Nerolidol attenuates cyclophosphamide-induced cardiac inflammation, apoptosis and fibrosis in Swiss Albino mice

European Journal of Pharmacology 863 (2019) 172666

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Full length article

Nerolidol attenuates cyclophosphamide-induced cardiac inflammation, apoptosis and fibrosis in Swiss Albino mice

T

Ashif Iqubala, Sumit Sharmaa, Mohd Asif Ansaria, Abul Kalam Najmia, Mansoor Ali Syedd, Javed Alic, M. Mumtaz Alamb, Shaniya Ahmadd, Haque Syed Ehtaishamula,∗ a

Department of Pharmacology, School of Pharmaceutical Education and Research, Jamia Hamdard, New Delhi, 110062, India Department of Pharmaceutical Chemistry, School of Pharmaceutical Education and Research, Jamia Hamdard, New Delhi, 110062, India c Department of Pharmaceutics, School of Pharmaceutical Education and Research, Jamia Hamdard, New Delhi, 110062, India d Department of Biotechnology, Jamia Millia Islamia, New Delhi, 110025, India b

A R T I C LE I N FO

A B S T R A C T

Keywords: Cardioprotection Oxidative stress p-NF-κB p65 Cleaved caspase 3 BNP Molecular docking

Incidence and prevalence of cancer is an alarming situation globally. For the treatment of cancer many anticancer drugs have been developed but, unfortunately, their potential cardiotoxic side effects raised serious concerns about their use among clinicians. Cyclophosphamide is a potent anticancer and immunosuppressant drug but its use is limited due to cardiotoxic side effect. Thus, there is a need for the development of certain drug which can reduce cardiotoxicity and can be used as an adjuvant therapy in cancer patients. In this direction we, therefore planned to evaluate nerolidol (NER) for its cardioprotective potential against cyclophosphamide-induced cardiotoxicity in Swiss Albino mice. Animals were divided into 6 groups. Vehicle control; Cyclophosphamide (CP 200); NER 400 per se; NER 200 + CP 200; NER 400 + CP 200; and fenofibrate (FF 80) + CP 200. Dosing was done for 14 days along with a single dose of CP 200 on the 7th day. On 15th day animals were sacrificed and various biochemical parameters pertaining to oxidative stress, nitrative stress, inflammation, apoptosis and fibrosis were estimated in the blood and heart tissues. Histopathological analysis (H & E and Masson's trichrome staining); ultrastructural analysis (transmission electron microscopy) and immunohistochemical analysis were also performed along with mRNA expression and molecular docking to establish the cardioprotective potential of nerolidol. Nerolidol acted as a potent cardioprotective molecule and attenuated CP-induced cardiotoxicity.

1. Introduction Cancer is a global menace accounting for more than 7.6 million deaths worldwide (Organisation, 2018). It has been reported that during 2017 around 1.69 million new cancer cases were diagnosed and 0.6 million deaths were reported in the US (Institute, 2018, 27 April). It is further estimated that by the end of 2030 deaths due to cancer may cross 13.1 million (Institute, 2018, 27 April). Considering the higher incidence and prevalence of cancer globally, many anticancer drugs have been developed but, unfortunately, their potential cardiotoxic side effects raised serious concerns about their use among clinicians (Lenneman and Sawyer, 2016). Thus, it becomes an extremely important task to understand and address this problem as it is directly related to the survival rate of patients on chemotherapy. Cyclophosphamide (CP) is one of the commonly used anticancer drugs used against multiple types of cancers (Park et al., 2018).

∗

Cyclophosphamide is also a potent immunosuppressant routinely used as a bolus and in management therapy during organ transplantation and against graft rejection (Elmariah et al., 2018). CP is a prodrug which when administered gets rapidly metabolized into 4-hydro-cyclophosphamide, aldophosphamide, phosphoramide mustard (PM) and acrolein in the liver (Jeelani et al., 2017). PM is an anticancer moiety that acts on N-7 guanine residues of DNA and results in cell death (antitumor effect) whereas acrolein is reported to be cardiotoxic. Thus, it can be said that CP when administered, acts as an antitumor drug with noticeable cardiotoxicity (Iqubal et al., 2018a). It has been reported that when CP was used for the treatment of hematological malignancies, bone marrow transplantation and in other types of tumors, 11–43% of patients suffered from fatal cardiotoxicity and symptom was manifested within one to three weeks (Goldberg et al., 1986; Meserve et al., 2014). CP causes diverse range of cardiotoxic effects leading to oxidative stress, inflammation, membrane damage, apoptosis and

Corresponding author. E-mail address: [email protected] (S.E. Haque).

https://doi.org/10.1016/j.ejphar.2019.172666 Received 13 May 2019; Received in revised form 6 September 2019; Accepted 17 September 2019 Available online 18 September 2019 0014-2999/ © 2019 Elsevier B.V. All rights reserved.

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

ultrastructural changes (Song et al., 2016). These adverse changes caused by CP encouraged the researchers to develop certain adjuvant therapy which can reduce the cardiotoxicity. Thus, in this study, we also addressed the cardiotoxicity issue of CP by using Swiss Albino mice where cardiotoxicity was induced by administering CP at the dose of 200 mg/kg, i.p and nerolidol (NER) was evaluted for its cardioprotective potential. Nerolidol (NER), is an acyclic sesquiterpene (sesquiterpene alcohol) having molecular formula 3,7,11-trimethyl-1,6,10-dodecatrien-3-1 (Chan et al., 2016). Nerolidol is commonly used as bioactive ingredient in food (flavoring agent), cosmetic (shampoo) and in non-cosmetic (detergent, and skin penetration enhancers) industries (Chan et al., 2016). Nerolidol has been reported to possess neuroprotective, antiulcer, anti-leishmanial, anti-schistosomal, anti-malarial, anti-nociceptive and anti-tumor activity (Chan et al., 2016; De Carvalho et al., 2018; Fonsêca et al., 2016). Further, it is well known that terpenes at higher doses are clastogenic but interestingly nerolidol is relatively safe and LD50 for the mouse is 15000 mg/kg, p.o, (Fonsêca et al., 2016; Lapczynski et al., 2008). Additionally, nerolidol is endorsed by FDA, FEMA and WHO as “Generally Recognized as Safe (GRAS)” molecule (Lapczynski et al., 2008).

