, Mollinari M, Gazaffi R, van der Vossen E A, Qu D, Visser R G, Jacobsen E, Vossen J H. 2012. A novel linkage map of sugarcane with evidence for clustering of retrotransposon-based markers. BMC Genetics, 13, 51. Park T H, Gros J, Sikkema A, Vleeshouwers V G, Muskens M, Allefs S, Jacobsen E, Visser R G, van der Vossen E A. 2005. The late blight resistance locus Rpi-bib3 from Solanum bulbocastanum belongs to a major late blight R
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora
gene cluster on chromosome 4 of potato. Molecular PlantMicrobe Interactions, 18, 722-729. Song J, Bradeen J M, Naess S K, Raasch J A, Wielgus S M, Haberlach G T, Liu J, Kuang H, Austin-Phillips S, Buell C R, Helgeson J P, Jiang J. 2003. Gene RB cloned from Solanum bulbocastanum confers broad spectrum resistance to potato late blight. Proceedings of the National Academy of Sciences of the United States of America, 100, 91289133. van der Vossen E, Sikkema A, Hekkert B L, Gros J, Stevens P, Muskens M, Wouters D, Pereira A, Stiekema W, Allefs S. 2003. An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato. The Plant Journal, 36, 867-882. van der Vossen E A, Gros J, Sikkema A, Muskens M, Wouters D, Wolters P, Pereira A, Allefs S. 2005. The Rpi-blb2 gene from Solanum bulbocastanum is an Mi-1 gene homolog
1671
conferring broad-spectrum late blight resistance in potato. The Plant Journal, 44, 208-222. Vleeshouwers V G A A, Dooijeweert W, Paul Keizer L C, Sijpkes L, Govers F, Colon L T. 1999. A laboratory assay for Phytophthora infestans resistance in various Solanum species reflects the field situation. European Journal of Plant Pathology, 105, 241-250. Vleeshouwers V G, Rietman H, Krenek P, Champouret N, Young C, Oh S K, Wang M, Bouwmeester K, Vosman B, Visser R G, Evert J, Francine G, Sophien K, van der Vossen E. 2008. Effector genomics accelerates discovery and functional profiling of potato disease resistance and Phytophthora infestans avirulence genes. PLoS One 3, e2875. Wang M, van den Berg R, van der Linden G, Vosman B. 2008. The utility of NBS profiling for plant systematics: A first study in tuber-bearing Solanum species. Plant Systematics and Evolution, 276, 137-148. (Managing editor WENG Ling-yun)
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
August 2014
RESEARCH ARTICLE
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora infestans ZHANG Kun, XU Jian-fei, DUAN Shao-guang, PANG Wan-fu, BIAN Chun-song, LIU Jie and JIN Li-ping Institute of Vegetables and Flowers, Chinese Academy of Agriculture Sciences/Key Laboratory of Biology and Genetic Improvement of Tuber and Root Crop, Ministry of Agriculture, Beijing 100081, P.R.China
Abstract Potato late blight, caused by the oomycete pathogen Phytophthora infestans, is the most serious disease of potato worldwide. The adoption of varieties with resistance genes, especially broad-spectrum resistance genes, is the most efficient approach to control late blight. Solanum demissum is a well-known wild potato species from which 11 race-specific resistance genes have been identified, however, no broad-spectrum resistance genes like RB have been reported in this species. Here, we report a novel reisistance locus from S. demissum that potentially confer broad-spectrum resistance to late blight. A small segregating population of S. demissum were assessed for resistance to aggressive P. infestans isolates (race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11). This coupled with nucleotide binding site (NBS) profiling analyses, led to the identification of three fragments that linked to the potential candidate resistance gene(s). Cloning and sequence analysis of these fragments suggested that the identified resistance gene locus is located in the region containing R2 resistance gene at chromosome 4. Based on the sequences of the cloned fragments, a co-segregating sequence characterized amplified region (SCAR) marker, RDSP, was developed. The newly identified marker RDSP will be useful for marker assisted breeding and further cloning of this potential resistance gene locus. Key words: potato, late blight, resistance gene, NBS profiling , broad-spectrum resistance
INTRODUCTION Potato (Solanum tuberosum L.) is the fourth most largest food crop in the world (Bhaskar et al. 2009). Potato is susceptible to various pests and diseases, among which late blight is the most devastating disease in potato crops worldwide (Kamoun 2001). Late blight is caused by Phytophthora infestans, an oomycete pathogen that has many different races (EI-Kharbotly et al. 1996). Since the Irish potato famine in the 1840s, breeders have begun
to search for resistant germplasm. Solanum demissum (2n=6x=72) was the first wild species identified to possess inherited resistance to the disease (Gebhardt et al. 2004), and thus has been used for breeding late blight resistance in cultivated potato by crossing or backcrossing (Jo et al. 2011). The resistance genes R1 to R11 were mostly characterized as single dominant loci in S. demissum, and were mapped on different chromosomes (Leonards-Schippers et al. 1992; EI-Kharbotly et al. 1996; Li et al. 1998; Huang et al. 2004; Bradshaw et al. 2006). In the past decade, R1, R2, R3a, and R3b have been cloned using different strategies such as
Received 15 April, 2013 Accepted 17 June, 2013 Correspondence XU Jian-fei, Tel: +86-10-82109543, E-mail: [email protected]; JIN Li-ping, Tel: +86-10-82105943, E-mail: [email protected]
