Neohesperidin prevents colorectal tumorigenesis by altering the gut microbiota

Journal Pre-proof Neohesperidin Prevents Colorectal Tumorigenesis by Altering the Gut Microbiota Yanling Gong, Rong Dong, Xiaomeng Gao, Jin Li, Li Jiang, Jiale Zheng, Sunliang Cui, Meidan Ying, Bo Yang, Ji Cao, Qiaojun He

PII:

S1043-6618(19)31054-0

DOI:

https://doi.org/10.1016/j.phrs.2019.104460

Reference:

YPHRS 104460

To appear in:

Pharmacological Research

Received Date:

11 June 2019

Revised Date:

16 September 2019

Accepted Date:

18 September 2019

Please cite this article as: Gong Y, Dong R, Gao X, Li J, Jiang L, Zheng J, Cui S, Ying M, Yang B, Cao J, He Q, Neohesperidin Prevents Colorectal Tumorigenesis by Altering the Gut Microbiota, Pharmacological Research (2019), doi: https://doi.org/10.1016/j.phrs.2019.104460

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Neohesperidin Prevents Colorectal Tumorigenesis by Altering the Gut Microbiota Running title: NHP prevents colorectal tumorigenesis via gut microbiota

Yanling Gong1,#, Rong Dong1,2,#, Xiaomeng Gao1,#,Jin Li1, Li Jiang1, Jiale Zheng1,

ro of

Sunliang Cui3, Meidan Ying1, Bo Yang1, Ji Cao1,* and Qiaojun He 1,*

1

, Institute of Pharmacology and Toxicology, Zhejiang Province Key Laboratory of Anti-

Cancer Drug Research, College of Pharmaceutical Sciences, Zhejiang University,

-p

Hangzhou, China.

, Affiliated Hangzhou First People’s Hospital, Zhejiang University School of Medicine,

re

2

Hangzhou, China.

Institute of Drug Discovery and Design, College of Pharmaceutical Sciences,

lP

3,

na

Zhejiang University, Hangzhou, China.

ur

*, Corresponding authors: Qiaojun He, Room 427, College of Pharmaceutical Sciences, Zhejiang University, Hangzhou, China. Email: [email protected]. Ji Cao,

Jo

Room 115, College of Pharmaceutical Sciences, Zhejiang University, Hangzhou, China. Email: [email protected].

#

, These authors contribute equally to this work.

lP

re

-p

ro of

Graphical abstract

na

Abstract

Neohesperidin (NHP), derived from citrus fruits, has attracted considerable interest due to

ur

its preventative and therapeutic effects on numerous diseases. However, little progress has been made in determining the exact function of NHP on tumorigenesis. In the current

Jo

study, we found that NHP inhibited colorectal tumorigenesis in the APC min/+ transgenic mouse model, as well as inducing apoptosis and blocking angiogenesis in vivo. Our in-cell study suggested that this tumorigenic preventative effect of NHP is not due to the direct impact on tumor cells. Intriguingly, by utilizing 16s rRNA gene-based microbiota sequencing, the relative abundance of Bacteroidetes was decreased, while Firmicutes and

Proteobacteria were increased in the presence of NHP. Additionally, the fecal microbiota transplantation experiment further revealed that feeding with fecal of NHP-treated mice induced considerable inhibition of tumorigenesis, which indicates that the alteration of gut microbiota is responsible for NHP-mediated prevention of colorectal tumorigenesis. Thus, our study not only suggests the efficacy of NHP as a potent natural product for preventing colorectal cancer but also proposes a compelling model to connect the gut microbiota to

ro of

the preventative effect of NHP on tumorigenesis.

Abbreviations

-p

NHP, Neohesperidin; CRC, colorectal cancer; APC, Adenomatosis Polyposis Coli; MMR,

re

DNA mismatch repair; IBD, inflammatory bowel disease; CMC-Na, sodium carboxymethyl cellulose; FMT, fecal microbiota transplantation experiment; SRB, Sulforhodamine B; H&E,

na

lP

hematoxylin and eosin; ROS, Reactive oxygen species

Keywords: Neohesperidin; APC min/+ transgenic mice; Gut microbiota; Colorectal cancer;

Jo

ur

Cancer prevention.

Chemical compounds studied in this article Neohesperidin (PubChem CID: 442439)；5-Fluorouracil (PubChem CID: 3385); Sorafenib (PubChem CID: 216239).

1. Introduction Colorectal cancer (CRC) is the fourth-leading cause of cancer-related deaths worldwide[1]. Although the exact mechanism of causing CRC is not clear in most cases, it is widely accepted that colon carcinogenesis is triggered by the accumulation of both genetic and epigenetic factors[2, 3]. In vivo studies utilizing transgenic mice have shown

ro of

that the initial formation of polyps can occur in response to the loss of tumor-suppressor genes, such as APC (adenomatous polyposis coli), a key component of the Wnt/β-catenin signaling pathway[3, 4], or genes involved in DNA mismatch repair (MMR), such as

-p

MSH2[5, 6]. In addition, studies of large groups of people have shown that a high-fat and

re

low-fiber diet is highly related to the increased risk of CRC[7, 8]. Surgery is the only curative therapy for primary CRC, and adjuvant chemotherapy is usually recommended for patients with

lP

metastases[9]. Despite advances in combined therapy for advanced CRC, only limited

na

survival advantages have been achieved. Given that CRC progresses from adenomas to adenocarcinomas over 5-10 years, it is promising to develop effective strategies for early

ur

prevention and treatment[10].

As CRC requires an extended period of time to convert normal colonic epithelia to

Jo

adenomas, the inflammatory microenvironment may strongly impact CRC development[11]. In patients with inflammatory bowel disease (IBD), the risk of developing CRC is markedly increased[12]. Increasing evidence has indicated a crucial role for the gut microbiota in shaping the inflammatory microenvironment and potentiating tumor growth and metastasis[13, 14]. Gut microbiota metabolites are demonstrated to participate in CRC

development[15]. The absence of the gut microbiota or treatment with antibiotics reduced tumorigenesis in several mouse colitis-associated CRC models[16]. Additionally, modulation of gut microbiota by probiotics and prebiotics would be beneficial in CRC prevention[17]. Notably, cancer therapy agents (5-fluorouracil, cyclophosphamide, methotrexate and ipilimumab) have also been reported to correlate with homeostasis of gut microbiota, which might be involved in their therapeutic effects[18, 19]. Furthermore,

ro of

studies have suggested that food fiber and phytochemicals, such as polyphenols, can impact gut microbial homeostasis and, in turn, mediate disease outcomes[20, 21].