Table 1 Grouping and Treatment schedule. S. No.

Group (n = 6)

Dose, route, and duration

1. 2. 3. 4.

Vehicle control CP 200 (Toxic) NER per se NER 200 + CP 200

5.

NER 400 + CP 200

6.

FF 80 + CP 200

0.1 ml Tween 80, p.o. for 14 days CP 200 mg/kg, i.p. once on 7th day NER 400 mg/kg, p.o. for 14 days NER 200 mg/kg, p.o. for 14 days + CP 200 mg/ kg, i.p. once on 7th day NER 400 mg/kg, p.o. for 14 days + CP 200 mg/ kg, i.p. once on 7th day FF 80 mg/kg, p.o. for 14 days + CP 200 mg/kg, i.p. once on 7th day

CP: Cyclophosphamide, NER: Nerolidol, and FF: Fenofibrate.

2.4. Molecular docking simulations Molecular docking studies of the test drug nerolidol and standard drug fenofibrate was performed on nuclear factor kappa-light-chainenhancer of activated B cells (NF-κB) receptor catalytic ligand binding site using Glide module of Maestro version 9.4 software, Schrödinger. The 3-Dimensional crystallographic X-ray protein structure of NF-κB was downloaded from the RCSB protein data bank. The 3-D structure was downloaded in.pdb file format. Crystallographic water molecules i.e. exhibiting less than three hydrogen bonds were deleted and hydrogen bonds corresponding to pH 7 were added considering the appropriate ionization states for both acidic and basic amino acid residues. The OPLS_2005 force field will be used for energy minimization of the crystal structure. The molecular interaction of ligands with the receptor was analyzed and a map of hydrophobic and hydrophilic interaction of the constituents at active ligand binding site of NF-κB receptor was recorded through ligand interaction diagram in 3-D and 2-D format.

2. Materials and methods 2.1. Drugs and chemicals Cyclophosphamide (Endoxan®, Batch No AEU1040) was obtained from Baxter Oncology GmbH, Frankfurt Germany. Nerolidol CAS No 7212-44-4, Lot# STBG8020 was purchased from Sigma Aldrich (St. Louis, Missouri, United States). Antibodies, p-NF-κB p65, caspase 3 and iNOS was procured from Santa Cruz Biotechnology Dallas, Texas, United States. For estimation of LDH and CK-MB, kits were procured from Arkray Healthcare, Santacruz and Reckon Diagnostic, India, respectively. ELISA kits for interleukins, cardiac troponin T (cTn-T) and brain natriuretic peptide (BNP) were procured from krishgen Biosystems, Worli, Mumbai, India and Biocodon Technologies, USA, respectively.

2.5. Estimation of oxidative and nitrative stress markers 2.5.1. Estimation of superoxide dismutase (SOD) activity SOD activity was determined according to the method of Marklund and Marklund (1974) which is based on the ability of SOD enzyme to inhibit the autoxdation of pyrogallol. 10 μl of cytosolic supernatant was mixed with the Tris HCl buffer and volume was adjusted with Tris HCl up to 3 ml. Now, 25 μl of pyrogallol was added into the mixture and change in absorbance was observed at 420 nm by using spectrophotometer. One unit (U) of SOD activity is defined as the amount of SOD enzyme that inhibited the autoxidation of pyrogallol by 50% per min. Value of SOD activity were expressed as U/mg of protein (Marklund and Marklund, 1974).

2.2. Experimental animals Male Swiss albino mice (35–40 g) were obtained from the Central Animal House Facility of Jamia Hamdard. The experimental protocol was approved by the Institutional Animal Ethics Committee of Jamia Hamdard (IAEC/JH-1484). Animals were allowed to acclimatize for one week and housed in standard polypropylene cages and had access to commercial standard pellet diet. Animals were maintained under controlled room temperature (23 ± 2°C) and relative humidity (60 ± 5%) with 12 h light/12 h dark cycle in the Central Animal House Facility, Jamia Hamdard, New Delhi, India.

2.5.2. Estimation of catalase activity (CAT) Catalase activity was determined according to the method of Claiborne, 1986). 10 μl of cytosolic supernatant was mixed with the 2.95 ml solution of H2O2 (19 mM) that was prepared by mixing 1.95 ml phosphate buffer (0.5 M, pH 7.0) and 1 ml of H2O2 (19 mM). Rate of disappearance of H2O2 was measured at 240 nm and expressed as nmoles of H2O2/min/mg of protein (Claiborne, 1986).

2.3. Treatment protocol Animals were randomly divided into 6 groups (n = 6) and treated for 14 days as per Table 1. After 24 h of the last dose, animals were weighed, blood was collected from the tail vein using urethane (1 g/kg) and serum was prepared for biochemical estimations. Animals were then euthanized and hearts were removed, washed with the normal saline and weighed. A section of heart tissue was kept in 10% formalin for histopathology, in modified Karnovasky's fluid for ultrastructural analysis (TEM) and rest preserved at −20° for biochemical estimtions. CP 200 mg/kg i.p., NER 200 mg/kg i.p., 400 mg/kg i.p., and FF 80 mg/kg, i.p., dose selection and treatment schedule were based on the literature published earlier (Ashry et al., 2013; Fonsêca et al., 2016; Khuchua et al., 2018; Song et al., 2016).

2.5.3. Estimation of reduced glutathione (GSH) GSH was estimated according to the method of Sedlak and Lindsay (1968). 10 μl of cytosolic supernatant was prepared by mixing with EDTA and TCA. This supernatant was then mixed with 4.0 ml of 0.4 M Tris buffer (pH 8.9). The mixture so formed was further mixed with 0.1 ml of 0.01 M DTNB and absorbance was taken at 412 nm within 5 min of addition of DTNB. Value of GSH were expressed as μmol/mg of protein (Sedlak and Lindsay, 1968). 2

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

37 °C for 10 min in dark. After 10 min, 50 μl of provided stopping reagent was added into the wells and the color that changed from blue to yellow was recorded at 450 nm within 15 min.