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd. doi: 10.1016/S2095-3119(14)60759-0
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora
positional cloning and allele mining (Ballvora et al. 2002; Huang et al. 2005; Li et al. 2011; Lokossou et al. 2009). However, due to the super resistance spectrum of these 11 R genes and high evolutionary potential of P. infestans, R genes introgressed into potato cultivars from S. demissum have been overcome by new strains of the pathogen (McDonald and Linde 2002). Therefore, broad-spectrum resistance genes offer a new hope for breeding durable late blight-resistant potato varieties. Recently, RB (Rpi-blb1) and Rpi-blb2 conferring broad-spectrum resistance to a wide range of known P. infestans races have been cloned from S. bulbocastanum (Song et al. 2003; van der Vossen et al. 2003, 2005). Somatic hybrids with RB (Rpi-blb1) have been developed and used in potato breeding programs. Several potato lines derived from these hybrids exhibit a remarkably high level of resistance to late blight (Colton et al. 2006). Rpi-blb2 has also been introgressed into potato cultivars (Haverkort et al. 2009). With the identification of many plant R genes, the conserved domains of the corresponding resistance proteins have been uncovered and used to develop new strategies for isolation of new R genes. Most of the cloned R genes can be categorized into five classes: nucleotide-binding site-leucine-rich repeat (NBS-LRR), LRR, LRR-kinase, serine-threonine kinase, coiled-coil (CC) motif (Martin et al. 2003). To date, all the cloned late blight-resistant genes, including R1, R3a, R3b, RB, and Rpi-blb2, are members of the NBS-LRR gene family, the largest of the five classes of R genes. Based on amplification from the conserved sequence of NBS motifs towards restriction enzyme sites, an approach termed NBS profiling to target molecular markers tightly linked to R genes and resistance gene analogs (RGAs) is developed (van der Linden et al. 2004). NBS profiling with little or no modifications across species can be applied on R gene mining, germplasm characterization and biodiversity studies. In potato, several new late blight resistance genes have been identified and mapped by NBS profiling (Brugmans et al. 2008; Jacobs et al. 2010; Jo et al. 2011). Despite progress, identification of new R genes, especially novel R genes conferring broad spectrum resistance to P. infestans complex races, is still needed for breeding potato varieties possessing a durable and high level of resistance to late blight. Wild potato species are valuable sources to explore resistance to late blight. Here, we evaluated a small
1663
segregating population from S. demissum for resistance to P. infestans pathotype that virulent to all 11 differential R genes (race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11). Several RGAs were identified in bulked DNA samples prepared from resistant and susceptible progenies using nucleotide binding site (NBS) profiling. The cloned RGAs were mapped to the chromosome 4 by sequence and genome analysis with the complete potato genome sequence (http://www.potatogenome.net). A novel resistance locus that may be associated with broad-spectrum resistance to P. infestans, was identified in S. demissum.
RESULTS Evaluation of S. demissum population for resistance to P. infestans The S. demissum population 03129 containing 21 progenies were evaluated for resistance against twelve P. infestans isolates. Cultivars Désirée and RB-3 were included as susceptible and resistant controls, with the latter showing broad-spectrum resistance to P. infestans. Similar to the resistant RB-3 and the susceptible Desiree, the resistant S. demissum plants developed localized necrosis while the susceptible plants developed systemic symptoms (massive sporulation) (Fig. 1). Among the 21 genotypes analyzed, 18 were deemed as resistant whereas three as susceptible to P. infestans.
NBS profiling and sequences analysis NBS profiling experiments were carried out using combinations of the NBS primers (NBS1, NBS2, NBS3, NBS5a6 and NBS9) and restriction enzymes (Alu I, Hae III, Mse I and Rsa I) on both resistant (BR) and susceptible (BS) bulks. Fragments NBS2-AluI-210 and NBS2Hae III-185/194 were identified to be present in BR but absent in BS (Fig. 2). Further analysis on the individual progenies showed that they were consistenly only present in resistant ones (Fig. 2), suggesting their co-segregation with the resistant phenotypes. These fragments were excised from the gel, cloned and sequenced. Sequence analysis and database search against NCBI (National Center of Biotechnology Information) and PGSC (Potato Genome Sequencing Consortium) showed that all three © 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
1664
ZHANG Kun et al.
Fig. 1 Pathogenicity assays of potato with Phytophthora infestans. Three isolates, CN152, NL10147 and S08-02, that are virulent on all R1R11 differentials were used. Negative control: large necrotic lesions and massive sporulation were typical for the susceptive genotypes and the susceptible cultivar Desiree, which was used as the susceptible control. Positive control: typical resistant phenotype (i.e., hypersensitive response) was observed for resistant genotypes and the potato line that expresses broad-spectrum resistance gene RB, which was used as the resistant control. Photographs were taken six days postinoculation.