NHP, found in citrus fruits, is a flavanone glycoside with a strong bitter flavor[22]. NHP

-p

has been found to possess a wide range of pharmacological properties, including anti-

re

inflammation, suppression of osteoclast differentiation, cardiovascular protection, ROSscavenging activity and neuroprotective effect[23-25]. In addition, our group also indicated

lP

that NHP exerts lipid and glucose regulating effects[26]. However, little progress has been

na

made in the exact function of NHP on tumorigenesis. In this study, we observed that NHP significantly inhibited colorectal tumorigenesis in the APC min/+ transgenic mouse model.

ur

Interestingly, the gut microbiota of APC min/+ transgenic mice was altered in the presence of NHP, which was also required for the NHP-mediated inhibition of colorectal

Jo

tumorigenesis, as demonstrated by the fecal microbiota transplantation (FMT) experiment. Thus, our study suggests applying the natural product NHP to CRC prevention and illustrates a novel mechanism by which NHP could modulate tumorigenesis.

2. Materials and methods

2.1 Materials NHP was purchased from Sigma-Aldrich (St. Louis, Mo., USA). 5-Fu was purchased from King York (Tianjin, China). Penicillin and streptomycin were purchased from LUKANG PHARMACEUTICAL (Shandong, China). Antibodies against p-β-catenin (#9561), βcatenin (#9587) and CD31 (#77699) were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibodies for c-MYC (sc-40) and Ki67 (sc-15402) were purchased

ro of

from Santa Cruz Biotechnology (CA, USA). Antibodies against GAPDH (db106), PCNA (db3315), and p-histone H3 (db5651) were purchased from Diagbio (Hangzhou, China).

The jetPRIME transfection agent was purchased from Polyplus (114-15, 850 bd Sebastien

-p

Brant 67400 Illkirch FRANCE). Sodium carboxymethyl cellulose was purchased from

re

Aladdin (CA, USA), and the Annexin-FITC kit and Matrigel were purchased from BD

2.2 Animal experiment min/+

mice were purchased from the Model Animal Research Center of

na

C57BL/6J-APC

lP

Bioscience (NH, USA).

Nanjing University (Nanjing, China). The following primers were used for genotyping:

ur

APC (wild-type mice) Forward: 5’-GCCATCCCTTCACGTTAG-3’ APC (APC min/+ mice) Forward: 5’-TTCTGAGAAAGACAGAAGTTA-3’

Jo

APC (for both wild-type and APC min/+ mice) Reverse: 5’-TTCCACTTTGGCATAAGGC-3’. To investigate the effect of NHP on colorectal tumorigenesis, five-week-old APC min/+

mice were pretreated with vehicle or NHP (50 mg kg-1 and 100 mg kg-1, NHP was dissolved by 0.5% sodium carboxymethyl cellulose, CMC-Na) 3 days before the high-fat diet started (45% fat, Xietong organism, Nanjing, China; high-fat diet could accelerate tumorigenesis

progression), and the NHP treatment was maintained for another 12 weeks along with a high-fat diet. Fecal pellets from mice (high-fat control and NHP 100 mg kg-1) were resuspended in phosphate-buffered saline (PBS) (1 fecal pellet/1 ml of PBS). For the fecal microbiota transplantation (FMT) experiment, five-week-old APC

min/+

mice were treated with

antibiotics for one week to destroy the original microbiota and were then treated with PBS

ro of

or fecal suspensions from high-fat diet control mice or NHP (100 mg kg-1)-treated mice or

NHP fecal suspensions combined with NHP (100 mg kg-1) 3 days before the high-fat diet started. The treatment was maintained for another 12 weeks along with a high-fat diet.

-p

Five-week-old APC min/+ mice were pretreated with vehicle or NHP (100 mg kg-1, NHP

re

was dissolved by 0.5% sodium carboxymethyl cellulose, CMC-Na) or NHP along with antibiotics (penicillin:100 mg L-1, streptomycin: 500 mg L-1 ) 3 days before the high-fat diet

lP

started (45% fat, Xietong organism, Nanjing, China; high-fat diet could accelerate

na

tumorigenesis progression), and the treatment was maintained for another 45 days along with a high-fat diet.

ur

Human colon cancer cell SW480 xenografts were established by subcutaneously inoculating 106 cells into Balb/c nude mice on both sides. Mouse colon cancer cell CT26

Jo

xenografts were established by subcutaneously inoculating 5×106 cells into Balb/c mice on both sides. When the tumor volumes reached a mean size of ~100 mm3, the mice were divided into three groups and treated with vehicle (0.5% CMC-Na, i.g.), NHP (100 mg.kg1,

i.g.) and 5-Fu (25 mg.kg-1, i.p.) every day. The animal studies were approved by the Animal Research Committee at Zhejiang

University, and animal care was provided in accordance with institutional guidelines.

2.3 Cell culture The human CRC cell lines HCT116, SW480，mouse CRC cell line CT26 and human umbilical vein endothelial cells (HUVECs) were purchased from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). HUVECs, HCT116 and SW480 cells

ro of

were cultured in DMEM with 10% fetal bovine serum (FBS), and CT26 cells were cultured

in RPMI-1640 with 10% fetal bovine serum (FBS) in a 5% CO2 humidified incubator at 37°C. The cells were monitored for mycoplasma contamination every six months, and the cell

-p

lines used for experiments had been passaged no more than 20 times.

re

2.4 Quantitative PCR assay

Total RNA was extracted from SW480 by the RNAiso plus kit (#9109, TaKaRa) according

lP

to the manufacturer's instructions. Reverse transcription reactions were performed with

na

Transcript one-step gDNA Removal and cDNA Synthesis supermix (#AT311-03, Transgene Biotech Co, Ltd) and analyzed by real-time quantitative PCR with iTaqTM Universal SYBR

ur

Green Supermix (#172-5124, BIO-RAD). The reaction mixtures containing SYBR Green were composed following the manufacturer's protocol. Relative expression levels of the

Jo

target genes were normalized to control gene β-actin. The sequences of the primers used for quantitative real-time PCR were as follows: c-MYC: forward-TTCGGGTAGTGGAAAACCAG reverse- AGTAGAAATACGGCTGCACC CyclinD1: forward- CATCTACACCGACAACTCCATC

reverse- TCTGGCATTTTGGAGAGGAAG MMP7: forward- TTCCAAAGTGGTCACCTACAG reverse- AGTTCCCCATACAACTTTCCTG β-actin: forward-TCACCCACACTGTGCCCATCTACGA reverse-CAGCGGAACCGCTCATTGCCAATGG 2.5 Western blot analysis

ro of

The cell samples were lysed in 2X SDS gel-loading buffer (24 mM Tris-HCl (pH 6.8), 0.02% mercaptoethanol, 4% SDS, 0.4% bromphenol blue, 20% glycerol) and then boiled

at 95°C for 15 minutes. Subsequently, cell lysates were electrophoresed in SDS-PAGE gel