2.5.4. Estimation of lipid peroxidation Extent of lipid peroxidation was determined by performing TBARS assay that estimated the level of malondialdehyde. Malondialdehyde is the end product and well-accepted marker of lipid peroxidation. Assay was performed according to the method of Ohkawa et al. (1979). Weighed amount of tissue was homogenized at 7826×g for 10 min. 0.5 ml of 30% TCA and 0.8% TBA was added into homogenate. This mixture was placed on the boiling water bath for 10 min maintained at 80 °C followed by its cooling in ice-cold water for 10 min. Absorbance of supernatant was taken at 540 nm and value of TBARS were expressed as nmol MDA/mg protein (Ohkawa et al., 1979).

2.7. Histopathological, immunohistochemical and ultrastructural (transmission electron microscopy) analysis For H & E staining, Masson's trichrome (MT) staining and immunohistochemical analysis heart tissues were fixed in 10% formalin, sliced and embedded in paraffin wax. 5 μm thick sections were cut transversally and further processed according to the method published earlier (Nakada et al., 2017; Sharma et al., 2018). Photomicrographs were taken with a computer-enabled Motic microscope. Semi-quantification of MT stained sections and protein expression (cleaved caspase 3, p-NF–κB p65 and iNOS) was done by reciprocal intensity method using Fiji (Image J) software. The range of pixel intensities of images was in between 0 to 250. Value 0 and 250 indicated the darkest and the lightest shade of image color, respectively. For transmission electron microscopy, the sample was directly fixed in modified Karnovasky's fluid and embedded in CY212. Ultrathin sections (60–80 nm) were stained with alcoholic acetone and lead citrate and examined under transmission electron microscope TECNAI 200 kv TEM (Fei, electron optics, Hillsboro, USA).

2.5.5. Estimation of Nitric oxide (NO) NO was estimated according to the method of Richa et al. (2017). 10 μl of test sample was transferred to 96 well plate. Similarly, 50 μl of standard sodium nitrate and sulphanilamide solution (1% Sulphanilamide in 5% phosphoric acid) were also transferred to these wells. Plate was incubated at room temperature for 10 min then 0.1% N-1-Napthylethylenediamine dihydrochloride (NED) was added. After this addition, plate was again incubated at room temperature for 10 min. As the purple color appeared, absorbance was taken at 520 nm within 30 min (Richa et al., 2017). 2.6. Estimation of cardiac injury markers

2.8. RNA extraction and RT-PCR 2.6.1. Estimation of lactate dehydrogenase (LDH) Assay for the estimation of LDH was based on the kinetic assay method and performed by using commercially available kit procured from Arkray Healthcare, Santacruz Mumbai (AUTOSPAN liquid gold LDH assay kit). Kit comprised of reagent I (20 tablets containing NAD and lactate) and reagent II (containing buffer substrate). First of all, working reagent was reconstituted by mixing one tablet from reagent I with 1.1 ml buffer substrate from reagent II. This mixture was gently mixed and used after 5 min. After 5 min, 1 ml of prepared working reagent was taken in the test tube and 50 μl of tissue homogenate was added into it. First absorbance was taken after 60 s of addition of homogenate and thereafter at the gap of 30, 60 and 90 s at 340 nm. Mean change in the absorbance per min was determined and values were expressed as IU/L.

RNA extraction was done using TRIZOL (Ambion, Carlsbad) according to the manufacturer's protocol. 500 ng of RNA was reverse transcribed into cDNA using Bio-Rad's iScript cDNA synthesis kit. cDNA was amplified using PCR green mastermix (Promega, Madison, USA) to estimate the expression of inducible Nitric oxide synthase (iNOS), Transforming Growth Factor-β1(TGF-β1), Connective Tissue Growth Factor (CTGF) and Actin. PCR conditions were as follow- Initial denaturation at 95̊ C for 5 min, then denaturation at 95̊ C for 45 s, annealing 1 min at 60 °C for iNOS, 55 °C for TGF-β1, 52 °C for CTGF and 50 °C for Actin. Extension at 72̊ C for 1 min and final extension at 72̊ C for 5 min and PCR cycle number was 35. PCR product was then subjected to 1% agarose electrophoresis containing EtBr (1 mg/ml). Gel was then visualized using Bio-Rad Gel Doc EZ system and band intensity was then quantified using Image J software. Data normalization was done using endogenous control actin gene expression. The results of gene expression level are presented relative to actin expression. Primer sequences used for genes were: iNOS fwd-TCCTGGAGGAAGTGGGCCGAAG, RevCCTCCACGGGCCCGGTACTC-3; TGF-β1 fwd- AGGGCTACCATGCCAAC TTC, Rev- CCACGTAGTAGAACGATGGC; CTGF fwd-CAAAGCAGCTGC AAATACCA Rev- GGCCAAATGTGTCTTCCAGT and Actin fwd CTGTC CCTGTATGCCTCTG Rev- ATGTCACGCACGATTTCC.

2.6.2. Estimation of Creatine kinase–MB (CK-MB) CK-MB assay was performed by using commercially available kit procured from Reckon Diagnostics Pvt. Ltd. Baroda, India. Working reagent was prepared by mixing 0.8 ml of CKMB-I (containing BufferAntibody) and 0.2 ml of CKMB-II (Enzymes-Activator). After 15 min, 1 ml of working reagent was mixed with 50 μl of test sample and the first reading was recorded after 300 s followed by a gap of 30, 60, 90 & 120 s at 340 nm. Mean change in the absorbance per min was determined and values were expressed as IU/L.

2.9. Statistical analysis Data were expressed as mean ± S.E.M. Data were analyzed by oneway ANOVA followed by Tukey's test. In all the tests, values were considered statistically significant when P < 0.05. The statistical analysis was performed using Graph Pad Prism 4.0 software (Graph Pad Software San Diego, California, USA).