Fig. 2 Gel electrophoresis of NBS profiling amplified with combination NBS2-Alu I. The black arrow indicates a polymorphic and potential RGA band to be recovered, cloned and sequenced. BR, bulk of seven resistant plants; BS, bulk of three susceptible plants.
sequences had good hits (high level of identities and low error (E) values) with NBS-related sequences, so they were regarded as resistance gene analogs (RGAs) (Table 1). Good hits were found with Lycopersicon esculentum BAC clone Clemson_Id 127E11, complete sequence (GenBank accession: AF411807) which contains some RGAs similar to Rpi-blb3 gene of S. bulbocastanum on chromosome 4 (Park et al. 2005). Another good hits were with Solanum demissum R2 protein gene, complete cds (GenBank accession: FJ536325) on chromosome 4 (Li et al. 1998). All the max identities were more than 88% with E value of 6.00E-40 or lower. For comparison to PGSC database (S. phureja DM superscaffolds, V3). These three types of sequences gave good hits with superscaffold PGSC0003DMB000000296 on chromosome 4 with identities more than 84% and E value of 1.2E-25 or lower.
Chromosome position validation of gene candidates To verify the chromosome position of the identified
novel R gene locus, Th21, a marker on chromosome 4 was used to screen all the genotypes of family 03129 (18 resistant and 3 susceptible). The result revealed the presence of 2 specific bands in resistant genotypes but absent from susceptible genotypes (Fig. 3-A). Since marker Th21 is linked to R2 and Rpi-blb3, primer set was designed using R2 gene sequence (GenBank accession number FJ536325) to develop PCR marker RDSP. PCR amplification of RDSP resulted in two bands, with one co-segregated with resistant genotypes and one non-specific band present in all genotypes (Fig. 3-B). Cloning and sequencing of these two amplicons revealed that a total of 85 bp deletion was present and dispersed in four sites of the specific band in comparison with the non-specific band (Fig. 4). Eighteen cloned sequences obtained from the specific band can be categorized into three types: 15 out of 18 show 99.46% similarity in the overlapping regions, the other two were almost identical (99.46%) to each other but different from the others and the last one was different from all, which might be produced by sequencing error (Figs. 4 and 5). The sequence in the overlapping region of the 15 cloned ones was all present in three resistant genotypes, and was likely a © 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora
1665
Table 1 Two types blast results of NBS bands against NCBI and PGSC database, respectively1) NBS band
Length (bp) Accession
NCBI BLASTn
E value
N2A-1
210
JX313794 1.00E-51
N2A-1
210
JX313794 1.00E-62
N2H-2
215
JX313795 7.00E-50
N2H-2
215
JX313795 5.00E-56
N2H-3
206
JX313796 2.00E-59
N2H-3
206
JX313796 1.00E-51
1)
PGSC BLAST Accession from Max identity Top identity Description E value Scaffold NCBI (%) (%) Solanum demissum R2 protein gene, FJ536325 89 4.8E-27 PGSC0003DMB000000296 84.36 complete cds Lycopersicon esculentum BAC AF411807 92 clone Clemson_Id 127E11, complete sequence Solanum demissum R2 protein gene, FJ536325 90 5.2E-26 PGSC0003DMB000000296 89.07 complete cds Lycopersicon esculentum BAC AF411807 89 clone Clemson_Id 127E11, complete sequence Solanum demissum R2 protein gene, FJ536325 92 1.20E-25 PGSC0003DMB000000296 90.75 complete cds Lycopersicon esculentum BAC AF411807 91 clone Clemson_Id 127E11, complete sequence
Chr. No. 4
4
4
NBS, nucleotide binding site; NCBI, National Center of Biotechnology Information; PGSC, Potato Genome Sequencing Consortium.
A
B
C
Fig. 3 Development of molecular marker RDSP linked to the RD locus. A, PCR amplification with primer Th21, resulted in three bands for the resistant genotypes while only one for the susceptible ones. B, PCR amplification with primer set RDSP produced two fragments, with one polymorphic while the other present in both resistant and susceptible plants. C, PCR analysis of the segregating population 03129 with primer set RDSPRV, showing specific amplification of a 288 bp band from resistant genotypes. R, resistant genotypes; S, susceptible genotypes; DL, DNA size markers (in bp), from top to the bottom, 1 200, 900, 700, 500, 300, and 100, respectively.
candidate fragment linked to the novel R gene locus. To eliminate the non-specific band, primer set RDSPRV was developed based on the specific band of RDSP. Using the designed primer set RDSPRV, a specific fragment (288 bp) was amplified only in the resistant genotypes (Fig. 3-C), and could be a marker linked to the potential novel R gene locus.
DISCUSSION In this study, we report the discovery of a novel resistance gene locus conferring broad-spectrum resistance to P. infestans and the determination of its location on the potato chromosome 4 using NBS profiling. Some late blight resistance genes, such as Rpi-blb3, R2, R2-
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
ZHANG Kun et al.