-p

and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA)

re

followed by blocking with milk for 1 h. The blots were then incubated with the indicated primary antibodies overnight at 4°C. The membranes were then incubated with the

lP

appropriate horseradish peroxidase-conjugated secondary antibodies. The signals were

na

visualized by the ECL Plus western blotting detection system (AI600, GE Healthcare). 2.6 Luciferase assay

ur

SW480 cells were seeded into 96-well plates and grown to 70% confluence before transfection. Cells were transfected with plasmid TCF/LEF1-luciferase-pGMTCF (Yeasen,

Jo

China) and renilla luciferase (internal control) by using jetPrime transfection agent according to the manufacturer's instructions. Luciferase activity was measured using the Dual-Luciferase reporter assay system (Promega, Madison, Wis., USA). In this assay, firefly luciferase activity was normalized by renilla luciferase. 2.7 Cell survival assay

Cell proliferation was assessed using the Sulforhodamine B (SRB, #S1402, Sigma). SW480 cells and HCT116 cells were seeded in 96-well plates at a density of 2000/well followed by NHP (25 μM, 50 μM and 100 μM) or 5-FU (5 μM) treatment. Cells were fixed by precooled 10% (w/v) trichloroacetic acid and stained by SRB for 30 minutes, and the excess dye was removed by washing with 1% (v/v) acetic acid five times. The proteinbound dye was dissolved in 10 mM Tris base solution for OD determination at 510 nm

each well was calculated. 2.8 Cell apoptosis assessment by FACS analysis

ro of

using a microplate reader (Multiskan Spectrum, Thermo). The rate of cell proliferation for

-p

Cell apoptosis was assessed by Annexin V-FITC/PI. SW480 cells and HCT116 cells

re

were seeded in 6-well plates at a density of 1.5x105 cells/well followed by NHP (25 μM, 50 μM and 100 μM) or 5-FU (5 μM) treatment for 24 h and 48 h. Cells were harvested and

lP

washed twice with PBS and then incubated with 5 μl Annexin V-FITC and 5 μl PI in the

na

dark for 15 minutes. Then, the samples were analyzed using a FACS Calibur cytometer (Becton Dickinson, San Jose, CA).

ur

2.9 Tube formation assay

A total of 15×104 HUVECs were seeded in 6-well plates followed by NHP (25 μM, 50 μM

Jo

and 100 μM) or Sorafenib (5 μM) treatment for 24 h. A 96-well plate was filled with 100 μl Matrigel and solidified at 37°C. The treated HUVECs (3×104) were seeded in the plate and cultured for 4 h. To observe the formation of tube-like structures, five optical fields per well were randomly chosen and analyzed. 2.10 TUNEL assay

Apoptotic cells were detected in frozen intestinal samples using the One Step TUNEL Apoptosis Assay Kit (Beyotime) according to the manufacturer’s instructions. DAPI was used to stain the nuclei. Images were taken with an inverted fluorescence microscope (Olympus) using appropriate fluorescence filters. We randomly selected five tumor sections for TUNEL detection, and TUNEL-positive cells were counted in images. 2.11 Hematoxylin/eosin (H&E) and immunohistochemical staining

ro of

Tissues were fixed in 4% formaldehyde and embedded in paraffin. Then, 4-μm sections were used for hematoxylin/eosin (H&E) staining and immunohistochemistry staining. H&E staining was carried out as previously described[27]. For immunohistochemistry staining,

-p

the sections were soaked in EDTA buffer (pH 9.0) and heated three times followed by

re

incubation with 3% H2O2 for 10 minutes to block the endogenous peroxidases. After washing with PBS, the sections were blocked with PBS containing 5% goat serum and 0.3%

lP

Triton X-100 for 30 minutes and then incubated with primary antibodies Ki67 (dilution 1:50, sc-15402), PCNA (dilution 1:50, db3315), p-Histone H3 (dilution 1:50, db5651), β-catenin

na

（dilution 1:100，#9587）and CD31 (dilution 1:100, #77699) overnight at 4°C followed by

ur

incubation with HRP-conjugated secondary antibody for 1 h at room temperature. Then, the sections were stained using an automated immunostainer with a DAB detection kit

Jo

according to the company's protocols. We randomly selected five tumor sections for detection. Expression scores of proteins were analyzed by Image-Pro Plus 6.0. 2.12 16s rRNA gene-based microbiota sequencing Microbial genomic DNA was extracted from feces using a QIAGEN QIAmp Fast DNA Stool Mini Kit according to the manufacturer’s instructions. Five samples from each group,

including the high-fat group, NHP (50 mg kg-1), and NHP (100 mg kg-1), were sent to LCBio Technologies (Hangzhou) for 16s rRNA gene-based microbiota sequencing. 2.13 Statistical analysis Values are presented as the means ± standard deviation (SD). Two-tailed and unpaired Student’s t tests and one-way ANOVA were used for statistical analysis, and differences

ro of

were considered to be significant for p-values less than 0.05.

3. Results

3.1 NHP treatment prevents colorectal tumorigenesis in APC min/+ mice.

-p

The APC Min/+ mouse is a well-established animal model of adenomatous polyposis that

re

spontaneously develops multiple polyps in the whole intestine, and a high-fat diet could accelerate this progression[28]. To investigate the effect of NHP, (chemical structure is

lP

shown in Fig. 1A) on colorectal tumorigenesis, five-week-old APC

min/+

mice were

na

pretreated with vehicle or NHP of 50 mg kg-1 and 100 mg kg-1 (the dosage chosen based on previous report[26]) 3 days before the high-fat diet started. Then, the NHP treatment was

ur

maintained for another 12 weeks along with a high-fat diet (Fig. 1B). As expected, the highfat diet group substantially promoted tumorigenesis compared to the normal diet group (Fig.

