- Email: [email protected]
Neonatal exposure to 17α-ethynyl estradiol (EE) disrupts follicle development and reproductive hormone profiles in female rats
Accepted Manuscript Title: Neonatal exposure to 17␣-ethynyl estradiol (EE) disrupts follicle development and reproductive hormone profiles in female rats Authors: Haolin Zhang, Kazuyoshi Taya, Kentaro Nagaoka, Midori Yoshida, Gen Watanabe PII: DOI: Reference:
S0378-4274(17)30191-1 http://dx.doi.org/doi:10.1016/j.toxlet.2017.05.014 TOXLET 9771
To appear in:
Toxicology Letters
Received date: Revised date: Accepted date:
23-12-2016 14-4-2017 12-5-2017
Please cite this article as: Zhang, Haolin, Taya, Kazuyoshi, Nagaoka, Kentaro, Yoshida, Midori, Watanabe, Gen, Neonatal exposure to 17␣-ethynyl estradiol (EE) disrupts follicle development and reproductive hormone profiles in female rats.Toxicology Letters http://dx.doi.org/10.1016/j.toxlet.2017.05.014 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Neonatal exposure to 17-ethynyl estradiol (EE) disrupts follicle development and reproductive hormone profiles in female rats Haolin Zhang1,2,3, Kazuyoshi Taya2, Kentaro Nagaoka2,3, Midori Yoshida4, Gen Watanabe2,3 1) Laboratory of Animal Physiology, College of Biological Sciences and Technology, Beijing Forestry University, Beijing 100083, PR China 2) United Graduate School of Veterinarian Science, Gifu University, Gifu5011193, Japan 3) Laboratory of Veterinary Physiology, Cooperative Department of Veterinary Medicine, Faculty of Agriculture, Tokyo University of Agriculture and Technology, Tokyo 183-8509, Japan 4) Division of Pathology, National Institute of Health Sciences, Tokyo 158-8501, Japan Abbreviated form of the title: EE Alters Reproductive Hormones Gen Watanabe, DVM, PhD, Professor Veterinary Physiology, Tokyo University of Agriculture and Technology Fuchu, Tokyo 183-8509, Japan Phone: +81-42-367-5768
Fax: +81-42-367-5767
Mail: [email protected] Highlights:
1
1. Neonatal exposure to EE retarded follicle development.
2. Neonatal exposure to EE elevated ovarian steroidogenesis and 17-estradiol at PND14.
3. Neonatal exposure to EE suppressed kisspeptin expression in the ARC at PND14.
4. Neonatal exposure to EE inhibited inhibin/activin A and B expression at PND21.
5. The disruptions in estrogens, inhibins/activins, and kisspeptin retarded follicular development
Abstract Toxic effects induced by exposure to endocrine-disrupting chemicals during fetal and neonatal periods can be irreversible and exert effects throughout an animal’s entire life. Our previous study showed that neonatal exposure to 17ethynyl estradiol (EE) induced irregular estrous cycle in adults. To uncover the reason for the delayed effect after neonatal exposure to EE, reproductive parameters including ovarian weight, ovarian steroidogenesis, and hormonal profiles were investigated in developing female rats. Ovarian weight decreased at postnatal days (PND) 14 and 21 after neonatal exposure to EE. Ovarian histology at PND21 showed that the ratio of follicles with a diameter >300 m decreased and the ratio of follicles with a diameter of 100-150 m increased in EE-treated ovaries, indicating that neonatal exposure to EE retarded follicular development. Moreover, the expression of P450arom increased at PND14 and the expressions of inhibin/activin subunits A and B decreased at PND21 in EE-treated ovaries. Consistent with the expression of P450arom, circulating levels of 17-estradiol increased at PND14 in EE-treated animals. Furthermore, the circulating levels of luteinizing hormone (LH) also increased at PND14 in the treated animals. Although the expression of Kiss1 did not change in the anteroventral periventricular nucleus (AVPV) of the hypothalamus between
2
controls and EE-treated rats, the expression of Kiss1 was reduced in the arcuate nucleus (ARC) of the hypothalamus at PND14. Based upon those results, we suggest that neonatal exposure to EE disrupted the system regulating the interactions between the reproductive hormones and follicle development in pre-pubertal rats, which may result in reproduction dysfunction in adulthood. Keywords: 17-ethynyl estradiol (EE); Endocrine-disrupting chemicals; Inhibins/Activins; Ovary; Steroid hormones.
3
1. Introduction Endocrine-disrupting chemicals (EDCs) are referred to as man-made or natural chemicals that may interfere with the body’s endocrine system (Diamanti-Kandarakis et al., 2009). EDCs have been proven to associated with reproductive dysfunction, abnormal fetal development, breast cancer, or other physiologic defects or diseases (Casals-Casas and Desvergne, 2011; Patisaul and Adewale, 2009; Soto and Sonnenschein, 2015; Unuvar and Buyukgebiz, 2012). Importantly, exposure to EDCs during the fetal and neonatal periods could be very risky, and the toxic effects experienced during these critical periods might be irreversible and last into adulthood (Diamanti-Kandarakis et al., 2009). Many man-made EDCs have been found in the environment, such as 17α-ethynyl estradiol in water, bisphenol A in food product, and nitrophenols in diesel exhaust (Laurenson et al., 2014; Noya et al., 2008; Pivnenko et al., 2015; Furuta et al., 2004). Due to the increasing public concern regarding EDCs and human and animal health in recent years, basic data collection on the adverse effects of EDCs on human and animal physiology have become increasingly important. 17α-ethynyl estradiol (EE) is a type of synthetic estrogen that has been used as an oral contraceptive for women, and has now become a well-known EDC in the environment since it enters the aquatic environment via wastewater discharge (Combalbert and Hernandez-Raquet, 2010; Pedersen et al., 2005). Many reports from experimental animals showed that neonatal exposure to EE in rats induced reproductive dysfunction during adulthood (Mandrup et al., 2013; Mathews et al., 2009; Sawaki et al., 2003; Shiorta et al., 2012; Takahashi et al.,
4
2013). Our previous study showed earlier disrupted estrous cycles, shorter reproductive lifespan, and disrupted expression of Kiss1 in the hypothalamus occurred in adult rats after neonatal exposure to EE (Nozawa et al., 2014; Usuda et al., 2014). However, the molecular or physiologic changes in the prepubertal rats after neonatal exposure to EE remain unclear. The hypothalamic-pituitary-ovarian axis is the classically recognized reproductive axis (Christensen et al., 2012). Kisspeptin participates in the axis and stimulates the production of gonadotropin-releasing hormone (GnRH) in the hypothalamus, and GnRH, in turn, stimulates the secretion of gonadotropins, including follicle-stimulating hormone (FSH) and luteinizing hormone (LH) from the pituitary; the gonadotropins then promote steroidogenesis by stimulating the expression of steroidogenic enzymes, including cytochrome P450 17hydroxylase/17,20 lyase (P450c17) and cytochrome P450 aromatase (P450arom) in the ovary (Andersen and Ezcurra, 2014). In addition, the ovary produces activins and inhibins to promote or inhibit gonadotropin production (Christensen et al., 2012). It remains unclear as to how neonatal exposure to EE influences the hypothalamic-pituitary-ovarian axis, especially concerning hormonal profiles. The aim of the present study is to investigate steroidogenic enzyme expression in developing ovaries, and to evaluate changes in peptide and steroid hormone profiles in pre-pubertal rats due to EE treatment. 2. Materials and methods 2.1 Animals
5
Male and female Wistar-Imamichi rats were purchased from SLC (Shizuoka, Japan) and maintained at 23 ± 2 ˚C under a 14-hour light/10-hour dark lighting schedule (lights on from 05:00 to 19:00 h). Labo MR Breeder (Nosan, Kanagawa, Japan) was used as the basal diet for rats. Food and tap water were given ad libitum. After mating and delivery, female pups were used for the experiment. All procedures were carried out in accordance with the guidelines established by Tokyo University of Agriculture and Technology (23-1). 2.2 Experimental design Newborn female pups were assigned to one of the following neonatal treatments: either controls, given sesame oil vehicle alone (control group); or EE at 200 μg/kg. Treatments were administered within 24 hours of delivery, i.e., postnatal day 0 (PND0), by subcutaneous (sc) injection in the nape of the neck. All compounds were dissolved in sesame oil. The dosage was determined based upon our preliminary results and previous reports (Nozawa et al., 2014; Takahashi et al., 2013, Usuda et al., 2014), and the clear toxicologic effects induced in the female reproductive system after neonatal exposure to 200 μg/kg EE. All rats were killed by decapitation and the blood samples were collected at PND1, PND3, PND7, PND14, and PND21. To obtain enough serum for the measurement of hormones, blood from 2-3 different animals was pooled for each sample. A total of 5-10 samples was obtained for each group at PND1 (n=10), PND3 (n=9), PND7 (n=8), PND14 (n=5), and PND21 (n=5) for subsequent hormonal measurement. 2.3 Histology
6
Ovaries were collected from each animal and fixed in 4% paraformaldehyde, embedded in paraffin, serially sectioned at 6 μm, and stained with hematoxylin and eosin. The diameters of all antral follicles in ovaries at PND21 were measured every five sections using an ocular micrometer. The size of each follicle was determined by measuring the diameter, as determined by vertical and horizontal measurements in the section that passed through the nucleus of an oocyte, and these were then averaged. The diameter was measured to the limits of the granulosa cell membrane. Follicles were classified according to size into five arbitrary groups (100-150 μm, 151-200 μm, 201-250 μm, 251-300 μm and more than 300 μm). In this colony of rats, all follicles larger than 301 µm in diameter had a developed antral cavity. The antral follicles with a clear oocyte nuclear were examined in a total of 80 sections per ovary (n=3 for each group). 2.4 Immunohistochemistry Serial sections of ovaries (n=5 for each group) were incubated with 10% normal goat serum to reduce background staining caused by the second antibody. Then the sections were incubated with primary antibody, human placental P450arom (R-8-1; kindly provided by Dr. Y. Osawa, Medical Foundation of Buffalo, Buffalo, NY, USA) or proliferating cell nuclei antigen (PCNA) antibody (Thermo Fisher Scientific, Rockford, IL, USA, #13-3900) overnight at 4℃. The sections were then incubated with a secondary antibody, anti-rabbit lgG conjugated with biotin and peroxidase with avidin, using a rabbit or mouse VECTASTAIN ABC kit (Vector lab., Burlingame, CA, USA), and subsequently visualized with diaminobenzidine (Sigma-Aldrich, St. Louis, MO, USA) as a chromogen substrate. Finally, the reacted sections were 7