1666 NS1-1.seq NS1-2.seq NS1-3.seq NS1-4.seq NS1-5.seq NS1-6.seq NS2-3.seq NS2-6.seq NS2-7.seq NS2-8.seq NS2-9.seq NS2-10.seq NS3-1.seq NS3-3.seq NS3-4.seq NS3-6.seq NS3-7.seq NS3-10.seq S1 S1-2.seq S1-3.seq S1-4.seq S2-1.seq S2-2.seq S2-3.seq S2-4.seq S2-5.seq S2-10.seq S3-2.seq S3-3.seq S3-4.seq S3-7.seq S1-5.seq S3-5.seq S3-6.seq Consensus NS1-1.seq NS1-2.seq NS1-3.seq NS1-4.seq NS1-5.seq NS1-6.seq NS2-3.seq NS2-6.seq NS2-7.seq NS2-8.seq NS2-9.seq NS2-10.seq NS3-1.seq NS3-3.seq NS3-4.seq NS3-6.seq NS3-7.seq NS3-10.seq S1 S1-2.seq S1-3.seq S1-4.seq S2-1.seq S2-2.seq S2-3.seq S2-4.seq S2-5.seq S2-10.seq S3-2.seq S3-3.seq S3-4.seq S3-7.seq S1-5.seq S3-5.seq S3-6.seq Consensus catttttgttgg
c gagaag
tcaggat ttgtac a attgcta t aa ttctca agca a
NS1-1.seq NS1-2.seq NS1-3.seq NS1-4.seq NS1-5.seq NS1-6.seq NS2-3.seq NS2-6.seq NS2-7.seq NS2-8.seq NS2-9.seq NS2-10.seq NS3-1.seq NS3-3.seq NS3-4.seq NS3-6.seq NS3-7.seq NS3-10.seq S1 S1-2.seq S1-3.seq S1-4.seq S2-1.seq S2-2.seq S2-3.seq S2-4.seq S2-5.seq S2-10.seq S3-2.seq S3-3.seq S3-4.seq S3-7.seq S1-5.seq S3-5.seq S3-6.seq Consensus tgt tc caag tacaaca a gg tct ct DZ3 ata a t NS1-1.seq NS1-2.seq NS1-3.seq NS1-4.seq NS1-5.seq NS1-6.seq NS2-3.seq NS2-6.seq NS2-7.seq NS2-8.seq NS2-9.seq NS2-10.seq NS3-1.seq NS3-3.seq NS3-4.seq NS3-6.seq NS3-7.seq NS3-10.seq S1 S1-2.seq S1-3.seq S1-4.seq S2-1.seq S2-2.seq S2-3.seq S2-4.seq S2-5.seq S2-10.seq S3-2.seq S3-3.seq S3-4.seq S3-7.seq S1-5.seq S3-5.seq S3-6.seq Consensus aga agaa c tggga gtttgaaa agcattc at gcaa aatggcagcagagt attattaccac
DZ2
DZ4
caaacaggatgtcgctgaaagagcaga
caag aatc
g a a attgaggagaac
a tcc
at
DZ1
c
a t
ag
acac
gat
c tggatat
aa tac tt tggtggt gat atgt t g
162 159 162 171 168 168 156 162 159 162 171 171 171 156 171 162 171 162 153 153 153 153 153 153 153 153 153 153 153 153 153 153 70 162 162 341 338 341 349 347 347 336 341 338 341 350 350 350 336 350 341 350 341 256 256 256 256 256 256 256 256 256 256 256 256 256 256 249 341 341 518 515 518 526 524 524 513 517 515 518 527 527 527 513 530 518 527 518 433 433 433 433 433 433 433 433 433 433 433 433 433 433 426 417 417 621 618 621 629 627 627 616 620 618 621 630 630 630 616 633 621 630 621 536 536 536 536 536 536 536 536 536 536 536 536 536 536 529 520 520
Fig. 4 Multiple sequence alignment of NS and S fragments amplified with primer RDSP. The alignment was generated by DNAMAN using the default parameter. Positions of the four differential zones (DZ1 to DZ4) are indicated by bars above and below the sequences. DZ1 & DZ2 and DZ3 &DZ4 separate one type of S sequence from the other. The single S1-5 was likely produced by sequencing error. The prefixes NS and S refer to none-specific and specific sequences to resistant plants, respectively. Each type are represented with 18 sequences obtained from three resistant genotypes.
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora NS1-3 NS2-8 NS1-1 NS3-6 NS3-10 NS2-6 NS1-2 NS2-7 NS2-3 NS3-3 NS1-4 NS3-1 NS3-4 NS2-9 NS2-10 NS3-7 NS1-5 NS1-6 S2-1 S3-4 S1-4 S1-7 S1-1 S1-5 S3-3 S2-5 Ⅰ S1-3 S3-7 S1-2 S2-2 S3-2 S2-3 S2-4 S2-10 S3-5 S3-6 Ⅱ 1.5
1.0
0.5
0.0
Fig. 5 Phylogenetic analysis of cloned sequences. The unrooted rectangular tree was established on the basis of an optimized multiple-sequence alignment using the MEGA 5.05 software package (bootstrap reps=1 000). The scale down the tree indicates expected number of substitutions per site. The boxed clade shaded in light gray harbors the two types of co-paralogs for the resistance-specific (S) sequences.