2.6.3. Estimation of cardiac troponin T (cTn-T) and brain natriuretic peptide (BNP) cTn-T and BNP estimation was done by using double-antibody sandwich ELISA kit procured from Biocodon Technologies, USA. All the reagents were brought to room temperature before use and the given procedure was followed which was same for both. In the first step, standard dilution was prepared according to the provided standard concentration and standard diluent. 50 μl of standards, 40 μl of test sample, 50 μl of cTn-T/BNP Biotin Conjugated Detection Antibody and 50 μl of Streptavidin-HRP conjugate were added into the respective wells. However, in the blank well only test sample was added. After addition plate was incubated at 37 °C for 1 h. After 1 h, plate was washed 4 times with the provided wash buffer and remaining buffer were blotted by gently tapping the plate on absorbent paper. After removal of residual buffer, 50 μl of substrate A and 50 μl of substrate B were added in all the wells including the blank well. Plate was than incubated at

3. Results 3.1. Molecular docking simulations In-silico study was carried out to predict and analyze the interaction and binding affinity of compounds at the catalytic ligand binding domain of NF–κB p65 protein, to obtain a better conception of NF–κB p65 inhibition by nerolidol and fenofibrate at the molecular level. The docking results represent that both the compounds (nerolidol and fenofibrate) interact and binds in a similar pattern to the catalytic amino 3

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

Fig. 1. (A) Binding mode and ligand interaction of nerolidol in the catalytic pocket of NF–κB p65 (PDB ID: 1LE5). (B) Binding mode and ligand interaction of fenofibrate in the catalytic pocket of NF–κB p65 (PDB ID: 1LE5). (C) Superimposing image of nerolidol and fenofibrate at the active binding site of NF–κB p65 (PDB ID: 1LE5).

3.4. Effect of nerolidol on the level of inflammatory markers in cardiac tissue

acid present at the active site of NF–κB p65 (Fig. 1). The molecular docking score for fenofibrate exhibited −5.73, whereas nerolidol displayed docking score of −5.22 which is quite comparable to fenofibrate. Nerolidol formed one hydrogen bond with the main backbone of the amino acid residue Asn 137 (Fig. 1 and Table 2) while fenofibrate formed one hydrogen bond with the side chain of amino acid residue Asn 137 and one π-π stacking with His 142 amino acid residues (Fig. 1 and Table 2). Nerolidol interacts with the catalytic ligand binding domain of NF–κB p65 by forming hydrophobic interactions with the amino acid residues as shown in Table 2. Docking score and molecular interactions manifested compatibility of the compounds in binding and fitting into the pocket of NF–κB p65.

Administration of CP 200 increased the pro-inflammatory (TNF-α, IL-6, and IL-1β) and decreased anti-inflammatory (IL-10) cytokines level (P < 0.001). Treatment with NER 400 (P < 0.01 vs. CP 200 for TNF-α; P < 0.001 vs CP 200 for IL-6, IL-10 and IL-1β) and FF 80 (P < 0.001 vs. CP 200 for TNF-α, IL-6, IL-10, and IL-1β) resulted in significant reduction of these inflammatory markers in cardiac tissue. However, treatment with NER 200 was found to be ineffective in normalizing the level of TNF-α, IL-6, IL-10 and IL-1β (P > 0.05 vs. CP). 3.5. Immunohistochemistry of p-NF–ĸB, iNOS and cleaved caspase 3

3.2. Effect of nerolidol on oxidative and nitrative stress markers

Treatment with CP 200 showed increased expression of cleaved caspase 3, Phosphorylated-NF–ĸB and iNOS in the cardiac tissue (P < 0.001). Treatment with NER 200 was found to be ineffective (P > 0.05) in reducing the expression of these transcription factors whereas NER 400 and FF 80 was found to be effective (P < 0.001) in reducing the expression level of p-NF–ĸB, iNOS, and cleaved caspase 3, as shown in Fig. 5 (A-C, I to VI and D-F).

CP-induced oxidative stress significantly reduced the activity of CAT and SOD whereas elevated the level of GSH, TBARS and nitrite as compared to the control group in cardiac tissue (P < 0.001). Treatment with NER 200 was found to be ineffective against altered SOD, CAT, TBARS and nitrite level (P > 0.05, NER 200 vs. CP 200), but showed significant protection against decreased GSH (P < 0.05, NER 200 vs. CP 200). However, NER 400 and FF 80 were found to be effective against SOD, CAT, GSH, TBARS, and nitrite levels in cardiac tissue (P < 0.001, NER 200 vs. CP 200), as shown in Fig. 2. NER per se exerted almost the same effect as exerted by the control group (Fig. 2).

3.6. Histopathological and ultrastructural analysis by H & E staining, Masson's trichrome (MT) staining and transmission electron microscopy (TEM) Histopathological analysis showed marked vacuolization, myofibrillar degeneration and pyknosis in CP-treated group. Treatment with NER 400 and FF 80 significantly attenuated the damage induced by CP administration in cardiac tissue as shown in Fig. 6. CP administration also caused marked fibrosis as evident from the Masson's trichrome staining where blue color showed the area of fibrosis. NER 400 and FF 80 significantly reduced the fibrotic lesions induced by CP administration, as shown in Fig. 7. TEM performed for the myocardium showed normal architecture of heart mitochondria and myofilament whereas treatment with CP 200 caused marked ultrastructural abberation leading to myofibruillar disintigration, damaged to Z-band and mitochondrial along with the vaculization.Treatment with NER 400 and FF 80 showed reduced damaged mitochondria and increased healthy

3.3. Effect of nerolidol on the level of cardiac injury markers Administration of CP 200 caused a significant increment (P < 0.001) in the level of cardiac injury markers like LDH, CK-MB, cTnT and BNP as compared to the control (Fig. 3). Treatment with NER 200 showed a significant reduction (P < 0.05) in the level of LDH but found ineffective in reducing CK-MB, troponin T and BNP. However, treatment with NER 400 and FF 80 resulted into significant reduction of these markers. The level of significance was found P < 0.01 for LDH, cTnT, BNP and P < 0.001 for CK-MB in NER 400 whereas in FF 80 it was P < 0.001 for all the parameters as shown in Fig. 3. 4