counterstained with hematoxylin solution. The control sections were treated with normal rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or normal mouse IgG (EMD Millipore, Temecula, MA, USA #12-371) instead of the primary antibodies. Images were captured using an immunofluorescence microscope, BX-51 (Olympus, Tokyo, Japan). Five sections from each sample were selected randomly for measurement of staining intensity. The intensity of staining was evaluated by ImageJ software (Schindelin et al., 2012) and the optical density was calculated by measuring the mean gray level of the DAB staining color channel after color deconvolution. The relative optical density was compared between control and EE-treated ovaries. 2.5 QRT-PCR analysis Brain samples were cut on dry ice using a stainless steel brain matrix and either the anteroventral periventricular nucleus (AVPV) or the arcuate nucleus (ARC) was collected according to the rat brain atlas. Total RNA was extracted from ovaries or brains using TRIzol Reagent (Invitrogen Co., Carlsbad, CA, USA) according to the manufacturer’s protocol, and cDNA was synthesized using a PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio Inc., Shiga, Japan). The oligonucleotide primers for qRT-PCR analysis were designed using the Primer 3 program (Table 1). The PCR reactions were carried in a 10-μl volume using ExTaqR Hot Start Version containing SYBR-Green I (Takara Bio Inc., Shiga, Japan) and performed with a chrome4 Real-Time PCR System (Bio-Rad, Richmond, CA, USA) using the following conditions: 95℃ for 30 sec, followed by PCR reaction by 40 cycles of 95℃ for 5 sec, 60℃ for 30 sec, and a dissociation protocol. The expression level of each target mRNA relative to 8
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was determined using the 2-ΔΔCt method (n=5 for each group). 2.6 Hormone Assay Serum concentrations of LH and FSH were measured using National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) rat radioimmunoassay (RIA) kits
(Bethesda, MD,USA). Iodinated preparations
were rat LH-I-7 and rat FSH-I-7, and the antisera were anti-rat LH-S-10 and anti-rat FSH-S-11, respectively. The results were expressed in terms of NIDDK rat LH-RP-3 and FSH-RP-2.; and the intra- and inter-assay coefficients of variations were 5.4% and 11.2% for LH, and 7.2% and 15.7% for FSH, respectively. Serum concentrations of 17-estradiol were measured using 125I-labeled radioligands ([125I] MP01738226, MP Biomedicals, Santa Ana, CA, USA). Antiserum to 17-estradiol (GDN244) was kindly provided by Dr. G.D. Niswender (Fort Collins, CO, USA). The intra- and inter-assay coefficients of variation were 3.4% and 5.2% for 17-estradiol, respectively (Taya et al., 1985). Serum concentrations of immunoreactive (ir-) inhibin were measured using rabbit antiserum against bovine inhibin (TNDH-1) and 125I-labeled 32-kDa bovine inhibin (Hamada et al., 1989). The intra- and inter-assay coefficients of variation were 7.1% and 14.7% respectively. All samples to be compared were analyzed in the same assay. 2.7 Statistical analysis
9
Statistical comparisons were made with the Student’s t-test or one-way ANOVA followed by Tukey’s multiple-range test using Prism 5 (GraphPad Software, Inc., CA, USA). A value of P < 0.05 was considered an indication of statistical significance. 3. Results 3.1 Body and ovarian weights The body weights (Fig. 1A) and ovarian weights (Fig. 1B) were assessed in the control and EE-treated rats at developmental stages. There was no significant difference in body weight between the control group and EEtreatment group from PND1 to PND21. However, there were significant decreases in the ovarian weight of EE-treated rats at PND14 and PND21. 3.2 Cell proliferation and histologic examination of the ovaries at PND21 Due to the decreased ovarian weights in the EE-treatment group, cell proliferation and ovarian histology were then evaluated at PND21. The PCNA staining in controls (Fig. 2A-E) and EE-treated ovaries (Fig. 2F-J) are shown in Fig. 2. PCNA staining was observed in theca cells, granulosa cells, and oocytes in various types of follicles. However, there was little difference between control and EE-treated ovaries, which indicates that cell proliferation was not different between control and EE-treated ovaries. Ovarian histology was also examined in the controls and EE-treated animals (Fig. 2K and L, respectively). The percentage of different sized follicles in ovaries is shown in Fig. 2M. The number of follicles with a diameter >300 μm was greater in control ovaries compared with EE-treated ovaries. Conversely, 10
the number of follicles with a diameter between 100 and 150 μm was less in control ovaries than in EE-treated ovaries (Fig. 2M). 3.3 The expression of steroidogenic enzymes and inhibin/activin subunits in developmental-stage ovaries To elucidate a reason for the disrupted follicle development, gene expressions for the steroidogenic enzymes and inhibin/activin subunits in these ovaries were investigated by real-time PCR. There was no difference in the expression of P450c17 in the developmental-stage ovaries of control and EE-treatment groups from PND1 to PND21 (Fig. 3A). The expression of P450arom in the EEtreated ovaries increased significantly compared with that in the control ovaries at PND14 (Fig. 3B). The expression of inhibin was not changed by EE exposure, but the expressions of inhibin/activin subunits A and B were decreased by EE exposure at PND21 (Fig. 3C-E). 3.4 Hormonal changes in control and EE-treated rats The different reproductive hormones, including gonadotropins, 17β-estradiol, and inhibin were investigated in control and EE-treated rats from PND3 to PND21. Though there were no differences in circulating FSH levels between the control and EE-treatment groups (Fig. 4A), the levels of circulating LH were significantly higher in the EE-treated rats when compared with the control rats at PND14 (Fig. 4B). There was a peak in 17β-estradiol concentrations in both the control and EE-treated rats at PND14; however, the level of 17β-estradiol was significantly higher in the EE-treated rats than in the control rats at PND14 (Fig. 4C). The circulating levels of inhibin were constant and attenuated from PND3
11
to PND14, and increased to a relatively high level at PND21. However, there was no significant difference in the inhibin concentration between controls and EE- treated groups from PND3 to PND21 (Fig. 4D). 3.5 The immunolocalization of P450arom in ovaries at PND14 To confirm the expression of P450arom in the ovary at PND14, we performed immunostaining for P450arom. P450arom was found to localize in the theca cells, interstitial cells, and granulosa cells at PND14 in the control and EEtreated ovaries (Fig. 5). According to the optical densities with respect to DAB staining, there was a slight decrement in the optical density of P450arom in the control ovaries compared to the EE-treated ovaries. 3.6 The expression of kisspeptin in the hypothalamus of developmental rats Although the expression of kisspeptin in the AVPV of the hypothalamus was not different between controls and EE-treated rats (Fig. 6A), the expression of kisspeptin in the ARC of the hypothalamus decreased in the EE-treated group compared with that in the control group at PND14 (Fig. 6B). 4. Discussion The adverse effects of exposure to EDCs have been studied for many years, and the connection between neonatal exposure to EDCs and health defects during adulthood have been reported previously (Herath et al., 2001a; Mandrup et al., 2013; Mathews et al., 2009; Sawaki et al., 2003; Shiorta et al., 2012; Takahashi et al., 2013). In our previous studies, neonatal exposure to EE induced disrupted estrous cycles in adulthood (Nozawa et al., 2014; Usuda et al., 2014). To clarify the mechanism(s) for this delayed effect, we evaluated in 12
the present study the influence of EE on ovarian development in the prepubertal period. Our results showed that ovarian weight was attenuated at PND14 and PND21. Moreover, the mean size of antral follicles was diminished in the EE- treated ovaries. These results suggest that the decreased ovarian weight is due to impaired follicular development with EE. Estrogen plays an important role in overall ovarian function and follicular development specifically (Adashi, 1994; Britt et al., 2004). The high dose of 17-estradiol might delay or inhibit oocyte meiotic maturation and induce abnormal follicle development (Tarumi et al., 2014). The increased circulating 17-estradiol accompanying the increased expression of P450arom was found in the EE-treated rats at PND14, which is the time for the antral follicle formation (Herath et al., 2001b); and the increased 17-estradiol at PND14 in the EE-treatment group may retard follicle development and result in a higher ratio of smaller-sized follicles at PND21. The localization of P450arom also indicates that EE treatment may disrupt the functions of theca and granulosa cells in the developmental follicle. Furthermore, the increased P450arom expression and circulating 17-estradiol levels in the EE-treatment group may be due to the elevated circulating LH at PND14, since increased LH may promote steroidogenesis via its receptors in somatic cells (Strott et al., 1969). Previous reports showed that EE is a small molecule that easily passes the blood-brain barrier (BBB) and exerts actions in the developing brain (Scallet and Meredith, 2002; Stanczyk et al., 2013). Therefore, altered circulating LH levels may also indicate that neonatal EE exposure might affect the hypothalamicpituitary axis, and kisspeptin has been proven to be a regulator of the
13
hypothalamic-pituitary-gonadal axis (Okamura et al., 2013; Roa et al., 2011). Previous reports showed that EDCs can induce epigenetic effects on gene expression in exposed individuals (Iqbal et al., 2015; Manikkam et al., 2013; Skinner, 2014, 2016), and that estrogenic compounds can regulate the expression of kisspeptin via acetylation and deacetylation (Tomikawa et al., 2012). The present data showed that a single neonatal exposure to EE changed kisspeptin expression after two weeks, which suggests that EE may regulate kisspeptin expression in the developing hypothalamus via an epigenetic pathway. We know that kisspeptin neuron subpopulations localized in the AVPV regulate or in the ARC constitute the LH surge or pulse regulator, respectively (Putteeraj et al., 2016). Decreased kisspeptin expression in the ARC at PND14 may then reduce LH pulse frequency and influence follicle development. Although we could not explain the increase in circulating LH concentrations concomitant with decreased expression of kisspeptin in the ARC of the hypothalamus after EE exposure at PND14, we could not exclude the possibility that EE directly influences LH expression or secretion in the pituitary. Inhibins and activins comprise important factors involved in ovarian function and development (Knight et al., 2012; Reader and Gold, 2015; Wijayarathna and de Kretser, 2016). Several investigators have shown that activin can promote follicle development, particularly large or antral follicles (Li et al., 1995; Thomas et al., 2003). In the present study, although neonatal exposure to EE did not affect inhibin, we observed altered expression of inhibin/activin subunits A and B at PND21 in the EE-treated animals. This indicates to us that neonatal exposure to EE may decrease activin production from the ovary.