like, Rpi-abpt and Rpi-mcd1 from S. bulbocastanum, S. demissum, RHAM026 (various wild Solanum species in its pedigree), ABPT clone (quadruple hybrid of S. acaule, S. bulbocastanum, S. phureja and S. tuberosum) and S. microdontum, respectively, are also located at the same locus but they confer resistance to isolates of limited race combinations. Conclusively, until now there has been no new resistance gene cluster detected in the materials but in the traditional “hot spot” of chromosome 4, which corroborates one theory that the Solanum genome is rather exhaustive and that most resistance gene
1667
clusters are already known (Jacobs et al. 2010). S. demissum is deemed to be the ancestry wild species for late blight resistance breeding. However, after decades of exploration, it seems to have been worn out, leaving its 11 (R1-R11) masterpieces which confer limited resistance to late blight pathogen. There has been no report about R genes from S. demissum capable of conquering P. infestans isolates virulent on all 11 R genes in the differentials. In this research, we discovered such a locus from S. demissum, which may confer broad-spectrum resistance to P. infestans. The resistance-specific fragments produced by NBS profiling showed a 92% sequence identity with R2 gene sequence. The materials showed broad-spectrum resistance, like RB/Rpi-blb1, but they are different from R2, as confirmed by repeated pathogenicity tests with three virulent isolates (race 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11). The identified locus may therefore confers distinct function from that of R2 gene, consistent with the suggestion that new alleles exist at the loci of already known genes (Vleeshouwers et al. 2008). P. infestans evolves very fast due to its mixed reproduction. Deployment of single or several resistance genes in potato has not catched up with evolution potential of the pathogen. It’s therefore urgent for efficient potato late blight control to discover and release new genes, especially the genes with broad-spectrum resistance, so as to artificially create resistance diversity in the field. It is relatively easy for S. demissum to introgress resistance genes into cultivated potatoes by crossing and backcrossing. The discovery and further isolation of this novel broad-spectrum resistance gene locus from S. demissum will facilitate efficient late blight control and understanding of disease resistance to P. infestans.
CONCLUSION A novel disease resistance locus from S. demissum that potentially confers broad-spectrum resistance to late blight pathogen has been identified and a linked molecular marker developed in this study. The results will be useful to breed for disease resistance in potato to P. infestans by marker assisted approach and to the understanding of disease resistance mechanisms by further cloning of the gene locus.
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
ZHANG Kun et al.
1668
The hexaploid S. demissum population (Code 03129) contains 50 seeds, which were introduced from NRSP-6 (United States Potato Genebank, Sturgeon Bay, US). The seeds were sown in the pot in 2003 and 21 plants containing 18 resistant and 3 susceptible genotypes were routinely maintained.
on the abaxial side. The detached leaves were incubated in the artificial climate box with the 16/8 h photoperiod and 15°C constant temperature. The phenotypes were determined at six days post inoculation and the evaluation criteria were in accordance with that described by van der Lee et al. 2001, being classified from the deadly susceptible (rank 1) to the most resistant (rank 5) phenotypes. Potato cultivar Desiree and somatic hybrid RB-3 line containing broad-spectrum resistance gene RB (kindly provided by Professor Jiming Jiang, University of Wisconsin, Madison, USA) were included as susceptible and resistant controls, respectively.
P. infestans isolates and pathogenicity assay
DNA isolation and NBS profiling
Twelve P.infestans isolates (Table 2) including three aggressive ones (S08-02, CN152 and NL10147) were used in detached leaf assays as described (Vleeshouwers et al. 1999). The isolates were activated on fresh Rye B medium and spores were washed off to prepare a spore suspension in large tubes after 7-10 days. Then the suspension was incubated at 4°C for 3-5 h to release the zoospore and the inoculum concentration was adjusted to 5×104 zoospores mL-1. For disease testing, the third or fourth fully-expanded leaves counted from the top were detached from 8-10 weeks old plants and placed into water-saturated florists foam through petioles. Nine leaflets of three compound leaves from three different replicate plants per genotype were inoculated with 10 µL zoospore suspension
Genomic DNA from plants grown in a greenhouse was isolated as described previously (van der Beek et al. 1992). The resistant and susceptible bulks (BR and BS) were constructed from 7 resistant and all the 3 susceptible genotypes from population 03129, respectively. DNA samples were pooled in equal amounts to form the bulks. NBS profiling procedure was as described (Wang et al. 2008) and modified by van der Linden et al. (2004) (personal communication with Prof. Ben Vosman). The modifications were as follows: polyacrylamide gels were silver stained instead of autoradiography, resulting in the difference of the second round PCR reaction: a 0.1 µmol L-1: 0.2 µmol L-1 final concentration ratio between NBS-specific primer and adapter primer. Totally, five NBS-specific primers targeting different parts of the conservative sequence of NBS regions (Table 3) and four restriction enzymes (AluⅠ, Hae Ⅲ, MseⅠand RsaⅠ) were chosen (Jacobs et al. 2010), accounting to 20 primerenzyme combinations. The first round of NBS profiling was performed on BR and BS to determine which combination worked. The second round NBS profiling was performed on both bulks and individuals which constituted the bulks.