Jo

1C). Meanwhile, the tumor number in the whole intestine was significantly reduced in the NHP treatment groups (50 mg kg-1 and 100 mg kg-1) compared to the high-fat diet vehicle control (Fig. 1C and 1D) without affecting the body weight (Fig. 1E) and organ weight (Fig. S1) of the mice. Histological H&E staining suggested that compared to the normal diet group, crypts of the high fat diet group were dysplastic, and developed adenomas

appeared with nuclear hyperchromasia and increased nucleus-to-cytoplasmic ratios, which were considerably improved in the NHP-treated groups (Fig. 1F). Next, we were interested in asking how NHP exhibited a prevention effect on colorectal tumorigenesis and mainly focused on three aspects: apoptotic death induction, proliferation, and angiogenesis. To evaluate the effect of NHP on apoptotic death induction, we deciphered the tumor tissues from the mouse intestine of the high-fat vehicle control group

ro of

and the NHP treatment (100 mg kg-1) group and subsequently performed TUNEL staining. As shown in Fig. 2A, few TUNEL-positive cells were detected in the high-fat diet vehicle

control group, while significantly more TUNEL-positive cells were observed in the NHP-

-p

treated group, suggesting the involvement of apoptosis induction in the NHP-mediated

re

prevention effect.

To test the effect of NHP on tumor proliferation, immunohistochemistry analysis of

lP

several markers for proliferating cells (Ki67, PCDA and p-Histone H3) was performed. As

na

shown in Fig. 2B-D, we detected the strong expression of these proliferation markers in tumor tissues of both the high-fat vehicle control group and the NHP treatment (100 mg kggroup. Quantification analysis suggested that there was no significant difference in the

ur

1)

expression of Ki67, PCNA and p-histone H3 between the control and NHP treatment

Jo

groups, implying that NHP did not impact tumor cell proliferation in vivo. Notably, CD31 staining, a biomarker of angiogenesis, revealed that tumor vessel density was considerably reduced in tumor tissues treated with NHP (Fig. 2E). Taken together, these results further suggest that NHP remarkably prevents colorectal tumorigenesis in APC inducing tumor apoptosis and inhibiting angiogenesis in vivo.

Min/+

mice by

3.2 Tumorigenic preventative effect of NHP is independent of its direct impact on tumor cells. Encouraged by the observations made concerning the apoptosis induction effect triggered by NHP in vivo (Fig. 2A) and a previous report suggesting the direct effect of NHP on human hepatoma cells in vitro[29], we next assessed the effect of NHP on two colorectal

ro of

tumor cell lines (HCT116 and SW480). Surprisingly, no significant effect on cell growth and

apoptosis induction was detected after treatment with NHP in both cell lines. Meanwhile, 5-Fu, set as a positive control, dramatically inhibited cell proliferation (Fig. 3A) and induced

-p

cell apoptosis in both cell lines (Fig. 3B-E). Since the highest concentration of NHP used

re

in our in-cell experiments was 100 µM, which is considerably higher than the well-accepted IC 50 of cytotoxic agents (the IC 50 concentration of cytotoxic agents is normally less than

lP

10 µM), our in-cell studies suggested there was no cytotoxicity of NHP on tumor cells. In

na

order to further confirm this, we established SW480 (APC-mutant) xenografts in Balb/c nude mice (immunodeficiency) and CT26 xenografts in Balb/c mice (immunocompetent),

ur

and investigated the in vivo efficacy of NHP. As presented in Fig S2 and Fig S3, NHP had no influence on tumor growth, while 5-Fu significantly inhibited tumor growth, suggesting

Jo

that NHP had no direct effect on tumor growth in vivo. Next, we asked whether NHP directly affects the angiogenesis process based on our

ex vivo results (Fig. 2E). We performed a tube formation assay to evaluate the effect of NHP on angiogenesis in vitro by applying the HUVEC cells. As shown in Fig. 3F and 3G, no significant difference was found between the control group and NHP-treated groups,

suggesting NHP had no direct effect on angiogenesis in vitro. APC min/+ mice are predisposed to intestinal adenoma formation for mutations in APC, leading to aberrant Wnt/β-catenin signaling, which is known to contribute to CRC development[3, 28]. Therefore, we next assessed whether the Wnt/β-catenin signaling pathway was involved in NHP-mediated prevention of tumorigenesis. First, the colorectal tumor cell line SW480 (APC-mutant) was treated with gradient concentrations of NHP, and

ro of

we subsequently evaluated β-catenin phosphorylation, β-catenin expression and downstream c-MYC expression. As shown in Fig. 4A and Fig S4, no significant changes were observed in the β-catenin phosphorylation, β-catenin expression and downstream c-

-p

MYC expression. Furthermore, we carried out a TCF/LEF1 luciferase reporter assay and

re

investigated Wnt/β-catenin downstream genes by quantitative PCR. The results showed that β-catenin transcriptional activity was not influenced by NHP (Fig. 4B and 4C).

lP

Moreover, IHC staining of β-catenin in tumor tissues from APC

Min/+

mice also suggested

na

that no significant changes in β-catenin were observed in the NHP treatment group (Fig. 4D and 4E). Taken together, these results further implied that the Wnt/β-catenin pathway

ur

was not involved in NHP-mediated prevention of tumorigenesis.

Jo

3.3 Alteration of gut microbiota contributes to NHP-mediated prevention of tumorigenesis. Increasing evidence has revealed an essential role of gut microbiota in cancer development, especially in CRC[3, 30]. We next investigated whether gut microbiota was involved in NHP-mediated prevention of tumorigenesis. To examine the gut microbiota

alteration upon NHP treatment in APC

Min/+

mice, we collected fecal samples from mice

(high-fat control, NHP 50 mg kg-1 and NHP 100 mg kg-1), and 16s rRNA gene-based microbiota sequencing was performed on the fecal DNA followed by analysis of diversity and composition of gut microbiota. As shown in Fig. 5A, the major phyla contents of the feces were Bacteroidetes, Firmicutes and Proteobacteria. NHP treatment significantly decreased the relative abundance of Bacteroidetes, while the relative abundance of and

Proteobacteria

was

increased

(Fig.

5B-5D).