14
Simultaneously, the mean size of antral follicles was decreased at PND21 in the EE-treatment group. There are reports that activin A induces FSH receptors in granulosa cells of follicles in vitro and in vivo (Hasegawa et al., 1988; Nakamura et al., 1993); and together with our results, this suggests that EE may reduce expression of inhibin/activin subunits A and B, and thereby decelerate follicular growth at PND21. Previous reports showed that neonatal exposure to EE induced delayed effects in the female rat (Takahashi et al., 2013; Nozawa et al., 2014; Usuda et al., 2014). The period from PND0 to PND10 is the critical window for susceptibility for these delayed effects since exposure to EE during this period induces reproductive dysfunction in the adult (Ichimura et al., 2015). The dose range for the induction by EE of abnormal estrous cycle was verified between 0.2 μg/kg and 2000 μg/kg (Takahashi et al., 2013; Nozawa et al., 2014). Our previous results showed that neonatal exposure to EE directly affected ovarian development by inhibiting oocyte apoptosis and disrupting follicle formation (Zhang et al., 2016). Moreover, neonatal exposure to EE also impaired ovarian function by affecting the hypothalamic-pituitary axis and kisspeptin expression. Although there were some conflicting data between previous reports (Takahashi et al., 2014, 2016) and the present data, kisspeptin expression was generally suppressed in the hypothalamus after neonatal exposure to EE. These toxic effects in the early developmental stages by neonatal EE exposure may be the reason for the reproductive deficits observed in the adult period. In conclusion, the present study showed that neonatal exposure to EE could alter kisspeptin expression in the hypothalamus and circulating concentrations 15
of gonadotropins, which then disrupted the expression of steroidogenic enzymes and inhibin/activin subunits in the developing ovary and also circulating 17-estradiol. This early disruption in the hypothalamus and the impaired follicle development due to neonatal exposure to EE may relate to the delayed effects observed in the adult period. Acknowledgments We are grateful to Dr. A.F. Parlow and the Rat Pituitary Hormone Distribution Program (NIDDK, NIH, Bethesda, MD, USA) for rat LH and FSH RIA materials, Dr. G D Niswender, Colorado State University, Fort Collins, CO, USA for antisera to estradiol-17β (GDN224), and Dr. Y. Osawa, Medical Foundation of Buffalo, Buffalo, NY, USA, for an antibody to human placental P450 aromatase. We also thank to Dr. R.J. Hutz for the manuscript reading and grammar checking. This study was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (to KN, 26660248); and Health and Labour Science Research Grants, Research on Risk of Chemical Substance, Ministry of Health, Labour and Welfare, Japan (H25-Toxical-003).
16
References Adashi, E.Y., 1994. Endocrinology of the ovary. Hum. Reprod. 9, 815-827. Andersen, C.Y., Ezcurra, D., 2014. Human steroidogenesis: implications for controlled ovarian stimulation with exogenous gonadotropins. Reprod. Biol. Endocrinol. 12, 128. Casals-Casas, C., Desvergne, B., 2011. Endocrine disruptors: from endocrine to metabolic disruption. Annu. Rev. Physiol. 73, 135-162. Christensen, A., Bentley, G.E., Cabrera, R., Ortega, H.H., Perfito, N., Wu, T.J., Micevych, P., 2012. Hormonal regulation of female reproduction. Horm. Metab. Res. 44, 587-591. Combalbert,
S.,
Hernandez-Raquet,
G.,
2010.
Occurrence,
fate,
and
biodegradation of estrogens in sewage and manure. Appl. Microbiol. Biotechnol. 86, 1671-1692. Diamanti-Kandarakis, E., Bourguignon, J.P., Giudice, L.C., Hauser, R., Prins, G.S., Soto, A.M., Zoeller, R.T., Gore, A.C., 2009. Endocrine-disrupting chemicals: an Endocrine Society scientific statement. Endocr. Rev. 30, 293342. Furuta, C., Suzuki, A.K., Taneda, S., Kamata, K., Hayashi, H., Mori, Yoki, Li, C., Watanabe, G. , Taya, K., 2004. Estrogenic activities of nitrophenols in diesel exhaust particles. Biology of Reproduction 70, 1527-1533. Hamada,T., Watanabe,G., Kokuho,T., Taya,K., Sasamoto,S., Hasegawa,Y., Miyamoto,K., Igarashi,M. 1989. Radioimmunoassay of inhibin in various mammals. Journal of Endocrinology 122, 697-704. Hasegawa Y, Miyamoto K, Abe Y, Nakamura T, Sugino H, Eto Y, Shibai H.,
17
Igarashi M 1988 Induction of follicle stimulating hormone receptor by erythroid differentiation factor on rat granulosa cell. Biochemical and Biophysical Research Communications 156 668–674. Herath,C.B., Watanabe,G., Katsuda,S., Yoshida,M., Suzuki,A.K., Taya,K. 2001a. Exposure of neonatal female rats to p-tert-octylphenol disrupts afternoon surges of luteinizing hormone, follicle-stimulating hormone and prolactin secretion, and interferes with sexual receptive behavior in adulthood. Biology of Reproduction 64, 1216-1224. Herath,C.B., Yamashita, M., Watanabe,G., Jin, W.Z., Tangtrongsup, S., Kojima, A., Groome, N. P., Suzuki, A. K., Taya,K. 2001b. Regulation of folliclestimulating hormone secretion by estradiol and dimeric inhibins in the infantile female rat. Biology of Reproduction 65, 1623-1633. Iqbal, K., Tran, D.A., Li, A.X., Warden, C., Bai, A.Y., Singh, P., Wu, X., Pfeifer, G.P., Szabo, P.E., 2015. Deleterious effects of endocrine disruptors are corrected in the mammalian germline by epigenome reprogramming. Genome Biol. 16, 59. Knight, P.G., Satchell, L., Glister, C., 2012. Intra-ovarian roles of activins and inhibins. Mol. Cell Endocrinol. 359, 53-65. Laurenson, J.P., Bloom, R.A., Page, S., Sadrieh, N., 2014. Ethinyl estradiol and other human pharmaceutical estrogens in the aquatic environment: a review of recent risk assessment data. AAPS J. 16, 299-310. Li, R., Phillips, D.M., Mather, J.P., 1995. Activin promotes ovarian follicle development in vitro. Endocrinology 136, 849-856. Mandrup, K.R., Jacobsen, P.R., Isling, L.K., Axelstad, M., Dreisig, K., Hadrup, N.,
18
Vinggaard, A.M., Hass, U., Boberg, J., 2013. Effects of perinatal ethinyl estradiol exposure in male and female Wistar rats. Reprod. Toxicol. 42, 180191. Manikkam, M., Tracey, R., Guerrero-Bosagna, C., Skinner, M.K., 2013. Plastics derived endocrine disruptors (BPA, DEHP and DBP) induce epigenetic transgenerational inheritance of obesity, reproductive disease and sperm epimutations. PloS one 8, e55387. Mathews, E., Braden, T.D., Williams, C.S., Williams, J.W., Bolden-Tiller, O., Goyal, H.O., 2009. Mal-development of the penis and loss of fertility in male rats treated neonatally with female contraceptive 17alpha-ethinyl estradiol: a dose-response study and a comparative study with a known estrogenic teratogen diethylstilbestrol. Toxicol. Sci. 112, 331-343. Nakamura M, Minegishi T, Hasegawa Y, Nakamura K, Igarashi S, Ito I, Shinozaki H, Miyamoto K, Eto Y., Ibuki Y 1993 Effect of an activin A on folliclestimulating hormone (FSH) receptor messenger ribonucleic acid levels and FSH receptor expression in cultured rat granulosa cells. Endocrinology 133 538–544. Noya, Y., Mikami, Y., Taneda, S., Mori, Y., Suzuki, A.K., Ohkura, K., Yamaki, K., Yoshino, S., Seki, K., 2008. Improvement of an efficient separation method for chemicals in diesel exhaust particles: analysis for nitrophenols. Environ. Sci. Pollut. Res. Int. 15, 318-321. Nozawa, K., Nagaoka, K., Zhang, H., Usuda, K., Okazaki, S., Taya, K., Yoshida, M., Watanabe, G., 2014. Neonatal exposure to 17alpha-ethynyl estradiol affects ovarian gene expression and disrupts reproductive cycles in female