MATERIALS AND METHODS Plant materials
Table 2 P. infestans isolates used in late blight resistance evaluation Isolate M08-04 M08-09 HK06-09 HK06-21 HK06-59 JW07-14 JW07-38 JW07-43 I08-01 S08-02 CN152 NL10147
Collecting location Fujian, China Fujian, China Heilongjiang, China Heilongjiang, China Heilongjiang, China Hebei, China Hebei, China Hebei, China Inner Mongolia, China Sichuan, China China Netherlands
Mating type Race ND 6, 8, 11 ND 3, 4, 10 A1 3, 4, 7, 9 A1 2, 3, 4, 9, 10 A1 3, 4, 6, 9, 11 A1 3, 4, 6, 8, 10, 11 A1 2, 3, 4, 6, 8, 10 A1 1, 3, 4, 9, 10 ND 3, 4, 6, 8, 9, 10, 11 ND 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 A2 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 A2 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
Sequencing and analysis of NBS fragments Bands that were present in both resistant bulk and individuals were excised with a sharp razor blade, eluted in 100 µL TE
Table 3 Overview of primers used in this study Primers NBS1 NBS2 NBS3 NBS5a6 NBS9 Th21 RDSP RDSP
RV
Sequences GCIARWGTWGTYTTICCYRAICC GTWGTYTTICCYRAICCISSCAT GTWGTYTTICCYRAICCISSCATICC YYTKRTHGTMITKGATGAYRTITGG TGTGGAGGRTTACCTCTAGC F: ATTCAAAATTCTAGTTCCGCC R: AACGGCAAAAAAGCACCAC F: TGTTGCCGAGGAGATCCAATCACT R: TCTGCTCTTTCAGCGACATCCTGT F: CTCAACTTCTCAAAGCACAAGTCCT R: TTCTTGCTATCTGGGAATGCTCT
Temperature (°C) 55 60 60 55 55
Fragment length (bp)
References Mantovani et al. (2006) van der Linden et al. (2004) Wang et al. (2008) Brugmans et al. (2008) Wang et al. (2008) Park et al. (2005)
48 58
621
Designed in this paper
68
288
Designed in this paper
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora
buffer for 10 min at 100°C and then centrifuged at 13 200×g for 5 min. The resulting supernatant was used as template for the re-amplification with the NBS-specific and the adapter primers. The PCR condition was identical to the first step of NBS profiling. PCR products were examined on agarose gels and purified with QIAquick spin columns (Qiagen Benelux, The Netherlands). Fragments were cloned into the pGM-T vector (TIANGEN Biotech (Beijing) Co.,Ltd., China) according to the manufacturer’s manual, and the resulting plasmid was transformed into E. coli Top 10 (TIANGEN). Twelve positive colonies per fragment, confirmed by colony PCR with universal primers T7 and SP6, were chosen randomly for sequencing using the ABI 3730 automatic sequencer. All the sequences were analyzed with DNASTAR modules (Burland 2000). The adapter-adapter sequences were discarded, leaving only the adapter-primer ones. The potential RGA sequences were analyzed with BLASTn to NCBI GenBank (http://www. ncbi.nlm.nih.gov/) and PGSC database (http://potatogenomics. plantbiology.msu.edu/blast.html) using the discontinuous megablast option of the BLASTn suite (Altschul et al. 1997).
Chromosome position validation of the gene locus The chromosomal position of the gene locus was preliminarily determined by the BLAST search against the potato genome sequence. To further verify the chromosome position of the gene locus, the chromosome-specific SCAR marker Th21 was used to screen the segregating population using PCR procedure (Hein et al. 2007; Jacobs et al. 2010; Lokossou et al. 2009; Park et al. 2005). The 10 µL PCR reaction mix included: 10 ng genomic DNA, 1× PCR buffer, 500 µmol L-1 dNTP each, 0.2 µmol L-1 of each primer and 0.5 U Taq polymerase (TIANGEN, China). The PCR condition was: 3 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 48°C and 1 min at 72°C with a 10-min final elongation step at 72°C. The band pattern was examined on 1.5% agarose gel with 5 V cm-1 voltage for 30 min. Furthermore, based on the sequences (GenBank accession No. FJ536325) with max hit in NCBI database, primer set RDSP (Table 3) was designed to specifically amplify the potential gene fragments that were verified for their map positions. In a 10-µL reaction system, approximately 5 ng genomic DNA, 1× PCR buffer, 500 µmol L-1 dNTP each, 0.4 /0.3 µmol L-1 of each primer, 0.5 U Taq polymerase were mixed and the following PCR condition was executed in Applied Biosystems: 3 min at 95°C, 35 cycles of 30 s at 95°C, 30 s at 62°C/58°C and 50 s at 72°C, with a final extention of 10 min at 72°C. After agarose electrophoresis, the two bands (621 bp and 536 bp) were excised, cloned and sequenced, respectively. Similar to the sequencing of fragments obtained from NBS profiling described above, six positive clones per band from three random resistant genotypes were sequenced. Eighteen sequences were obtained and analyzed with DNASTAR
1669
modules. Although a resistance-specific band was amplified by primer set RDSP, there was also a non-specific band present in both resistant and susceptible genotypes. Based on the fragment sequences, primer set RDSPRV (Table 3) was further designed to target the RD locus. The PCR conditions for the RDSPRV were : 40 ng genomic DNA, 0.4 µmol L-1 of each primer, 1× PCR buffer, 500 µmol L-1 dNTP each and 0.5 U Taq polymerase (TIANGEN, China), in a total volume of 10 µL. The following PCR program was used: 5 min at 94°C followed by 32 cycles of 30 s at 94°C, 30 s at 68°C, 30 s at 72°C, and a final elongation of 7 min at 72°C.