European Journal of Pharmacology 863 (2019) 172666

Nerolidol

mitochondria with marked improvement in irregular, disintegrated sarcomere and Z-band. NER per se showed normal myofilaments, mitochondria with intact nucleus and nuclear membrane thereby signifying non-deleterious effect on ultrastructural integrity in cardiomyocytes as shown in Fig. 8. For all the above analysis, treatment with NER 200 did not show any significant result. 3.7. mRNA expression of iNOS, CTGF and TGF-β1 RT-PCR analysis for the mRNA expression of iNOS and fibrotic markers such as CTGF and TGF-β1 showed marked elevation in their level in the CP 200 treated groups. Treatment with NER 400 and FF 80 significantly reduced the mRNA expression level of iNOS (Fig. 5F) and fibrotic markers such as CTGF and TGF-β1 in the cardiac tissue (Fig. 7). Treatment with NER 200 was found to be ineffective, as expression level of aforementioned markers were almost similar to CP 200. 4. Discussion Current study was focused with the aim to induce cardiotoxicity using CP at the dose of 200 mg/kg i.p and to see the protective effect of NER at the dose of 200 and 400 mg/kg p.o. Cardiotoxicity is manifested by increase in oxidative stress, calcium overload, reactive oxygen species, reactive nitrogen species, inflammation, apoptosis and other histological aberrations (Swamy et al., 2013; Tripathi and Jena, 2010). In healthy cardiomyocytes, reduced GSH, SOD and CAT take care of superoxide and peroxide ion which otherwise causes oxidative stress (Asiri, 2010; Iqubal et al., 2018b). In our study when we administered CP 200 mg/kg, found similar elevation in lipid peroxidation, reduction in antioxidant enzyme, SOD and CAT which confirmed cardiotoxicity. On treatment with NER 400 and FF 80 mg/kg, we found reversal of these parameters towards normal which indicates cardioprotection by elevation in antioxidants status (Fig. 2). This finding is in accordance with the previous findings and showed antioxidant properties of these drugs Asiri (2010); Avci et al. (2017); El-Sheikh et al. (2017). Treatment with NER 200 mg/kg however, did not show any significant changes in the level of these parameters (Fig. 2). One of the manifestations of myocardial injury is the release of troponin (cTnT), CK-MB and LDH from the myocardium due to membrane damage. These myocardial injury markers increase in serum and any drug which brings down the level of these markers to normal shows cardioprotection (Noszczyk-Nowak, 2011). In our study when we administered CP 200 mg/kg, i.p to mice, we found significant increase in the level of these markers (cTnT, CK-MB and LDH) and when treated the mice with NER 400 mg/kg and FF 80 mg/kg, we found their significant reversal to normal (Fig. 3, A-C). Thus, these biochemical markers showed membrane integrity and cardioprotection which goes fine with the previous findings Gore et al. (2016); Omole et al. (2018). Serum BNP level is clinically used as a diagnostic marker of heart failure (Noszczyk-Nowak, 2011). Increased level of BNP in serum indicates that cardiomyocytes are getting excess pre- and after-load which results into myocardial wall stretching leading to hypertrophy or heart failure (Kong et al., 2014). Earlier study also reported elevation in serum BNP level in patients with cardiac dysfunction leading to fibrosis (Colin et al., 2015). Further It has been reported that when the heart is exposed to a stressful or toxic stimulus, it results into myocardial wall stretching and myofibrillar disintegration leading to release of this marker from cardiac tissue into the blood (Nafees et al., 2015; Shanmugarajan et al., 2008). In the present study, administration of CP 200 mg/kg caused increase in the level of BNP which is well in agreement with the previous findings (Fig. 3D). (Avci et al., 2017; Singh et al., 2016). Treatment with NER 400 mg/kg and FF 80 mg/kg showed significant reduction in BNP level (Fig. 3D), hence showed cardioprotection. Cardiac inflammation is another pathological condition which is observed in cardiac tissue after exposure to cardiotoxic agents like

– ASN 137

Fenofibrate (standard)

ILE 145, ALA 258, PRO 144, VAL143, GLN 148, ARG 73, VAL 143, PRO 177, PRO 140, THR 164, ASN 137, ASN 138, ASN 139, HIS 142, GLN 162, LEU 174, LEU 175 ILE 145, TYR 257, ALA 258, PRO 144, TRP 233, VAL 143, PRO 256, PRO 140, ARG 73, ASN 137, ASN 138, ASN 139, HIS 142, GLN 162

−8.847 −7.529

−63.084 −58.992 Residues involved in π-π stacking HID 142 −5.73 −5.22 Residues involved in hydrogen bonding interactions ASN 137 Fenofibrate (standard) Nerolidol Ligand

−96.212 −57.617 −86.989 −54.332 Residues involved in hydrophobic interactions

Glide ecoul Glide evdw Glide emodel Glide energy (cal/mol) Docking score Ligand

Table 2 Molecular docking of fenofibrate and nerolidol at active binding site of NF–κB p65 (PDB ID: 1LE5) and residues involved in forming hydrogen bonds and hydrophobic interactions.