19
rats. Reprod. Toxicol. 46, 77-84. Okamura, H., Yamamura, T., Wakabayashi, Y., 2013. Kisspeptin as a master player in the central control of reproduction in mammals: an overview of kisspeptin research in domestic animals. Anim. Sci. J. 84, 369-381. Patisaul, H.B., Adewale, H.B., 2009. Long-term effects of environmental endocrine disruptors on reproductive physiology and behavior. Front Behav. Neurosci. 3, 10. Pedersen, J.A., Soliman, M., Suffet, I.H., 2005. Human pharmaceuticals, hormones, and personal care product ingredients in runoff from agricultural fields irrigated with treated wastewater. J. Agric. Food Chem. 53, 1625-1632. Pivnenko, K., Pedersen, G.A., Eriksson, E., Astrup, T.F., 2015. Bisphenol A and its structural analogues in household waste paper. Waste Manag. 44, 39-47. Putteeraj, M., Soga, T., Ubuka, T., Parhar, I.S., 2016. A “Timed” Kiss Is Essential for Reproduction: Lessons from Mammalian Studies. Front. Endocrinol. 7, 121. Reader, K.L., Gold, E., 2015. Activins and activin antagonists in the human ovary and ovarian cancer. Mol. Cell. Endocrin. 415, 126-132. Roa, J., Navarro, V.M., Tena-Sempere, M., 2011. Kisspeptins in reproductive biology: consensus knowledge and recent developments. Biol. Reprod. 85, 650-660. Sawaki, M., Noda, S., Muroi, T., Mitoma, H., Takakura, S., Sakamoto, S., Yamasaki, K., 2003. In utero through lactational exposure to ethinyl estradiol induces cleft phallus and delayed ovarian dysfunction in the offspring. Toxicol. Sci. 75, 402-411.
20
Scallet,
A.C.,
Meredith,
J.M.,
2002.
Quantitative
three-dimensional
reconstruction: feasibility for studies of sexually dimorphic hypothalamic development in rats. Neurotoxicol. Teratol. 24, 81-85. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J.Y., White, D.J., Hartenstein, V., Eliceiri, K., Tomancak, P., Cardona, A., 2012. Fiji: an open-source platform for biological-image analysis. Nat. Methods. 9(7), 676682. Shiorta, M., Kawashima, J., Nakamura, T., Ogawa, Y., Kamiie, J., Yasuno, K., Shirota, K., Yoshida, M., 2012. Delayed effects of single neonatal subcutaneous
exposure
of
low-dose
17alpha-ethynylestradiol
on
reproductive function in female rats. J. Toxicol. Sci. 37, 681-690. Skinner,
M.K.,
2014.
Endocrine
disruptor
induction
of
epigenetic
transgenerational inheritance of disease. Mol. Cell. Endocrin. 398, 4-12. Skinner, M.K., 2016. Endocrine disruptors in 2015: Epigenetic transgenerational inheritance. Nat. Rev. Endocrinol. 12, 68-70. Soto, A.M., Sonnenschein, C., 2015. Endocrine disruptors: DDT, endocrine disruption and breast cancer. Nat. Rev. Endocrinol. 11, 507-508. Stanczyk, F.Z., Archer, D.F., Bhavnani, B.R., 2013. Ethinyl estradiol and 17betaestradiol
in
combined
oral
contraceptives:
pharmacokinetics,
pharmacodynamics and risk assessment. Contraception 87, 706-727. Strott, C.A., Yoshimi, T., Ross, G.T., Lipsett, M.B., 1969. Ovarian physiology: relationship between plasma LH and steroidogenesis by the follicle and corpus luteum; effect of HCG. J. Clin. Endocrinol. Metab. 29, 1157-1167.
21
Takahashi, M., Inoue, K., Morikawa, T., Matsuo, S., Hayashi, S., Tamura, K., Watanabe, G., Taya, K., Yoshida, M., 2013. Delayed effects of neonatal exposure to 17alpha-ethynylestradiol on the estrous cycle and uterine carcinogenesis in Wistar Hannover GALAS rats. Reprod. Toxicol. 40, 16-23. Tarumi, W., Itoh, M.T., Suzuki, N., 2014. Effects of 5alpha-dihydrotestosterone and 17beta-estradiol on the mouse ovarian follicle development and oocyte maturation. PloS one 9, e99423. Taya,K.,
Watanabe,G.
&
Sasamoto,S.,
1985.
Radioimmunoassay
for
progesterone, testosterone and estradiol-17β using 125I-iodohistamine radioligands. Japanese Journal of Animal Reproduction 31, 186-197. Thomas, F.H., Armstrong, D.G., Telfer, E.E., 2003. ctivin promotes oocyte development in ovine preantral follicles in vitro. Reprod. Biol. Endocrinol. 1:76-83. Tomikawa, J., Uenoyama, Y., Ozawa, M., Fukanuma, T., Takase, K., Goto, T., Abe, H., Ieda, N., Minabe, S., Deura, C., Inoue, N., Sanbo, M., Tomita, K., Hirabayashi, M., Tanaka, S., Imamura, T., Okamura, H., Maeda, K., Tsukamura, H., 2012. Epigenetic regulation of Kiss1 gene expression mediating estrogen-positive feedback action in the mouse brain. Proc. Natl. Acad. Sci. USA. 109, E1294-E1301. Unuvar, T., Buyukgebiz, A., 2012. Fetal and neonatal endocrine disruptors. J. Clin. Res. Pediatr. Endocrinol. 4, 51-60. Usuda, K., Nagaoka, K., Nozawa, K., Zhang, H., Taya, K., Yoshida, M., Watanabe, G., 2014. Neonatal exposure to 17alpha-ethinyl estradiol affects kisspeptin expression and LH-surge level in female rats. J. Vet. Med. Sci. 76,
22
1105-1110. Zhang, H., Nagaoka, K., Usuda, K., Nozawa, K., Taya, K., Yoshida, M., Watanabe, G., 2016. Estrogenic Compounds Impair Primordial Follicle Formation by Inhibiting the Expression of Proapoptotic Hrk in Neonatal Rat Ovary. Biol. Reprod. 95, 78.
23
FIGURE LEGENDS Fig. 1. Rat body and ovarian weight in the control and EE-treatment groups. PND, postnatal day. Fig. 2. PCNA staining in control (A-E) and EE-treated (F-J) ovaries at PND21. Rat ovarian histology in control (K) and EE-treatment (L) groups at PND21. (M) The average diameter of antral follicles in ovaries at PND21. Bars (A, F, K and L), 200 m. Bars (B-E, G-J), 20 m. Asterisks represent significant differences (P < 0.05). Fig. 3. mRNA expression of P450c17 (A), P450arom (B), inhibin subunit (C), inhibin/activin subunits A (D), and B (E) in control and EE-treated ovaries from PND1 to PND21. Asterisks represent significant differences (P < 0.05). Fig. 4. Circulating levels of FSH (A), LH (B), 17-estradiol (C) and inhibin (D) in control and EE-treated animals from PND3 to PND21. Asterisks represent significant differences (P < 0.05). Fig. 5. Immunostaining for P450arom in control (A) and EE-treated (B) ovaries at PND21. Bars, 200 m. Fig. 6. mRNA expression of kisspeptin in the AVPV and ARC of the hypothalamus in control and EE-treated animals from PND7 to PND21. Asterisks represent significant differences (P < 0.05).