Additionally,

the

ro of

Firmicutes

Bacteroidetes/Firmicutes ratio was reduced (Fig. 5E), suggesting that the composition of gut microbiota was influenced by NHP. Further pyrosequencing analysis (Fig. 5F) revealed

-p

that NHP altered the gut microbiota at the species level. As shown in Fig. 5G-5J, compared

re

to the high-fat control group, NHP-treated mice showed a remarkable decrease in the relative abundance of Bacteroidetes Becteroidaceae, while Firmicutes Lachnospiraceae

lP

and Proteobacteria Helicobacteraceae were observed to be significantly increased. Taken

na

together, these data indicated that the gut microbiota was significantly altered after treatment with NHP, implying an essential role for the gut microbiota.

ur

To elucidate the role of gut microbiota involved in NHP-mediated prevention of colorectal tumorigenesis, we performed an FMT experiment. As illustrated in Fig. 6A, five-week-old

Jo

APC min/+ mice were treated with antibiotics for one week to destroy the original microbiota followed by pre-treatment with PBS or fecal matter from high-fat diet control mice or mice treated with NHP (100 mg kg-1) or NHP FMT combined with NHP (100 mg kg-1) 3 days before the high-fat diet started. Interestingly, the tumor number of high fat control group was similar to the high fat FMT group, and compared with the high-fat FMT group, NHP

FMT dramatically inhibited tumor formation, and no further inhibition was found in the group treated with extra NHP (Fig. 6B and 6C), and the body weights were not influenced (Fig. 6D). To further investigate the effect of microbiota alteration on apoptotic death induction and angiogenesis, we performed TUNEL staining and CD31 staining. As shown in Fig. 6E and 6F, increased TUNEL-positive cells were observed in the NHP FMT group compared to the HF control, and no further promotion was found in the group treated with extra NHP.

ro of

CD31 staining revealed that tumor vessel density was remarkably reduced in tumor tissues of the NHP FMT group and NHP FMT+ NHP group (Fig. 6G and 6H), and there was no

significant difference between the NHP FMT group and the NHP FMT+ NHP group. Thus,

-p

these results suggested that altering the gut microbiota contributed to the prevention of

re

intestinal tumorigenesis by NHP.

Furthermore, we treated the APC min/+ mice with NHP and antibiotics together to see if

lP

NHP still work the same way without the participation of gut microbiota, and the illustration

na

of the experiment was shown in Fig. S5A. Of note, in line with the result in Fig. 1, tumor number was remarkably reduced in NHP group. However, when treated with NHP and

ur

antibiotics together, the inhibition caused by NHP was abolished (Fig. S5B-D). TUNEL staining (Fig. S5E and S5F) and CD31 staining (Fig. S5G and S5H) further indicated that

Jo

NHP-mediated apoptosis induction and angiogenesis inhibition were reversed by antibiotics treatment, suggesting the key role that gut microbiota in NHP-mediated tumorigenesis.

4. Discussion

Despite the significant advances in CRC, current treatments still rely mostly on surgery, conventional chemotherapy and combined therapy, displaying limited therapy benefit[9, 31]. Since CRC develops over five stages with morphological and molecular changes, polyps cannot be detected in early stages[10, 32]. Therefore, chemoprevention as an effort to treat and prevent CRC is a promising approach. NHP is a flavanone glycoside derived from citrus fruits. Citrus flavonoids are the main effective ingredients of citrus species[23,

ro of

33, 34], and previous research has demonstrated various pharmacological properties of

citrus flavonoids, including anticancer, anti-inflammation, and neuroprotective activity[23-

25]. Many studies have revealed the promising potential of citrus flavonoids as

-p

chemopreventive agents for their antioxidant activity, suppression of carcinogenesis and

re

effect on cell cycle regulation[9, 35]. In this study, we revealed that NHP dramatically inhibited colorectal tumor formation in APC min/+ transgenic mice, providing evidence for its

lP

chemopreventive effect on CRC. In addition, NHP is derived from natural plants and

na

appears to be nontoxic to humans and animals, thereby exhibiting strong potential to be developed as a chemopreventive agent for cancer therapy.

ur

Given the promising preventive effect of NHP on CRC, it will be interesting to ask whether NHP still work when the treatment starts at a stage that the tumors reach a specific

Jo

size, which will help to translate our finding to clinical usage. Though we hasn’t directly tested this effect，we notice that not only the number of tumors but also the size of tumors was significantly decreased in groups treated with NHP, providing the clues that NHP might also display therapeutic effect on CRC, which was worth further studying in future. NHP has been reported to inhibit human hepatoma cell proliferation and induce

cellular apoptosis in human breast cancer MDA-MB-231[29, 36]. However, in our study, NHP had no influence on the proliferation and apoptosis of CRC cells (SW480) in vitro. We also tested other cell lines, including MDA-MB-231 and human hepatoma cell lines, such as HepG2 and Bel-7402, and no cytotoxicity or growth inhibition was observed in these cell lines following treatment with 100 µM NHP (data not shown). Thus, the difference in these in-cell results cannot be simply attributed to cell line specificity. We notice that the

ro of

effective concentration of NHP used in a previous report is 100 µM, which is considerably higher than the well-accepted IC 50 of cytotoxic agents (the IC 50 concentration of cytotoxic agents is normally less than 10 µM). This finding raises the concern that this cytotoxic

-p

concentration can be achieved in vivo. And our in vivo SW480 (APC mutated) xenografts

re

in Balb/c nude mice and CT26 xenografts in Balb/c mice further confirmed that NHP had no influence on the tumor growth. Since it promoted apoptosis in the tumor section of APC transgenic mice, our results suggested that NHP might not display direct tumor

lP

min/+

na

cytotoxicity but might inhibit CRC development by influencing the tumor environment. Increasing evidence has demonstrated the essential role of gut microbiota in

ur

carcinogenesis in recent decades, and microbes are suspected to be involved in approximately 20% of cancers, especially CRC[30, 37]. Current theories to explain the

Jo

impact of bacteria on CRC are mainly generalized as follows: one hypothesis suggests that microbial communities with pro-carcinogenic features are capable of remodeling the microbiome to drive pro-inflammatory responses and epithelial cell transformation, leading to carcinogenesis, and the other hypothesis is the “driver-passenger” theory, wherein intestinal bacteria, termed “bacteria drivers”, initiate CRC by inducing epithelial DNA

damage and carcinogenesis, thereby promoting the proliferation of passenger bacteria that have a growth advantage in the tumoral microenvironment[38, 39]. The human gut microbiota is dominated by 3 primary phyla: Firmicutes (30%-50%), Bacteroidetes (20%40%) and Actinobacteria (1%-10%)[14]. Disturbances of the gut microbiota regarding either its diversity or its abundance have been found to be closely related to CRC[30]. At the phylum level, increased abundance of Bacteroidetes and decreased abundance of

ro of

Firmicutes and Proteobacteria have been reported to play a role in colorectal

carcinogenesis[40-42]. Our study showed that NHP caused a decrease in Bacteroidetes accompanied by an increase in Firmicutes and Proteobacteria. The ratios of

-p

Bacteroidetes/Firmicutes and Bacteroidetes/Proteobacteria were also decreased. These

re

results suggested that NHP might prevent CRC by gut microbiota. Further experiments suggested that fecal transplantation from APC

min/+

transgenic mice could significantly

lP

reduce tumor numbers. Furthermore, we treated the APC

min/+

mice with NHP and

na

antibiotics together to see if NHP still work the same way without the participation of gut microbiota. And the results showed that the inhibition caused by NHP was abolished when

ur

treated with NHP and antibiotics together. Taken together, these data revealed that gut microbiota accounted for tumor prevention by NHP.