A. Iqubal, et al.

5

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

Fig. 2. Effect of NER 200, NER 400 and FF 80 on oxidative and nitrative stress induced by CP 200 in the myocardial tissue of Swiss albino mice. (A) SOD activity, (B) catalase activity, (C–E) GSH, TBARS and nitrate level. Treatment with CP 200 significantly reduced the catalytic activities of SOD and catalase, increased the level of TBARS and nitrite and reduced the level of GSH in the myocardial tissue. Treatment with NER 400 and FF 80 increased the activities of SOD, catalase and level of GSH and reduced the level of TBARS and nitrate towards normal. Treatment with NER 200 however, was found to be ineffective against these markers of oxidative and nitrative stress. Values are expressed as mean ± S.E.M (n = 6). One-way ANOVA followed by Tukey's multiple comparison test was applied for determining the significance of data. ###P < 0.001 significant, versus control; *P < 0.05, **P < 0.01, ***P < 0.001 significant versus CP and ns is non-significant versus CP.

include atherosclerosis, unstable angina, myocardial infarction, cardiac fibrosis and heart failure (El-Agamy et al., 2019). NF–κB exert its cardiotoxic manifestations once it gets activated. Under normal physiological condition, inhibitor of NF-κB proteins (IκB) keeps the NF–κB inactivated in the cytoplasm and thus inhibit the cascade of inflammation. Phosphorylation of IκB-α by IκB kinase (IKK) results in the subsequent ubiquitination and proteasome-mediated degradation of

isoproterenol, doxorubicin or CP (Song et al., 2016). Increased expression of p-NF–κB p65 is one of the indications of cardiac inflammation and injury (Goode et al., 2018). Nuclear factor-κB (NF–κB) belongs to the family of transcription factors and it is considered as redox-sensitive transcription factor that regulates arrays of inflammatory and apoptotic genes (Profita et al., 2008). Role of NF–κB has been well documented in the pathogenicity of cardiotoxicity that

Fig. 3. Effect of CP 200, NER 200, NER 400 and FF 80 on cardiac injury markers. (A) LDH, (B) CK-MB, (C) cTnT and (D) BNP levels are shown. Treatment with CP 200 significantly increased the level of these cardiac injury markers whereas treatment with NER 400 and FF 80 reduced their level. Treatment with NER 200 however, was found to be ineffective. Values are expressed as mean ± S.E.M (n = 6). Oneway ANOVA followed by Tukey's multiple comparison test was applied for determining the significance of data. ###P < 0.001 significant versus control; *P < 0.05, **P < 0.01, ***P < 0.001 significant versus CP and ns is non-significant versus CP.

6

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

Fig. 4. Effect of CP 200, NER 200, NER 400 and FF 80 on inflammatory markers in cardiac tissue. (A) TNF α, (B) IL- 6, (C) IL-1β, (D) IL-10 levels are shown. Treatment with CP 200 significantly increased the level of TNF α, IL- 6, IL-1β and reduced the level of IL-10, whereas treatment with NER 400 and FF 80 significantly reduced their level. Treatment with NER 200 was found to be ineffective against these inflammatory markers. Values are expressed as mean ± S.E.M (n = 6). One-way ANOVA followed by Tukey's multiple comparison test was applied for determining the significance of data. ### P < 0.001 significant versus control; *P < 0.05, **P < 0.01, ***P < 0.001 significant versus CP and ns is non-significant versus CP.

treatment with NER 400 and FF 80 mg/kg got reversed to normal (Figs. 2E Fig 5 C-1 – C-VI and 5F). These findings clearly indicated cardioprotective potential of nerolidol and fenofibrate. Apoptosis is another consequence of cardiotoxicity and cleaved caspase 3 elevation is one of the important apoptotic markers (Zhao et al., 2018). In our study, we estimated cleaved caspase 3 expression and found its elevation in CP treated mice. When we treated mice with NER 400 and FF 80 mg/kg, we found significant decrease which indicated anti-apoptotic effect of NER and goes fine with the previous findings (Fig. 5 A-1 to A-VI) (Asiri, 2010; Avci et al., 2017). One of the common implication of cardiomyocyte's apoptosis is fibrosis, which is characterized by the deposition of extracellular matrix (ECM) proteins like collagens (Travers et al., 2016). Cardiac fibrosis is the result of myocardial injury where increased ROS, apoptosis, inflammatory and pro-fibrotic cytokines (TNF-α, ILs and TGF-β etc.) causes transdifferentiation of quiescent fibroblast into myofibroblast (Frangogiannis, 2018; Wynn, 2008). This event of transdifferentiation drives the etiology of fibrosis by synthesis and secretion of ECM proteins, connective tissue growth factor (CTGF) and collagen deposition (Chen et al., 2000). CTGF has been well demonstrated in experimental and human fibrosis which get induced by the TGF- β and modulate apoptosis, chemotaxis, ECM production and secretion (Dessein et al., 2009; Vainio et al., 2019). Considering the role of pro-fibrotic cytokines, TGF-β is the most extensively studied pro-fibrotic cytokine which is considered as the master regulator of fibrosis and exist in three isoforms (TGF-β1, β2 and β3) (Bujak and Frangogiannis, 2007; Lijnen et al., 2000). Exposure to cardiotoxic drugs activated TGF-β that binds with the TGF-β receptors (TβRI and II) causes activation of myofibroblasts, produces extracellular matrix (ECM) proteins and inhibit ECM degradation (Ihn, 2002). These events cumulatively lead to cardiac fibrosis (Massagué, 2000). Once myocardial tissue become fibrotic, it results into stiff ventricles, causes arrhythmia and results into heart failure (Frangogiannis, 2018). In the present study, when we administered CP 200, we found increased mRNA expression of TGF-β1 and CTGF in the cardiac tissue that indicated cardiac fibrosis (Fig. 7). We