Acknowledgments
This project was supported by the Key Laboratory of Biology and Genetic Improvement of Tuber and Root Crop, Ministry of Agriculture, P.R.China and funded by the National Natural Science Foundation of China (NSFC, 31000738). We thank Dr Huang Sanwen and Li Ying from Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences for kindly providing the isolates CN152 and NL10147, Prof. Zhu Jiehua from Agricultural University of Hebei, China, for disease test with isolate S08-02. We are grateful for the patient personal communication for the NBS profiling operation from Prof. Ben Vosman of Wageningen University, the Netherlands and Prof. Nie Xianzhou from Agriculture and Agri-Food Canada (AAFC) and Xiong Xingyao from Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences for critically reading the manuscript.
References
Altschul S F, Madden T L, Schaffer A A, Zhang J, Zhang Z, Miller W, Lipman D J. 1997. Gapped BLAST and PSIBLAST: A new generation of protein database search programs. Nucleic Acids Research, 25, 3389-3402. Ballvora A, Ercolano M R, Weiss J, Meksem K, Bormann C A, Oberhagemann P, Salamini F, Gebhardt C. 2002. The R1 gene for potato resistance to late blight (Phytophthora infestans) belongs to the leucine zipper/NBS/LRR class of plant resistance genes. The Plant Journal, 30, 361-371. van der Beek J G, Verkerk R, Zabel P, Lindhout P. 1992. Mapping strategy for resistance genes in tomato based on RFLPs between cultivars: Cf9 (resistance to Cladosporium fulvum) on chromosome 1. Theoretical and Applied Genetics, 84, 106-112. Bhaskar P B, Venkateshwaran M, Wu L, Ane J M, Jiang J. 2009. Agrobacterium-mediated transient gene expression and silencing: a rapid tool for functional gene assay in potato. PLoS One, 4, e5812. Bradshaw J E, Bryan G J, Lees A K, McLean K, SolomonBlackburn R M. 2006. Mapping the R10 and R11 genes for resistance to late blight (Phytophthora infestans) present in the potato (Solanum tuberosum) R-gene differentials of
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
1670
black. Theoretical and Applied Genetics, 112, 744-751. Brugmans B, Wouters D, van Os H, Hutten R, van der Linden G, Visser R G, van Eck H J, van der Vossen E A. 2008. Genetic mapping and transcription analyses of resistance gene loci in potato using NBS profiling. Theoretical and Applied Genetics, 117, 1379-1388. Burland T G. 2000. DNASTAR’s Lasergene sequence analysis software. In: Bioinformatics Methods and Protocols, Humana Press, USA. pp. 71-91. Colton L M, Groza H I, Wielgus S M, Jiang J. 2006. Markerassisted selection for the broad-spectrum potato late blight resistance conferred by gene RB derived from a wild potato species. Crop Science, 46, 589-594. EI-Kharbotly A, Palomino-Sfinchez C, Salamini F, Jacobsen E, Gebhardt C. 1996. R6 and R7 alleles of potato conferring race-specific resistance to Phytophthora infestans (Mont.) de Bary identified genetic loci clustering with the R3 locus on chromosome XI. Theoretical and Applied Genetics, 92, 880-884. Gebhardt C, Ballvora A, Walkemeier B, Oberhagemann P, Schüler K. 2004. Assessing genetic potential in germplasm collections of crop plants by marker-trait association: a case study for potatoes with quantitative variation of resistance to late blight and maturity type. Molecular Breeding, 13, 93-102. Haverkort A J, Struik P C, Visser R G F, Jacobsen E. 2009. Applied biotechnology to combat late blight in potato caused by Phytophthora infestans. Potato Research, 52, 249-264. Hein I, McLean K, Chalhoub B, Bryan G J. 2007. Generation and screening of a BAC library from a diploid potato clone to unravel durable late blight resistance on linkage group IV. International Journal of Plant Genomics. doi: 10.1155/2007/51421. Huang S, Vleeshouwers V G, Werij J S, Hutten R C, van Eck H J, Visser R G, Jacobsen E. 2004. The R3 resistance to Phytophthora infestans in potato is conferred by two closely linked R genes with distinct specificities. Molecular Plant-Microbe Interactions, 17, 428-435. Huang S, van der Vossen E A, Kuang H, Vleeshouwers V G, Zhang N, Borm T J, van Eck H J, Baker B, Jacobsen E, Visser R G. 2005. Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato. The Plant Journal, 42, 251-261. Jacobs M M, Vosman B, Vleeshouwers V G, Visser R G, Henken B, van den Berg R G. 2010. A novel approach to locate Phytophthora infestans resistance genes on the potato genetic map. Theoretical and Applied Genetics, 120, 785-796. Jo K R, Arens M, Kim T Y, Jongsma M A, Visser R G, Jacobsen E, Vossen J H. 2011. Mapping of the S. demissum late blight resistance gene R8 to a new locus on chromosome IX. Theoretical and Applied Genetics, 123, 1331-1340. Kamoun S. 2001. Nonhost resistance to Phytophthora: Novel
ZHANG Kun et al.