Jo

Mechanisms involved in gut microbiota-mediated colorectal carcinogenesis include

bacterial-derived genotoxins and metabolism, the modulation of host defenses and inflammation pathways, and antioxidative defense regulation[43-45]. Reactive oxygen species (ROS) induction seems to play an essential role in microbiota-driven cancer. H. pylori has been reported to promote gastric carcinogenesis via the induction of oxidative

stress[46]. Since NHP has been demonstrated to be a strong antioxidant with ROSscavenging activity, it could thus be extrapolated that NHP prevented colorectal tumorigenesis through its ROS-scavenging activity, which should be investigated in future studies. In conclusion, for the first time, we revealed that NHP markedly inhibited colorectal tumorigenesis, which might be mediated by alterations of gut microbiota, indicating new

ro of

insights into the chemopreventive effect and possible mechanism of NHP. Notably, because citrus flavonoids share similar pharmacological properties, this work may provide

-p

evidence and potential to develop more chemopreventive agents for CRC therapy.

re

Financial support: This work was supported by grants from the National Natural Science Foundation of China (No.81872885 to Ji Cao, No.81625024 and

lP

No.91529304 to Bo Yang), Zhejiang Provincial Natural Science Foundation

na

(No.LY18H310001 to Ji Cao), and the Talent Project of Zhejiang Association for Science and Technology (No.2018YCGC002 to Ji Cao)

ur

Conflict of interest

Jo

No conflict of interest exists in the submission of this manuscript.

Acknowledgment

This work was supported by grants from the National Natural Science Foundation of China (No.81872885 to Ji Cao, No.81625024 and No.91529304 to Bo Yang), Zhejiang Provincial Natural Science Foundation (No.LY18H310001 to Ji Cao), and the Talent

Project of Zhejiang Association for Science and Technology (No.2018YCGC002 to Ji Cao)

References [1] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA: A Cancer Journal for Clinicians 68(6) (2018) 394-424.

ro of

[2] J.C. Obuch, D.J. Ahnen, Colorectal Cancer: Genetics is Changing Everything, Gastroenterology Clinics of North America 45(3) (2016) 459-476.

[3] C.A. Brennan, W.S. Garrett, Gut Microbiota, Inflammation, and Colorectal Cancer, Annu Rev Microbiol 70 (2016) 395-411.

[4] T. Senda, A. Iizuka-Kogo, T. Onouchi, A. Shimomura, Adenomatous polyposis coli (APC)

-p

plays multiple roles in the intestinal and colorectal epithelia, Medical Molecular Morphology 40(2) (2007) 68-81.

[5] G. Poulogiannis, I.M. Frayling, M.J. Arends, DNA mismatch repair deficiency in sporadic

re

colorectal cancer and Lynch syndrome, Histopathology 56(2) (2009) 167-179. [6] S.K.H. Li, A. Martin, Mismatch Repair and Colon Cancer: Mechanisms and Therapies Explored, Trends in Molecular Medicine 22(4) (2016) 274-289.

lP

[7] C.D. Williams, J.A. Satia, L.S. Adair, J. Stevens, J. Galanko, T.O. Keku, R.S. Sandler, Associations of red meat, fat, and protein intake with distal colorectal cancer risk, Nutr Cancer 62(6) (2010) 701-709.

[8] L.S. Navarro, L.M. Neuhouser, D.T.-Y. Cheng, F.L. Tinker, M.J. Shikany, L. Snetselaar, A.J.

na

Martinez, I. Kato, A.S. Beresford, S.R. Chapkin, W.J. Lampe, The Interaction between Dietary Fiber and Fat and Risk of Colorectal Cancer in the Women’s Health Initiative, Nutrients 8(12) (2016).

ur

[9] J.E. East, B.P. Saunders, J.R. Jass, Sporadic and Syndromic Hyperplastic Polyps and Serrated Adenomas of the Colon: Classification, Molecular Genetics, Natural History, and Clinical Management, Gastroenterology Clinics of North America 37(1) (2008) 25-46.

Jo

[10] K. Simon, Colorectal cancer development and advances in screening, Clinical interventions in aging 11 (2016) 967-976. [11] J. Terzić, S. Grivennikov, E. Karin, M. Karin, Inflammation and Colon Cancer, Gastroenterology 138(6) (2010) 2101-2114.e5. [12] L. Beaugerie, S.H. Itzkowitz, Cancers Complicating Inflammatory Bowel Disease, The New England journal of medicine 373(2) (2015) 195. [13] A.W. Walker, J. Ince, S.H. Duncan, L.M. Webster, G. Holtrop, X. Ze, D. Brown, M.D. Stares, P. Scott, A. Bergerat, P. Louis, F. McIntosh, A.M. Johnstone, G.E. Lobley, J. Parkhill, H.J. Flint, Dominant and diet-responsive groups of bacteria within the human colonic microbiota, The Isme Journal 5 (2010) 220.

[14] J. Gagnière, J. Raisch, J. Veziant, N. Barnich, R. Bonnet, E. Buc, M.-A. Bringer, D. Pezet, M. Bonnet, Gut microbiota imbalance and colorectal cancer, World journal of gastroenterology 22(2) (2016) 501-518. [15] S. Zou, L. Fang, M.-H. Lee, Dysbiosis of gut microbiota in promoting the development of colorectal cancer, Gastroenterology Report 6(1) (2018) 1-12. [16] Cynthia L. Sears, Wendy S. Garrett, Microbes, Microbiota, and Colon Cancer, Cell Host & Microbe 15(3) (2014) 317-328. [17] P. Ambalam, M. Raman, R.K. Purama, M. Doble, Probiotics, prebiotics and colorectal cancer prevention, Best Pract Res Clin Gastroenterol 30(1) (2016) 119-131. [18] M. Vétizou, J.M. Pitt, R. Daillère, P. Lepage, N. Waldschmitt, C. Flament, S. Rusakiewicz, B. Routy, M.P. Roberti, C.P.M. Duong, V. Poirier-Colame, A. Roux, S. Becharef, S. Formenti, E. Golden, S. Cording, G. Eberl, A. Schlitzer, F. Ginhoux, S. Mani, T. Yamazaki, N. Jacquelot, D.P. Enot, M. Bérard, J. Nigou, P. Opolon, A. Eggermont, P.-L. Woerther, E. Chachaty, N. Chaput,

ro of

C. Robert, C. Mateus, G. Kroemer, D. Raoult, I.G. Boneca, F. Carbonnel, M. Chamaillard, L.

Zitvogel, Anticancer immunotherapy by CTLA-4 blockade relies on the gut microbiota, Science 350(6264) (2015) 1079-1084.