24
Figr-1
25
Figr-2
26
27
Figr-3
28
Figr-4
29
30
Figr-5
31
Figr-6
32
Table 1. Nucleotide sequences of primers used for real-time PCR. Gene P450c17 P450arom Inhibinsubunit Inhibin/activin subunit A Inhibin/activin subunit B GAPDH
Forward 5’-CCATCCCGAAGGACACACAT3’ 5’-GAACGGTCCGCCCTTTCT-3’ 5’GCTCTACCAGGGAGCATGAG-3’ 5’-TTTCTGTTGGCAAGTTGCTG3’ 5’-GCCACGTATCCCTGACTTGT3’ 5’GGCACAGTCAAGGCTGAGAAT G-3’
33
Reverse 5’-CTGGCTGGTCCCATTCATTT-3’ 5’TGGATTCCACACAGACTTCTACCA -3’ 5’-CACCTTCCTCCTAGCTGACG-3’ 5’-CGGGTCTCTTCTTCAAGTGC-3’ 5’-CTGCTCCATGGTCTCTGTGA-3’ 5’-ATGGTGGTGAAGACGCCAGTA3’
S0378-4274(17)30191-1 http://dx.doi.org/doi:10.1016/j.toxlet.2017.05.014 TOXLET 9771
To appear in:
Toxicology Letters
Received date: Revised date: Accepted date:
23-12-2016 14-4-2017 12-5-2017
Please cite this article as: Zhang, Haolin, Taya, Kazuyoshi, Nagaoka, Kentaro, Yoshida, Midori, Watanabe, Gen, Neonatal exposure to 17␣-ethynyl estradiol (EE) disrupts follicle development and reproductive hormone profiles in female rats.Toxicology Letters http://dx.doi.org/10.1016/j.toxlet.2017.05.014 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Neonatal exposure to 17-ethynyl estradiol (EE) disrupts follicle development and reproductive hormone profiles in female rats Haolin Zhang1,2,3, Kazuyoshi Taya2, Kentaro Nagaoka2,3, Midori Yoshida4, Gen Watanabe2,3 1) Laboratory of Animal Physiology, College of Biological Sciences and Technology, Beijing Forestry University, Beijing 100083, PR China 2) United Graduate School of Veterinarian Science, Gifu University, Gifu5011193, Japan 3) Laboratory of Veterinary Physiology, Cooperative Department of Veterinary Medicine, Faculty of Agriculture, Tokyo University of Agriculture and Technology, Tokyo 183-8509, Japan 4) Division of Pathology, National Institute of Health Sciences, Tokyo 158-8501, Japan Abbreviated form of the title: EE Alters Reproductive Hormones Gen Watanabe, DVM, PhD, Professor Veterinary Physiology, Tokyo University of Agriculture and Technology Fuchu, Tokyo 183-8509, Japan Phone: +81-42-367-5768
Fax: +81-42-367-5767
Mail: [email protected] Highlights:
1
1. Neonatal exposure to EE retarded follicle development.
2. Neonatal exposure to EE elevated ovarian steroidogenesis and 17-estradiol at PND14.
3. Neonatal exposure to EE suppressed kisspeptin expression in the ARC at PND14.
4. Neonatal exposure to EE inhibited inhibin/activin A and B expression at PND21.
5. The disruptions in estrogens, inhibins/activins, and kisspeptin retarded follicular development
Abstract Toxic effects induced by exposure to endocrine-disrupting chemicals during fetal and neonatal periods can be irreversible and exert effects throughout an animal’s entire life. Our previous study showed that neonatal exposure to 17ethynyl estradiol (EE) induced irregular estrous cycle in adults. To uncover the reason for the delayed effect after neonatal exposure to EE, reproductive parameters including ovarian weight, ovarian steroidogenesis, and hormonal profiles were investigated in developing female rats. Ovarian weight decreased at postnatal days (PND) 14 and 21 after neonatal exposure to EE. Ovarian histology at PND21 showed that the ratio of follicles with a diameter >300 m decreased and the ratio of follicles with a diameter of 100-150 m increased in EE-treated ovaries, indicating that neonatal exposure to EE retarded follicular development. Moreover, the expression of P450arom increased at PND14 and the expressions of inhibin/activin subunits A and B decreased at PND21 in EE-treated ovaries. Consistent with the expression of P450arom, circulating levels of 17-estradiol increased at PND14 in EE-treated animals. Furthermore, the circulating levels of luteinizing hormone (LH) also increased at PND14 in the treated animals. Although the expression of Kiss1 did not change in the anteroventral periventricular nucleus (AVPV) of the hypothalamus between
2
controls and EE-treated rats, the expression of Kiss1 was reduced in the arcuate nucleus (ARC) of the hypothalamus at PND14. Based upon those results, we suggest that neonatal exposure to EE disrupted the system regulating the interactions between the reproductive hormones and follicle development in pre-pubertal rats, which may result in reproduction dysfunction in adulthood. Keywords: 17-ethynyl estradiol (EE); Endocrine-disrupting chemicals; Inhibins/Activins; Ovary; Steroid hormones.
3
1. Introduction Endocrine-disrupting chemicals (EDCs) are referred to as man-made or natural chemicals that may interfere with the body’s endocrine system (Diamanti-Kandarakis et al., 2009). EDCs have been proven to associated with reproductive dysfunction, abnormal fetal development, breast cancer, or other physiologic defects or diseases (Casals-Casas and Desvergne, 2011; Patisaul and Adewale, 2009; Soto and Sonnenschein, 2015; Unuvar and Buyukgebiz, 2012). Importantly, exposure to EDCs during the fetal and neonatal periods could be very risky, and the toxic effects experienced during these critical periods might be irreversible and last into adulthood (Diamanti-Kandarakis et al., 2009). Many man-made EDCs have been found in the environment, such as 17α-ethynyl estradiol in water, bisphenol A in food product, and nitrophenols in diesel exhaust (Laurenson et al., 2014; Noya et al., 2008; Pivnenko et al., 2015; Furuta et al., 2004). Due to the increasing public concern regarding EDCs and human and animal health in recent years, basic data collection on the adverse effects of EDCs on human and animal physiology have become increasingly important. 17α-ethynyl estradiol (EE) is a type of synthetic estrogen that has been used as an oral contraceptive for women, and has now become a well-known EDC in the environment since it enters the aquatic environment via wastewater discharge (Combalbert and Hernandez-Raquet, 2010; Pedersen et al., 2005). Many reports from experimental animals showed that neonatal exposure to EE in rats induced reproductive dysfunction during adulthood (Mandrup et al., 2013; Mathews et al., 2009; Sawaki et al., 2003; Shiorta et al., 2012; Takahashi et al.,
4
2013). Our previous study showed earlier disrupted estrous cycles, shorter reproductive lifespan, and disrupted expression of Kiss1 in the hypothalamus occurred in adult rats after neonatal exposure to EE (Nozawa et al., 2014; Usuda et al., 2014). However, the molecular or physiologic changes in the prepubertal rats after neonatal exposure to EE remain unclear. The hypothalamic-pituitary-ovarian axis is the classically recognized reproductive axis (Christensen et al., 2012). Kisspeptin participates in the axis and stimulates the production of gonadotropin-releasing hormone (GnRH) in the hypothalamus, and GnRH, in turn, stimulates the secretion of gonadotropins, including follicle-stimulating hormone (FSH) and luteinizing hormone (LH) from the pituitary; the gonadotropins then promote steroidogenesis by stimulating the expression of steroidogenic enzymes, including cytochrome P450 17hydroxylase/17,20 lyase (P450c17) and cytochrome P450 aromatase (P450arom) in the ovary (Andersen and Ezcurra, 2014). In addition, the ovary produces activins and inhibins to promote or inhibit gonadotropin production (Christensen et al., 2012). It remains unclear as to how neonatal exposure to EE influences the hypothalamic-pituitary-ovarian axis, especially concerning hormonal profiles. The aim of the present study is to investigate steroidogenic enzyme expression in developing ovaries, and to evaluate changes in peptide and steroid hormone profiles in pre-pubertal rats due to EE treatment. 2. Materials and methods 2.1 Animals
5
Male and female Wistar-Imamichi rats were purchased from SLC (Shizuoka, Japan) and maintained at 23 ± 2 ˚C under a 14-hour light/10-hour dark lighting schedule (lights on from 05:00 to 19:00 h). Labo MR Breeder (Nosan, Kanagawa, Japan) was used as the basal diet for rats. Food and tap water were given ad libitum. After mating and delivery, female pups were used for the experiment. All procedures were carried out in accordance with the guidelines established by Tokyo University of Agriculture and Technology (23-1). 2.2 Experimental design Newborn female pups were assigned to one of the following neonatal treatments: either controls, given sesame oil vehicle alone (control group); or EE at 200 μg/kg. Treatments were administered within 24 hours of delivery, i.e., postnatal day 0 (PND0), by subcutaneous (sc) injection in the nape of the neck. All compounds were dissolved in sesame oil. The dosage was determined based upon our preliminary results and previous reports (Nozawa et al., 2014; Takahashi et al., 2013, Usuda et al., 2014), and the clear toxicologic effects induced in the female reproductive system after neonatal exposure to 200 μg/kg EE. All rats were killed by decapitation and the blood samples were collected at PND1, PND3, PND7, PND14, and PND21. To obtain enough serum for the measurement of hormones, blood from 2-3 different animals was pooled for each sample. A total of 5-10 samples was obtained for each group at PND1 (n=10), PND3 (n=9), PND7 (n=8), PND14 (n=5), and PND21 (n=5) for subsequent hormonal measurement. 2.3 Histology
6
Ovaries were collected from each animal and fixed in 4% paraformaldehyde, embedded in paraffin, serially sectioned at 6 μm, and stained with hematoxylin and eosin. The diameters of all antral follicles in ovaries at PND21 were measured every five sections using an ocular micrometer. The size of each follicle was determined by measuring the diameter, as determined by vertical and horizontal measurements in the section that passed through the nucleus of an oocyte, and these were then averaged. The diameter was measured to the limits of the granulosa cell membrane. Follicles were classified according to size into five arbitrary groups (100-150 μm, 151-200 μm, 201-250 μm, 251-300 μm and more than 300 μm). In this colony of rats, all follicles larger than 301 µm in diameter had a developed antral cavity. The antral follicles with a clear oocyte nuclear were examined in a total of 80 sections per ovary (n=3 for each group). 2.4 Immunohistochemistry Serial sections of ovaries (n=5 for each group) were incubated with 10% normal goat serum to reduce background staining caused by the second antibody. Then the sections were incubated with primary antibody, human placental P450arom (R-8-1; kindly provided by Dr. Y. Osawa, Medical Foundation of Buffalo, Buffalo, NY, USA) or proliferating cell nuclei antigen (PCNA) antibody (Thermo Fisher Scientific, Rockford, IL, USA, #13-3900) overnight at 4℃. The sections were then incubated with a secondary antibody, anti-rabbit lgG conjugated with biotin and peroxidase with avidin, using a rabbit or mouse VECTASTAIN ABC kit (Vector lab., Burlingame, CA, USA), and subsequently visualized with diaminobenzidine (Sigma-Aldrich, St. Louis, MO, USA) as a chromogen substrate. Finally, the reacted sections were 7