IkB-α that causes activation and translocation of NF–κB into the nucleus (Gilmore, 2006). In the nucleus p65 subunit of NF–κB binds with the specific gene promoters to modulate the expression of inflammatory and apoptotic genes. Mechanistically, NF–κB causes upregulation of pro-apoptotic, inflammatory, redox sensitive and fibrotic genes that regulate Fas, p53, cytokines, iNOS, p38 MAPKs, Nrf2 and TGF-β activity and causes apoptosis, inflammation and fibrosis (El-Agamy et al., 2019; Zhang et al., 2016; Zhou et al., 2018). Thus, NF-kB activates a number of positive feedback loops by modulating the expression of target genes and therefore inhibitory action of NER on NFkB could interfere with these self-sustaining loops and thereby can exert cardioprotective effect. Blockage of p65 subunit of NF-kB could be a potential therapeutic approach to mitigate CP-induced cardiotoxicity. Considering this fact, we performed in silico study using Schrodinger v 10.6 software which confirmed the binding affinity of NER at p65 subunit (Fig. 1). We further, performed ELISA and immunohistochemistry (Fig. 4 and Fig. 5) and observed that CP significantly increased the level of phosphorylated NF–κB p65 along with increase in pro-inflammatory (TNF-α, IL-6 and IL-1β) and decrease in anti-inflammatory (IL-10) cytokines which confirmed cardiotoxicity. NER 400 and FF 80 mg/kg very well reversed these changes thereby confirmed cardioprotection (Figs. 4 and Fig. 5). Increased expression of iNOS leads to excessive production of NO, which react with ROS or superoxide ions to produce peroxynitrite leading to nitrative stress (Aktan, 2004). Nitrative stress alone or in combination with ROS has been reported to impair mitochondrial homeostasis leading to more sustained production of ROS and ATP depletion (Noiri et al., 2018). Nitrative stress on one hand causes heart failure, myocardial hypertrophy, myocardial pericarditis, angina pectoris and hypertension (Nickola et al., 2000), whereas on the other hand facilitates the cascade of cardiac inflammation and apoptosis (Nakazawa et al., 2017). Thus, the expression of iNOS and estimation of NO can give sufficient idea for cardiac damage (Nakazawa et al., 2017). In our study, we have seen the mRNA expression of iNOS by RT-PCR, performed immunohistochemistry of iNOS and also estimated NO in the cardiac tissue which was found high in CP administered mice and on 7

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

Fig. 5. Immunohistochemistry of cleaved caspase 3, p- NF–ĸB p65 and iNOS in cardiac tissue. Representative images show cleaved caspase 3 (A-I to A-VI), p- NF–ĸB p65 (B–I to B-VI) and iNOS (C–I to C-VI) staining of heart tissues after treatment with vehicle, CP 200, NER per se, NER 200 + CP 200, NER 400 + CP 200, FF 80 + CP 200 [Scale bar - 100 μm]. (D–F) showing the semi quantitative analysis of cleaved caspase 3, p-NF–κB p65 and iNOS along with the mRNA expression level of iNOS, respectively. Treatment with CP 200 significantly increased the level of cleaved caspase 3, p-NF–κB p65 and iNOS, respectively in the cardiac tissue whereas treatment with NER 400 and FF 80 significantly reduced these levels. Treatment with NER 200 however, was found to be ineffective. Values are expressed as mean ± S.E.M (n = 6). One-way ANOVA followed by Tukey's multiple comparison test was applied for determining the significance of data. ###P < 0.001 significant versus control; *P < 0.05, **P < 0.01, ***P < 0.001 significant versus CP and ns is non-significant vs. CP.

mice, we found myofibrillar disintegration, pyknosis in certain areas and vacuolization (Fig. 6). On ultrastructural examination by TEM, we found organellar disruption with myofibril loss, sarcolemma disintegration, nuclear membrane damage and mitochondrial disruption which showed cardiotoxicity (Fig. 8). However, on treatment with NER 400 and FF 80 mg/kg we found significant reversal of these histopathological and ultrastructural changes which strengthened our findings. We would have further strengthened the finding, if we would have

also performed Masson's trichrome staining (MT staining) which is another parameter to ascertain fibrosis in cardiac tissue where the collagen-rich perivascular and non-perivascular fibrotic regions appear blue, cytoplasm red or pink and nuclei dark brown to black (Nakada et al., 2017). Treatment with NER 400 mg/kg and FF 80 mg/kg significantly reduced the expression of TGF-β1, CTGF and also reduced the fibrotic area (Fig. 7). Histopathology, using H and E staining and transmission electron microscopy (TEM), is one of the decisive parameters of cellular and ultrastructural damages. In CP administered

Fig. 6. H & E stained sections showing histological alterations induced by CP 200 and reversal by NER 200, NER 400 and FF 80 in cardiac tissue [Scale bar 100 μm]. Treatment with CP 200 showed cellular disintegration, pyknotic nucleus and vacuolization. Treatment with NER 400 and FF 80 effectively reduced these histological aberrations whereas NER 200 was found to be ineffective.

8

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

Fig. 7. Effect of CP 200, NER 200, NER 400 and FF 80 on fibrotic markers in cardiac tissue. Upper panels show Masson's trichrome stained sections of fibrotic areas (blue color) in cardiac tissue [Scale bar 100 μm]. Treatment with CP 200 significantly induced peri-vascular fibrosis (blue color) which was significantly reduced on ttreatment with NER 400 and FF 80. NER 200 however, was found ineffective. Lower panel showing quantification of Masson's trichrome stained cardiac section (left) and mRNA expression of CTGF and TGF-β1 (right). One-way ANOVA followed by Tukey's multiple comparison test was applied for determining the significance of data. ###P < 0.001 significant versus control; *P < 0.05, **P < 0.01, ***P < 0.001 significant versus CP and ns is non-significant versus CP.

Fig. 8. Ultrastructural alterations induced by CP 200 and effect of NER 200, NER 400 and FF 80 in cardiac tissue. Treatment with CP 200 caused marked ultrastructural aberrations [myofibrillar disintigration (yellow long arrow), deteriotation of Z-band (white arrow), nuclear membrane damage (yellow short arrow), mitochondrial damage (red arrow) and vaculization (red astricks)]. Ttreatment with NER 400 and FF 80 significantly reduced these ultrastructural aberrations whereas, NER 200 was found ineffective. Higher magnification insets (9000x) showing heathy myofibrils, Z-band and nuclear membrane in control and per se groups. Insets of CP 200 and NER 200 showing damaged Z band, myofibrils and mitochondria with presence of vacuoles. Insets for NER 400 and FF 80 showing improved myofibrils, Z-bands and mitochondrial architectures.