[19] J.L. Alexander, I.D. Wilson, J. Teare, J.R. Marchesi, J.K. Nicholson, J.M. Kinross, Gut microbiota modulation of chemotherapy efficacy and toxicity, Nature Reviews Gastroenterology

-p

&Amp; Hepatology 14 (2017) 356.

[20] D. Graf, R. Di Cagno, F. Fåk, H.J. Flint, M. Nyman, M. Saarela, B. Watzl, Contribution of diet to the composition of the human gut microbiota, Microb Ecol Health Dis, 2015, p. 26164.

re

[21] F. Cardona, C. Andrés-Lacueva, S. Tulipani, F.J. Tinahones, M.I. Queipo-Ortuño, Benefits of polyphenols on gut microbiota and implications in human health, The Journal of Nutritional Biochemistry 24(8) (2013) 1415-1422.

lP

[22] J. Zhang, X. Zhu, F. Luo, C. Sun, J. Huang, X. Li, K. Chen, Separation and purification of neohesperidin from the albedo of Citrus reticulata cv. Suavissima by combination of macroporous resin and high-speed counter-current chromatography, Journal of Separation Science 35(1) (2011) 128-136.

na

[23] O. Benavente-Garcia, J. Castillo, Update on uses and properties of citrus flavonoids: new findings in anticancer, cardiovascular, and anti-inflammatory activity, Journal of agricultural and food chemistry 56(15) (2008) 6185-205.

ur

[24] W. Zhang, S. Jiang, D. Qian, E.-x. Shang, J.-a. Duan, Determination of Metabolism of Neohesperidin by Human Intestinal Bacteria by UPLC-Q-TOF/MS, Chromatographia 77(5) (2014) 439-445.

Jo

[25] J. Wang, Y. Yuan, P. Zhang, H. Zhang, X. Liu, Y. Zhang, Neohesperidin Prevents Abeta2535-Induced Apoptosis in Primary Cultured Hippocampal Neurons by Blocking the SNitrosylation of Protein-Disulphide Isomerase, Neurochem Res 43(9) (2018) 1736-1744. [26] H. Wu, Y. Liu, X. Chen, D. Zhu, J. Ma, Y. Yan, M. Si, X. Li, C. Sun, B. Yang, Q. He, K. Chen, Neohesperidin Exerts Lipid-Regulating Effects in vitro and in vivo via Fibroblast Growth Factor 21 and AMP-Activated Protein Kinase/Sirtuin Type 1/Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1alpha Signaling Axis, Pharmacology 100(3-4) (2017) 115-126. [27] R.D. Cardiff, C.H. Miller, R.J. Munn, Manual hematoxylin and eosin staining of mouse tissue sections, Cold Spring Harb Protoc 2014(6) (2014) 655-8. [28] R.A. Floyd, R.A. Towner, D. Wu, A. Abbott, R. Cranford, D. Branch, W.-X. Guo, S.B. Foster,

I. Jones, R. Alam, D. Moore, T. Allen, M. Huycke, Anti-cancer activity of nitrones in the Apc(Min/+) model of colorectal cancer, Free Radic Res 44(1) (2010) 108-117. [29] E. Bellocco, D. Barreca, G. Lagana, U. Leuzzi, E. Tellone, S. Ficarra, A. Kotyk, A. Galtieri, Influence of L-rhamnosyl-D-glucosyl derivatives on properties and biological interaction of flavonoids, Mol Cell Biochem 321(1-2) (2009) 165-71. [30] W.S. Garrett, Cancer and the microbiota, Science 348(6230) (2015) 80. [31] R.M. Goldberg, Advances in the treatment of metastatic colorectal cancer, The oncologist 10 Suppl 3 (2005) 40-8. [32] F. Stracci, M. Zorzi, G. Grazzini, Colorectal cancer screening: tests, strategies, and perspectives, Front Public Health, 2014, p. 210. [33] J.F. Pérez-Cano, M. Castell, Flavonoids, Inflammation and Immune System, Nutrients 8(10) (2016). [34] L. Chang, S. Jia, Y. Fu, T. Zhou, J. Cao, Q. He, B. Yang, X. Li, C. Sun, D. Su, H. Zhu, K.

ro of

Chen, Ougan (Citrus reticulata cv. Suavissima) flavedo extract suppresses cancer motility by

interfering with epithelial-to-mesenchymal transition in SKOV3 cells, Chinese medicine 10 (2015) 14.

[35] E. Meiyanto, A. Hermawan, Anindyajati, Natural products for cancer-targeted therapy: citrus flavonoids as potent chemopreventive agents, Asian Pacific journal of cancer prevention :

-p

APJCP 13(2) (2012) 427-36.

[36] F. Xu, J. Zang, D. Chen, T. Zhang, H. Zhan, M. Lu, H. Zhuge, Neohesperidin induces cellular apoptosis in human breast adenocarcinoma MDA-MB-231 cells via activating the Bcl-

re

2/Bax-mediated signaling pathway, Natural product communications 7(11) (2012) 1475-8. [37] B.A. Peters, C. Dominianni, J.A. Shapiro, T.R. Church, J. Wu, G. Miller, E. Yuen, H. Freiman, I. Lustbader, J. Salik, C. Friedlander, R.B. Hayes, J. Ahn, The gut microbiota in conventional

lP

and serrated precursors of colorectal cancer, Microbiome 4(1) (2016) 69. [38] H. Tjalsma, A. Boleij, J.R. Marchesi, B.E. Dutilh, A bacterial driver–passenger model for colorectal cancer: beyond the usual suspects, Nature Reviews Microbiology 10 (2012) 575. [39] L. Vannucci, R. Stepankova, H. Kozakova, A. Fiserova, P. Rossmann, H. Tlaskalova-

na

Hogenova, Colorectal carcinogenesis in germ-free and conventionally reared rats: different intestinal environments affect the systemic immunity, International journal of oncology 32(3) (2008) 609-17.

ur

[40] J.R. Marchesi, Human distal gut microbiome, Environmental Microbiology 13(12) (2011) 3088-3102.