counterstained with hematoxylin solution. The control sections were treated with normal rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or normal mouse IgG (EMD Millipore, Temecula, MA, USA #12-371) instead of the primary antibodies. Images were captured using an immunofluorescence microscope, BX-51 (Olympus, Tokyo, Japan). Five sections from each sample were selected randomly for measurement of staining intensity. The intensity of staining was evaluated by ImageJ software (Schindelin et al., 2012) and the optical density was calculated by measuring the mean gray level of the DAB staining color channel after color deconvolution. The relative optical density was compared between control and EE-treated ovaries. 2.5 QRT-PCR analysis Brain samples were cut on dry ice using a stainless steel brain matrix and either the anteroventral periventricular nucleus (AVPV) or the arcuate nucleus (ARC) was collected according to the rat brain atlas. Total RNA was extracted from ovaries or brains using TRIzol Reagent (Invitrogen Co., Carlsbad, CA, USA) according to the manufacturer’s protocol, and cDNA was synthesized using a PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio Inc., Shiga, Japan). The oligonucleotide primers for qRT-PCR analysis were designed using the Primer 3 program (Table 1). The PCR reactions were carried in a 10-μl volume using ExTaqR Hot Start Version containing SYBR-Green I (Takara Bio Inc., Shiga, Japan) and performed with a chrome4 Real-Time PCR System (Bio-Rad, Richmond, CA, USA) using the following conditions: 95℃ for 30 sec, followed by PCR reaction by 40 cycles of 95℃ for 5 sec, 60℃ for 30 sec, and a dissociation protocol. The expression level of each target mRNA relative to 8
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was determined using the 2-ΔΔCt method (n=5 for each group). 2.6 Hormone Assay Serum concentrations of LH and FSH were measured using National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) rat radioimmunoassay (RIA) kits
(Bethesda, MD,USA). Iodinated preparations
were rat LH-I-7 and rat FSH-I-7, and the antisera were anti-rat LH-S-10 and anti-rat FSH-S-11, respectively. The results were expressed in terms of NIDDK rat LH-RP-3 and FSH-RP-2.; and the intra- and inter-assay coefficients of variations were 5.4% and 11.2% for LH, and 7.2% and 15.7% for FSH, respectively. Serum concentrations of 17-estradiol were measured using 125I-labeled radioligands ([125I] MP01738226, MP Biomedicals, Santa Ana, CA, USA). Antiserum to 17-estradiol (GDN244) was kindly provided by Dr. G.D. Niswender (Fort Collins, CO, USA). The intra- and inter-assay coefficients of variation were 3.4% and 5.2% for 17-estradiol, respectively (Taya et al., 1985). Serum concentrations of immunoreactive (ir-) inhibin were measured using rabbit antiserum against bovine inhibin (TNDH-1) and 125I-labeled 32-kDa bovine inhibin (Hamada et al., 1989). The intra- and inter-assay coefficients of variation were 7.1% and 14.7% respectively. All samples to be compared were analyzed in the same assay. 2.7 Statistical analysis
9
Statistical comparisons were made with the Student’s t-test or one-way ANOVA followed by Tukey’s multiple-range test using Prism 5 (GraphPad Software, Inc., CA, USA). A value of P < 0.05 was considered an indication of statistical significance. 3. Results 3.1 Body and ovarian weights The body weights (Fig. 1A) and ovarian weights (Fig. 1B) were assessed in the control and EE-treated rats at developmental stages. There was no significant difference in body weight between the control group and EEtreatment group from PND1 to PND21. However, there were significant decreases in the ovarian weight of EE-treated rats at PND14 and PND21. 3.2 Cell proliferation and histologic examination of the ovaries at PND21 Due to the decreased ovarian weights in the EE-treatment group, cell proliferation and ovarian histology were then evaluated at PND21. The PCNA staining in controls (Fig. 2A-E) and EE-treated ovaries (Fig. 2F-J) are shown in Fig. 2. PCNA staining was observed in theca cells, granulosa cells, and oocytes in various types of follicles. However, there was little difference between control and EE-treated ovaries, which indicates that cell proliferation was not different between control and EE-treated ovaries. Ovarian histology was also examined in the controls and EE-treated animals (Fig. 2K and L, respectively). The percentage of different sized follicles in ovaries is shown in Fig. 2M. The number of follicles with a diameter >300 μm was greater in control ovaries compared with EE-treated ovaries. Conversely, 10
the number of follicles with a diameter between 100 and 150 μm was less in control ovaries than in EE-treated ovaries (Fig. 2M). 3.3 The expression of steroidogenic enzymes and inhibin/activin subunits in developmental-stage ovaries To elucidate a reason for the disrupted follicle development, gene expressions for the steroidogenic enzymes and inhibin/activin subunits in these ovaries were investigated by real-time PCR. There was no difference in the expression of P450c17 in the developmental-stage ovaries of control and EE-treatment groups from PND1 to PND21 (Fig. 3A). The expression of P450arom in the EEtreated ovaries increased significantly compared with that in the control ovaries at PND14 (Fig. 3B). The expression of inhibin was not changed by EE exposure, but the expressions of inhibin/activin subunits A and B were decreased by EE exposure at PND21 (Fig. 3C-E). 3.4 Hormonal changes in control and EE-treated rats The different reproductive hormones, including gonadotropins, 17β-estradiol, and inhibin were investigated in control and EE-treated rats from PND3 to PND21. Though there were no differences in circulating FSH levels between the control and EE-treatment groups (Fig. 4A), the levels of circulating LH were significantly higher in the EE-treated rats when compared with the control rats at PND14 (Fig. 4B). There was a peak in 17β-estradiol concentrations in both the control and EE-treated rats at PND14; however, the level of 17β-estradiol was significantly higher in the EE-treated rats than in the control rats at PND14 (Fig. 4C). The circulating levels of inhibin were constant and attenuated from PND3
11
to PND14, and increased to a relatively high level at PND21. However, there was no significant difference in the inhibin concentration between controls and EE- treated groups from PND3 to PND21 (Fig. 4D). 3.5 The immunolocalization of P450arom in ovaries at PND14 To confirm the expression of P450arom in the ovary at PND14, we performed immunostaining for P450arom. P450arom was found to localize in the theca cells, interstitial cells, and granulosa cells at PND14 in the control and EEtreated ovaries (Fig. 5). According to the optical densities with respect to DAB staining, there was a slight decrement in the optical density of P450arom in the control ovaries compared to the EE-treated ovaries. 3.6 The expression of kisspeptin in the hypothalamus of developmental rats Although the expression of kisspeptin in the AVPV of the hypothalamus was not different between controls and EE-treated rats (Fig. 6A), the expression of kisspeptin in the ARC of the hypothalamus decreased in the EE-treated group compared with that in the control group at PND14 (Fig. 6B). 4. Discussion The adverse effects of exposure to EDCs have been studied for many years, and the connection between neonatal exposure to EDCs and health defects during adulthood have been reported previously (Herath et al., 2001a; Mandrup et al., 2013; Mathews et al., 2009; Sawaki et al., 2003; Shiorta et al., 2012; Takahashi et al., 2013). In our previous studies, neonatal exposure to EE induced disrupted estrous cycles in adulthood (Nozawa et al., 2014; Usuda et al., 2014). To clarify the mechanism(s) for this delayed effect, we evaluated in 12
the present study the influence of EE on ovarian development in the prepubertal period. Our results showed that ovarian weight was attenuated at PND14 and PND21. Moreover, the mean size of antral follicles was diminished in the EE- treated ovaries. These results suggest that the decreased ovarian weight is due to impaired follicular development with EE. Estrogen plays an important role in overall ovarian function and follicular development specifically (Adashi, 1994; Britt et al., 2004). The high dose of 17-estradiol might delay or inhibit oocyte meiotic maturation and induce abnormal follicle development (Tarumi et al., 2014). The increased circulating 17-estradiol accompanying the increased expression of P450arom was found in the EE-treated rats at PND14, which is the time for the antral follicle formation (Herath et al., 2001b); and the increased 17-estradiol at PND14 in the EE-treatment group may retard follicle development and result in a higher ratio of smaller-sized follicles at PND21. The localization of P450arom also indicates that EE treatment may disrupt the functions of theca and granulosa cells in the developmental follicle. Furthermore, the increased P450arom expression and circulating 17-estradiol levels in the EE-treatment group may be due to the elevated circulating LH at PND14, since increased LH may promote steroidogenesis via its receptors in somatic cells (Strott et al., 1969). Previous reports showed that EE is a small molecule that easily passes the blood-brain barrier (BBB) and exerts actions in the developing brain (Scallet and Meredith, 2002; Stanczyk et al., 2013). Therefore, altered circulating LH levels may also indicate that neonatal EE exposure might affect the hypothalamicpituitary axis, and kisspeptin has been proven to be a regulator of the
13
hypothalamic-pituitary-gonadal axis (Okamura et al., 2013; Roa et al., 2011). Previous reports showed that EDCs can induce epigenetic effects on gene expression in exposed individuals (Iqbal et al., 2015; Manikkam et al., 2013; Skinner, 2014, 2016), and that estrogenic compounds can regulate the expression of kisspeptin via acetylation and deacetylation (Tomikawa et al., 2012). The present data showed that a single neonatal exposure to EE changed kisspeptin expression after two weeks, which suggests that EE may regulate kisspeptin expression in the developing hypothalamus via an epigenetic pathway. We know that kisspeptin neuron subpopulations localized in the AVPV regulate or in the ARC constitute the LH surge or pulse regulator, respectively (Putteeraj et al., 2016). Decreased kisspeptin expression in the ARC at PND14 may then reduce LH pulse frequency and influence follicle development. Although we could not explain the increase in circulating LH concentrations concomitant with decreased expression of kisspeptin in the ARC of the hypothalamus after EE exposure at PND14, we could not exclude the possibility that EE directly influences LH expression or secretion in the pituitary. Inhibins and activins comprise important factors involved in ovarian function and development (Knight et al., 2012; Reader and Gold, 2015; Wijayarathna and de Kretser, 2016). Several investigators have shown that activin can promote follicle development, particularly large or antral follicles (Li et al., 1995; Thomas et al., 2003). In the present study, although neonatal exposure to EE did not affect inhibin, we observed altered expression of inhibin/activin subunits A and B at PND21 in the EE-treated animals. This indicates to us that neonatal exposure to EE may decrease activin production from the ovary.