prospects for a classical problem. Current Opinion in Plant Biology, 4, 295-300. van der Lee T, Testa A, van ‘t Klooster J, van den BergVelthuis G, Govers F. 2001. Chromosomal deletion in isolates of Phytophthora infestans correlates with virulence on R3, R10, and R11 potato lines. Molecular Plant-Microbe Interactions, 14, 1444-1452. Leonards-Schippers C, Gieffers W, Salamini F, Gebhardt C. 1992. The R1 gene conferring race-specific resistance to Phytophthora infestans in potato is located on potato chromosome V. Molecular and General Genetics MGG, 233, 278-283. Li G, Huang S, Guo X, Li Y, Yang Y, Guo Z, Kuang H, Rietman H, Bergervoet M, Vleeshouwers V G, van der Vossen E A, Qu D, Visser R G, Jacobsen E, Vossen J H. 2011. Cloning and characterization of r3b; members of the r3 superfamily of late blight resistance genes show sequence and functional divergence. Molecular PlantMicrobe Interactions, 24, 1132-1142. van der Linden C G, Wouters D C, Mihalka V, Kochieva E Z, Smulders M J, Vosman B. 2004. Efficient targeting of plant disease resistance loci using NBS profiling. Theoretical and Applied Genetics, 109, 384-393. Li X, van Eck H J, van der Voort J R, Huigen D J, Stam P, Jacobsen E. 1998. Autotetraploids and genetic mapping using common AFLP markers: The R2 allele conferring resistance to Phytophthora infestans mapped on potato chromosome 4. Theoretical and Applied Genetics, 96, 1121-1128. Lokossou A A, Park T H, van Arkel G, Arens M, Ruyter-Spira C, Morales J, Whisson S C, Birch P R, Visser R G, Jacobsen E, van der Vossen E A. 2009. Exploiting knowledge of R/ Avr genes to rapidly clone a new LZ-NBS-LRR family of late blight resistance genes from potato linkage group IV. Molecular Plant-Microbe Interactions, 22, 630-641. Mantovani P, van der Linden G, Maccaferri M, Danguineti MC, Tuberosa R. 2006. Nucleotide-binding site (NBS) profiling of genetic diversity in durum wheat. Genome, 49, 1473-1480. Martin G B, Bogdanove A J, Sessa G. 2003. Understanding the functions of plant disease resistance proteins. Annual Review of Plant Biology, 54, 23-61. McDonald B A, Linde C. 2002. Pathogen population genetics, evolutionary potential, and durable resistance. Annual Review of Phytopathology, 40, 349-379. Palhares A C, Rodrigues-Morais T B, van Sluys M A, Domingues D S, Maccheroni W, Jordao H, Souza A P, Marconi T G, Mollinari M, Gazaffi R, van der Vossen E A, Qu D, Visser R G, Jacobsen E, Vossen J H. 2012. A novel linkage map of sugarcane with evidence for clustering of retrotransposon-based markers. BMC Genetics, 13, 51. Park T H, Gros J, Sikkema A, Vleeshouwers V G, Muskens M, Allefs S, Jacobsen E, Visser R G, van der Vossen E A. 2005. The late blight resistance locus Rpi-bib3 from Solanum bulbocastanum belongs to a major late blight R
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.
NBS Profiling Identifies Potential Novel Locus from Solanum demissum That Confers Broad-Spectrum Resistance to Phytophthora
gene cluster on chromosome 4 of potato. Molecular PlantMicrobe Interactions, 18, 722-729. Song J, Bradeen J M, Naess S K, Raasch J A, Wielgus S M, Haberlach G T, Liu J, Kuang H, Austin-Phillips S, Buell C R, Helgeson J P, Jiang J. 2003. Gene RB cloned from Solanum bulbocastanum confers broad spectrum resistance to potato late blight. Proceedings of the National Academy of Sciences of the United States of America, 100, 91289133. van der Vossen E, Sikkema A, Hekkert B L, Gros J, Stevens P, Muskens M, Wouters D, Pereira A, Stiekema W, Allefs S. 2003. An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato. The Plant Journal, 36, 867-882. van der Vossen E A, Gros J, Sikkema A, Muskens M, Wouters D, Wolters P, Pereira A, Allefs S. 2005. The Rpi-blb2 gene from Solanum bulbocastanum is an Mi-1 gene homolog
1671
conferring broad-spectrum late blight resistance in potato. The Plant Journal, 44, 208-222. Vleeshouwers V G A A, Dooijeweert W, Paul Keizer L C, Sijpkes L, Govers F, Colon L T. 1999. A laboratory assay for Phytophthora infestans resistance in various Solanum species reflects the field situation. European Journal of Plant Pathology, 105, 241-250. Vleeshouwers V G, Rietman H, Krenek P, Champouret N, Young C, Oh S K, Wang M, Bouwmeester K, Vosman B, Visser R G, Evert J, Francine G, Sophien K, van der Vossen E. 2008. Effector genomics accelerates discovery and functional profiling of potato disease resistance and Phytophthora infestans avirulence genes. PLoS One 3, e2875. Wang M, van den Berg R, van der Linden G, Vosman B. 2008. The utility of NBS profiling for plant systematics: A first study in tuber-bearing Solanum species. Plant Systematics and Evolution, 276, 137-148. (Managing editor WENG Ling-yun)
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.