[41] W. Chen, F. Liu, Z. Ling, X. Tong, C. Xiang, Human intestinal lumen and mucosa-associated

Jo

microbiota in patients with colorectal cancer, PloS one 7(6) (2012) e39743-e39743. [42] J. Ahn, R. Sinha, Z. Pei, C. Dominianni, J. Wu, J. Shi, J.J. Goedert, R.B. Hayes, L. Yang, Human gut microbiome and risk for colorectal cancer, Journal of the National Cancer Institute 105(24) (2013) 1907-1911. [43] T. Irrazábal, A. Belcheva, Stephen E. Girardin, A. Martin, Dana J. Philpott, The Multifaceted Role of the Intestinal Microbiota in Colon Cancer, Molecular Cell 54(2) (2014) 309-320. [44] J.E. Klaunig, L.M. Kamendulis, B.A. Hocevar, Oxidative Stress and Oxidative Damage in Carcinogenesis, Toxicologic Pathology 38(1) (2009) 96-109. [45] L. Jiang, R. Dong, M. Ying, Q. He, J. Cao, B. Yang, Immune cells in the tumour: new routes of retinoids for chemoprevention and chemotherapeutics, British journal of pharmacology

175(23) (2018) 4285-4294. [46] J.C. Arthur, E. Perez-Chanona, M. Mühlbauer, S. Tomkovich, J.M. Uronis, T.-J. Fan, B.J. Campbell, T. Abujamel, B. Dogan, A.B. Rogers, J.M. Rhodes, A. Stintzi, K.W. Simpson, J.J. Hansen, T.O. Keku, A.A. Fodor, C. Jobin, Intestinal inflammation targets cancer-inducing

Jo

ur

na

lP

re

-p

ro of

activity of the microbiota, Science 338(6103) (2012) 120-123.

na

lP

re

-p

ro of

Figures and Figure Legends

Figure 1. NHP treatment prevents colorectal tumorigenesis in APC

min/+

mice. (A)

ur

Structure of NHP. (B) Schematic illustration of experimental design. (C) Representative photographs of whole intestinal tissues. (D) Quantitative analysis of tumor number

Jo

measured (n=22 per group). (E) Body weight of mice from each group. (F) Representative H&E staining of histological sections in the intestine. Statistical significance was determined by one-way ANONA analysis. **, p < 0.01；***, p < 0.001.

ro of -p re

lP

Figure 2. NHP induces tumor apoptosis and inhibits angiogenesis in vivo. (A) The

na

representative images of TUNEL staining in the tumor tissues in different groups are shown, and the TUNEL-positive ratios of tumor regions were analyzed. (B-D) Representative

ur

immunohistochemical image of Ki67, PCNA and p-Histone H3 in tumor sections, and expression scores of Ki67 PCNA and p-Histone H3 were analyzed by Image-Pro Plus 6.0.

Jo

(E) Representative immunohistochemical image of CD31 in tumor sections and expression scores of CD31 were analyzed by Image-Pro Plus 6.0. Statistical significance was determined by Student’s t-test. n=5, n.s. no significance; **, p < 0.01.

ro of -p re lP na ur Jo

Figure 3. The tumorigenesis preventative effect of NHP is independent of its direct impact on tumor cells. (A) Proliferation of CRC cells (HCT116 and SW480) treated with different concentrations of NHP (25 μM, 50 μM and 100 μM) or 5-Fu (5 μM) was measured. (B-E) After treating CRC cells (HCT116 and SW480) with different concentrations of NHP

(25 μM, 50 μM and 100 μM) or 5-Fu (5 μM) for 24 h and 48 h, Annexin V-FITC/PI analysis was performed to determine the apoptosis ratio. (F-G) After treating HUVECs with different concentrations of NHP (25 μM, 50 μM and 100 μM) or sorafenib (5 μM) for 24 h, tube formation assay was performed. Statistical significance was determined by one-way

Jo

ur

na

lP

re

-p

ro of

ANONA analysis. n=3; n.s. no significance; **, p < 0.01; ***, p < 0.001.

Figure 4. Wnt/β-catenin pathway is not involved in NHP-mediated prevention of tumorigenesis. (A) CRC cells SW480 were treated with gradient concentrations of NHP

for 72h, the cells were fractionated and subjected to western blot analysis using p-β-catenin, β-catenin and c-MYC antibodies. (B) CRC cells SW480 were transfected with plasmids TCF/LEF1 luciferase and renilla luciferase, then luciferase assays were performed after treating with NHP (50μM) for 48h. Statistical significance was determined by Student’s ttest. n=3, n.s. no significance. (C) mRNA expression of Wnt/β-catenin downstream genes was quantified by RT-PCR and normalized to β-actin expression. Statistical significance

ro of

was determined by one-way ANONA analysis. n=3, n.s. no significance. (D-E) Representative immunohistochemical image of β-catenin in tumor sections. (D) and

expression scores of β-catenin were analyzed by Image-Pro Plus 6.0 (E). Statistical

Jo

ur

na

lP

re

-p

significance was determined by Student’s t-test. n=3, n.s. no significance.

ro of -p re lP na ur Jo

Figure 5. NHP treatment significantly altered the gut microbiota. (A) The bar diagram of bacterial community distribution in feces contents (n = 5 per group) at phyla level. (BD) the ratios of Bacteroidetes (B), Firmicutes (C) and Proteobacteria (D) were analyzed. (E) Bacteroidetes/Firmicutes ratio and Bacteroidetes/ Proteobacteria ratio in feces contents were analyzed. (F) The bar diagram of bacterial community distribution in feces

contents (n = 5 per group) at species level. (G-J) The ratios of Bacteroidetes Becteroidaceae, Bacteroidetes Porphyromonadaceae, Firmicutes Lachnospiraceae and Proteobacteria Helicobacteraceae were analyzed. Statistical significance was determined by one-way ANONA analysis. n=5, n.s. no significance; *, p < 0.05; **, p < 0.01; ***, p <

Jo

ur

na

lP

re

-p

ro of

0.001.

Figure 6. Altered gut microbiota contributed to NHP-mediated prevention of tumorigenesis. (A) Schematic illustration of experimental design. (B) Representative photographs of intestinal tissues. (C) Quantitative analysis of tumor number measured (n=6 for high fat control group, n=7 for high fat FMT group, n=11 for NHP-FMT group, n=13 for NHP-FMT+NHP group). (D) Body weight of mice from each group. (E-F) The representative images of TUNEL staining in the tumor tissues in different groups were

ro of

shown, and the TUNEL-positive ratios of tumor regions were analyzed, n=3. (G-H) Representative immunohistochemical image of CD31 in tumor sections and expression

scores of CD31 were analyzed by Image-Pro Plus 6.0, n=3. Statistical significance was

Jo

ur

na

lP

re

-p

determined by one-way ANONA analysis. *, p < 0.05; **, p < 0.01; ***, p < 0.001.