14
Simultaneously, the mean size of antral follicles was decreased at PND21 in the EE-treatment group. There are reports that activin A induces FSH receptors in granulosa cells of follicles in vitro and in vivo (Hasegawa et al., 1988; Nakamura et al., 1993); and together with our results, this suggests that EE may reduce expression of inhibin/activin subunits A and B, and thereby decelerate follicular growth at PND21. Previous reports showed that neonatal exposure to EE induced delayed effects in the female rat (Takahashi et al., 2013; Nozawa et al., 2014; Usuda et al., 2014). The period from PND0 to PND10 is the critical window for susceptibility for these delayed effects since exposure to EE during this period induces reproductive dysfunction in the adult (Ichimura et al., 2015). The dose range for the induction by EE of abnormal estrous cycle was verified between 0.2 μg/kg and 2000 μg/kg (Takahashi et al., 2013; Nozawa et al., 2014). Our previous results showed that neonatal exposure to EE directly affected ovarian development by inhibiting oocyte apoptosis and disrupting follicle formation (Zhang et al., 2016). Moreover, neonatal exposure to EE also impaired ovarian function by affecting the hypothalamic-pituitary axis and kisspeptin expression. Although there were some conflicting data between previous reports (Takahashi et al., 2014, 2016) and the present data, kisspeptin expression was generally suppressed in the hypothalamus after neonatal exposure to EE. These toxic effects in the early developmental stages by neonatal EE exposure may be the reason for the reproductive deficits observed in the adult period. In conclusion, the present study showed that neonatal exposure to EE could alter kisspeptin expression in the hypothalamus and circulating concentrations 15
of gonadotropins, which then disrupted the expression of steroidogenic enzymes and inhibin/activin subunits in the developing ovary and also circulating 17-estradiol. This early disruption in the hypothalamus and the impaired follicle development due to neonatal exposure to EE may relate to the delayed effects observed in the adult period. Acknowledgments We are grateful to Dr. A.F. Parlow and the Rat Pituitary Hormone Distribution Program (NIDDK, NIH, Bethesda, MD, USA) for rat LH and FSH RIA materials, Dr. G D Niswender, Colorado State University, Fort Collins, CO, USA for antisera to estradiol-17β (GDN224), and Dr. Y. Osawa, Medical Foundation of Buffalo, Buffalo, NY, USA, for an antibody to human placental P450 aromatase. We also thank to Dr. R.J. Hutz for the manuscript reading and grammar checking. This study was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (to KN, 26660248); and Health and Labour Science Research Grants, Research on Risk of Chemical Substance, Ministry of Health, Labour and Welfare, Japan (H25-Toxical-003).
16
References Adashi, E.Y., 1994. Endocrinology of the ovary. Hum. Reprod. 9, 815-827. Andersen, C.Y., Ezcurra, D., 2014. Human steroidogenesis: implications for controlled ovarian stimulation with exogenous gonadotropins. Reprod. Biol. Endocrinol. 12, 128. Casals-Casas, C., Desvergne, B., 2011. Endocrine disruptors: from endocrine to metabolic disruption. Annu. Rev. Physiol. 73, 135-162. Christensen, A., Bentley, G.E., Cabrera, R., Ortega, H.H., Perfito, N., Wu, T.J., Micevych, P., 2012. Hormonal regulation of female reproduction. Horm. Metab. Res. 44, 587-591. Combalbert,
S.,
Hernandez-Raquet,
G.,
2010.
Occurrence,
fate,
and
biodegradation of estrogens in sewage and manure. Appl. Microbiol. Biotechnol. 86, 1671-1692. Diamanti-Kandarakis, E., Bourguignon, J.P., Giudice, L.C., Hauser, R., Prins, G.S., Soto, A.M., Zoeller, R.T., Gore, A.C., 2009. Endocrine-disrupting chemicals: an Endocrine Society scientific statement. Endocr. Rev. 30, 293342. Furuta, C., Suzuki, A.K., Taneda, S., Kamata, K., Hayashi, H., Mori, Yoki, Li, C., Watanabe, G. , Taya, K., 2004. Estrogenic activities of nitrophenols in diesel exhaust particles. Biology of Reproduction 70, 1527-1533. Hamada,T., Watanabe,G., Kokuho,T., Taya,K., Sasamoto,S., Hasegawa,Y., Miyamoto,K., Igarashi,M. 1989. Radioimmunoassay of inhibin in various mammals. Journal of Endocrinology 122, 697-704. Hasegawa Y, Miyamoto K, Abe Y, Nakamura T, Sugino H, Eto Y, Shibai H.,
17
Igarashi M 1988 Induction of follicle stimulating hormone receptor by erythroid differentiation factor on rat granulosa cell. Biochemical and Biophysical Research Communications 156 668–674. Herath,C.B., Watanabe,G., Katsuda,S., Yoshida,M., Suzuki,A.K., Taya,K. 2001a. Exposure of neonatal female rats to p-tert-octylphenol disrupts afternoon surges of luteinizing hormone, follicle-stimulating hormone and prolactin secretion, and interferes with sexual receptive behavior in adulthood. Biology of Reproduction 64, 1216-1224. Herath,C.B., Yamashita, M., Watanabe,G., Jin, W.Z., Tangtrongsup, S., Kojima, A., Groome, N. P., Suzuki, A. K., Taya,K. 2001b. Regulation of folliclestimulating hormone secretion by estradiol and dimeric inhibins in the infantile female rat. Biology of Reproduction 65, 1623-1633. Iqbal, K., Tran, D.A., Li, A.X., Warden, C., Bai, A.Y., Singh, P., Wu, X., Pfeifer, G.P., Szabo, P.E., 2015. Deleterious effects of endocrine disruptors are corrected in the mammalian germline by epigenome reprogramming. Genome Biol. 16, 59. Knight, P.G., Satchell, L., Glister, C., 2012. Intra-ovarian roles of activins and inhibins. Mol. Cell Endocrinol. 359, 53-65. Laurenson, J.P., Bloom, R.A., Page, S., Sadrieh, N., 2014. Ethinyl estradiol and other human pharmaceutical estrogens in the aquatic environment: a review of recent risk assessment data. AAPS J. 16, 299-310. Li, R., Phillips, D.M., Mather, J.P., 1995. Activin promotes ovarian follicle development in vitro. Endocrinology 136, 849-856. Mandrup, K.R., Jacobsen, P.R., Isling, L.K., Axelstad, M., Dreisig, K., Hadrup, N.,
18
Vinggaard, A.M., Hass, U., Boberg, J., 2013. Effects of perinatal ethinyl estradiol exposure in male and female Wistar rats. Reprod. Toxicol. 42, 180191. Manikkam, M., Tracey, R., Guerrero-Bosagna, C., Skinner, M.K., 2013. Plastics derived endocrine disruptors (BPA, DEHP and DBP) induce epigenetic transgenerational inheritance of obesity, reproductive disease and sperm epimutations. PloS one 8, e55387. Mathews, E., Braden, T.D., Williams, C.S., Williams, J.W., Bolden-Tiller, O., Goyal, H.O., 2009. Mal-development of the penis and loss of fertility in male rats treated neonatally with female contraceptive 17alpha-ethinyl estradiol: a dose-response study and a comparative study with a known estrogenic teratogen diethylstilbestrol. Toxicol. Sci. 112, 331-343. Nakamura M, Minegishi T, Hasegawa Y, Nakamura K, Igarashi S, Ito I, Shinozaki H, Miyamoto K, Eto Y., Ibuki Y 1993 Effect of an activin A on folliclestimulating hormone (FSH) receptor messenger ribonucleic acid levels and FSH receptor expression in cultured rat granulosa cells. Endocrinology 133 538–544. Noya, Y., Mikami, Y., Taneda, S., Mori, Y., Suzuki, A.K., Ohkura, K., Yamaki, K., Yoshino, S., Seki, K., 2008. Improvement of an efficient separation method for chemicals in diesel exhaust particles: analysis for nitrophenols. Environ. Sci. Pollut. Res. Int. 15, 318-321. Nozawa, K., Nagaoka, K., Zhang, H., Usuda, K., Okazaki, S., Taya, K., Yoshida, M., Watanabe, G., 2014. Neonatal exposure to 17alpha-ethynyl estradiol affects ovarian gene expression and disrupts reproductive cycles in female
19
rats. Reprod. Toxicol. 46, 77-84. Okamura, H., Yamamura, T., Wakabayashi, Y., 2013. Kisspeptin as a master player in the central control of reproduction in mammals: an overview of kisspeptin research in domestic animals. Anim. Sci. J. 84, 369-381. Patisaul, H.B., Adewale, H.B., 2009. Long-term effects of environmental endocrine disruptors on reproductive physiology and behavior. Front Behav. Neurosci. 3, 10. Pedersen, J.A., Soliman, M., Suffet, I.H., 2005. Human pharmaceuticals, hormones, and personal care product ingredients in runoff from agricultural fields irrigated with treated wastewater. J. Agric. Food Chem. 53, 1625-1632. Pivnenko, K., Pedersen, G.A., Eriksson, E., Astrup, T.F., 2015. Bisphenol A and its structural analogues in household waste paper. Waste Manag. 44, 39-47. Putteeraj, M., Soga, T., Ubuka, T., Parhar, I.S., 2016. A “Timed” Kiss Is Essential for Reproduction: Lessons from Mammalian Studies. Front. Endocrinol. 7, 121. Reader, K.L., Gold, E., 2015. Activins and activin antagonists in the human ovary and ovarian cancer. Mol. Cell. Endocrin. 415, 126-132. Roa, J., Navarro, V.M., Tena-Sempere, M., 2011. Kisspeptins in reproductive biology: consensus knowledge and recent developments. Biol. Reprod. 85, 650-660. Sawaki, M., Noda, S., Muroi, T., Mitoma, H., Takakura, S., Sakamoto, S., Yamasaki, K., 2003. In utero through lactational exposure to ethinyl estradiol induces cleft phallus and delayed ovarian dysfunction in the offspring. Toxicol. Sci. 75, 402-411.
20
Scallet,
A.C.,
Meredith,
J.M.,
2002.
Quantitative
three-dimensional
reconstruction: feasibility for studies of sexually dimorphic hypothalamic development in rats. Neurotoxicol. Teratol. 24, 81-85. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J.Y., White, D.J., Hartenstein, V., Eliceiri, K., Tomancak, P., Cardona, A., 2012. Fiji: an open-source platform for biological-image analysis. Nat. Methods. 9(7), 676682. Shiorta, M., Kawashima, J., Nakamura, T., Ogawa, Y., Kamiie, J., Yasuno, K., Shirota, K., Yoshida, M., 2012. Delayed effects of single neonatal subcutaneous
exposure
of
low-dose
17alpha-ethynylestradiol
on
reproductive function in female rats. J. Toxicol. Sci. 37, 681-690. Skinner,
M.K.,
2014.
Endocrine
disruptor
induction
of
epigenetic
transgenerational inheritance of disease. Mol. Cell. Endocrin. 398, 4-12. Skinner, M.K., 2016. Endocrine disruptors in 2015: Epigenetic transgenerational inheritance. Nat. Rev. Endocrinol. 12, 68-70. Soto, A.M., Sonnenschein, C., 2015. Endocrine disruptors: DDT, endocrine disruption and breast cancer. Nat. Rev. Endocrinol. 11, 507-508. Stanczyk, F.Z., Archer, D.F., Bhavnani, B.R., 2013. Ethinyl estradiol and 17betaestradiol
in
combined
oral
contraceptives:
pharmacokinetics,
pharmacodynamics and risk assessment. Contraception 87, 706-727. Strott, C.A., Yoshimi, T., Ross, G.T., Lipsett, M.B., 1969. Ovarian physiology: relationship between plasma LH and steroidogenesis by the follicle and corpus luteum; effect of HCG. J. Clin. Endocrinol. Metab. 29, 1157-1167.
21
Takahashi, M., Inoue, K., Morikawa, T., Matsuo, S., Hayashi, S., Tamura, K., Watanabe, G., Taya, K., Yoshida, M., 2013. Delayed effects of neonatal exposure to 17alpha-ethynylestradiol on the estrous cycle and uterine carcinogenesis in Wistar Hannover GALAS rats. Reprod. Toxicol. 40, 16-23. Tarumi, W., Itoh, M.T., Suzuki, N., 2014. Effects of 5alpha-dihydrotestosterone and 17beta-estradiol on the mouse ovarian follicle development and oocyte maturation. PloS one 9, e99423. Taya,K.,
Watanabe,G.
&
Sasamoto,S.,
1985.
Radioimmunoassay
for
progesterone, testosterone and estradiol-17β using 125I-iodohistamine radioligands. Japanese Journal of Animal Reproduction 31, 186-197. Thomas, F.H., Armstrong, D.G., Telfer, E.E., 2003. ctivin promotes oocyte development in ovine preantral follicles in vitro. Reprod. Biol. Endocrinol. 1:76-83. Tomikawa, J., Uenoyama, Y., Ozawa, M., Fukanuma, T., Takase, K., Goto, T., Abe, H., Ieda, N., Minabe, S., Deura, C., Inoue, N., Sanbo, M., Tomita, K., Hirabayashi, M., Tanaka, S., Imamura, T., Okamura, H., Maeda, K., Tsukamura, H., 2012. Epigenetic regulation of Kiss1 gene expression mediating estrogen-positive feedback action in the mouse brain. Proc. Natl. Acad. Sci. USA. 109, E1294-E1301. Unuvar, T., Buyukgebiz, A., 2012. Fetal and neonatal endocrine disruptors. J. Clin. Res. Pediatr. Endocrinol. 4, 51-60. Usuda, K., Nagaoka, K., Nozawa, K., Zhang, H., Taya, K., Yoshida, M., Watanabe, G., 2014. Neonatal exposure to 17alpha-ethinyl estradiol affects kisspeptin expression and LH-surge level in female rats. J. Vet. Med. Sci. 76,
22
1105-1110. Zhang, H., Nagaoka, K., Usuda, K., Nozawa, K., Taya, K., Yoshida, M., Watanabe, G., 2016. Estrogenic Compounds Impair Primordial Follicle Formation by Inhibiting the Expression of Proapoptotic Hrk in Neonatal Rat Ovary. Biol. Reprod. 95, 78.
23
FIGURE LEGENDS Fig. 1. Rat body and ovarian weight in the control and EE-treatment groups. PND, postnatal day. Fig. 2. PCNA staining in control (A-E) and EE-treated (F-J) ovaries at PND21. Rat ovarian histology in control (K) and EE-treatment (L) groups at PND21. (M) The average diameter of antral follicles in ovaries at PND21. Bars (A, F, K and L), 200 m. Bars (B-E, G-J), 20 m. Asterisks represent significant differences (P < 0.05). Fig. 3. mRNA expression of P450c17 (A), P450arom (B), inhibin subunit (C), inhibin/activin subunits A (D), and B (E) in control and EE-treated ovaries from PND1 to PND21. Asterisks represent significant differences (P < 0.05). Fig. 4. Circulating levels of FSH (A), LH (B), 17-estradiol (C) and inhibin (D) in control and EE-treated animals from PND3 to PND21. Asterisks represent significant differences (P < 0.05). Fig. 5. Immunostaining for P450arom in control (A) and EE-treated (B) ovaries at PND21. Bars, 200 m. Fig. 6. mRNA expression of kisspeptin in the AVPV and ARC of the hypothalamus in control and EE-treated animals from PND7 to PND21. Asterisks represent significant differences (P < 0.05).
24
Figr-1
25
Figr-2
26
27
Figr-3
28
Figr-4
29
30
Figr-5
31
Figr-6
32
Table 1. Nucleotide sequences of primers used for real-time PCR. Gene P450c17 P450arom Inhibinsubunit Inhibin/activin subunit A Inhibin/activin subunit B GAPDH
Forward 5’-CCATCCCGAAGGACACACAT3’ 5’-GAACGGTCCGCCCTTTCT-3’ 5’GCTCTACCAGGGAGCATGAG-3’ 5’-TTTCTGTTGGCAAGTTGCTG3’ 5’-GCCACGTATCCCTGACTTGT3’ 5’GGCACAGTCAAGGCTGAGAAT G-3’
33
Reverse 5’-CTGGCTGGTCCCATTCATTT-3’ 5’TGGATTCCACACAGACTTCTACCA -3’ 5’-CACCTTCCTCCTAGCTGACG-3’ 5’-CGGGTCTCTTCTTCAAGTGC-3’ 5’-CTGCTCCATGGTCTCTGTGA-3’ 5’-ATGGTGGTGAAGACGCCAGTA3’