9

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

seen the expression level of genes and proteins such as NF-κB, IҡB, or others that are involved in cardiac homeostasis and therefore consider this as the limitation of our study.

using non–first-degree related donors. Biol. Blood Marrow Transplant. 24, 1099–1102. Fonsêca, D.V., Salgado, P.R., de Carvalho, F.L., Salvadori, M.G.S., Penha, A.R.S., Leite, F.C., Borges, C.J.S., Piuvezam, M.R., Pordeus, L.C.d.M., Sousa, D.P., 2016. Nerolidol exhibits antinociceptive and anti‐inflammatory activity: involvement of the GABA ergic system and proinflammatory cytokines. Fundam. Clin. Pharmacol. 30, 14–22. Frangogiannis, N.G., 2018. Cardiac fibrosis: cell biological mechanisms, molecular pathways and therapeutic opportunities. Mol. Asp. Med. 65, 70–99. Gilmore, T.D., 2006. Introduction to NF-κB: players, pathways, perspectives. Oncogene 25, 6680–6684. Goldberg, M.A., Antin, J.H., Guinan, E., Rappeport, J.M., 1986. Cyclophosphamide cardiotoxicity: an analysis of dosing as a risk factor. Blood 68, 1114–1118. Goode, B., Joseph, N.M., Stevers, M., Van Ziffle, J., Onodera, C., Talevich, E., Grenert, J.P., Yeh, I., Bastian, B.C., Phillips, J.J., 2018. Adenomatoid tumors of the male and female genital tract are defined by TRAF7 mutations that drive aberrant NF-kB pathway activation. Mod. Pathol. 31, 660–673. Gore, P.R., Prajapati, C.P., Mahajan, U.B., Goyal, S.N., Belemkar, S., Ojha, S., Patil, C.R., 2016. Protective effect of thymoquinone against cyclophosphamide-induced hemorrhagic cystitis through inhibiting DNA Damage and upregulation of Nrf2 expression. Int. J. Biol. Sci. 12, 944–953. Ihn, H., 2002. Pathogenesis of fibrosis: role of TGF-β and CTGF. Curr. Opin. Rheumatol. 14, 681–685. Institute, N.H., 2018. Cancer Statistics. 27 April. p. 15 july. Iqubal, A., Iqubal, M.K., Sharma, S., Ansari, M.A., Najmi, A.K., Ali, S.M., Ali, J., Haque, S.E., 2018a. Molecular mechanism involved in cyclophosphamide-induced cardiotoxicity: old drug with a new vision. Life Sci. 218, 112–131. Iqubal, A., Sharma, S., Sharma, K., Bhavsar, A., Hussain, I., Iqubal, M.K., Kumar, R., 2018b. Intranasally administered pitavastatin ameliorates pentylenetetrazol-induced neuroinflammation, oxidative stress and cognitive dysfunction. Life Sci. 211, 172–181. Jeelani, R., Khan, S.N., Shaeib, F., Kohan-Ghadr, H.-R., Aldhaheri, S.R., Najafi, T., Thakur, M., Morris, R., Abu-Soud, H.M., 2017. Cyclophosphamide and acrolein induced oxidative stress leading to deterioration of metaphase II mouse oocyte quality. Free Radic. Biol. Med. 110, 11–18. Khuchua, Z., Glukhov, A.I., Strauss, A.W., Javadov, S., 2018. Elucidating the beneficial role of PPAR agonists in cardiac diseases. Int. J. Mol. Sci. 19, 3464–3481. Kong, P., Christia, P., Frangogiannis, N.G., 2014. The pathogenesis of cardiac fibrosis. Cell. Mol. Life Sci. 71, 549–574. Lapczynski, A., Bhatia, S., Letizia, C., Api, A., 2008. Fragrance material review on nerolidol (isomer unspecified). Food Chem. Toxicol. 46, S247–S250. Lenneman, C.G., Sawyer, D.B., 2016. Cardio-oncology: an update on cardiotoxicity of cancer-related treatment. Circ. Res. 118, 1008–1020. Lijnen, P., Petrov, V., Fagard, R., 2000. Induction of cardiac fibrosis by transforming growth factor-β1. Mol. Genet. Metab. 71, 418–435. Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 47, 469–474. Massagué, J., 2000. How cells read TGF-β signals. Nat. Rev. Mol. Cell Biol. 1, 169–178. Meserve, E.E., Lehmann, L.E., Perez-Atayde, A.R., LaBelle, J.L., 2014. Cyclophosphamideassociated cardiotoxicity in a child after stem cell transplantation for β-Thalassemia Major: case report and review of the literature. Pediatr. Dev. Pathol. 17, 50–54. Nafees, S., Rashid, S., Ali, N., Hasan, S.K., Sultana, S., 2015. Rutin ameliorates cyclophosphamide induced oxidative stress and inflammation in Wistar rats: role of NFκB/ MAPK pathway. Chem. Biol. Interact. 231, 98–107. Nakada, Y., Canseco, D.C., Thet, S., Abdisalaam, S., Asaithamby, A., Santos, C.X., Shah, A.M., Zhang, H., Faber, J.E., Kinter, M.T., 2017. Hypoxia induces heart regeneration in adult mice. Nature 541, 222–227. Nakazawa, H., Chang, K., Shinozaki, S., Yasukawa, T., Ishimaru, K., Yasuhara, S., Yu, Y.M., Martyn, J.J., Tompkins, R.G., Shimokado, K., 2017. iNOS as a driver of inflammation and apoptosis in mouse skeletal muscle after burn injury: possible involvement of Sirt1 S-nitrosylation-mediated acetylation of p65 NF-κB and p53. PLoS One 12 e0170391. Nickola, M.W., Wold, L.E., Colligan, P.B., Wang, G.-J., Samson, W.K., Ren, J., 2000. Leptin attenuates cardiac contraction in rat ventricular myocytes: role of NO. Hypertension 36, 501–505. Noiri, E., Nakao, A., Uchida, K., Tsukahara, H., Ohno, M., Fujita, T., Brodsky, S., Goligorsky, M.S., 2018. Oxidative and nitrosative stress in acute renal ischemia. Am. J. Physiol. Renal. Physiol. 281, F948–F957. Noszczyk-Nowak, A., 2011. NT-pro-BNP and troponin I as predictors of mortality in dogs with heart failure. Pol. J. Vet. Sci. 14, 551–556. Ohkawa, H., Ohishi, N., Yagi, K., 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 95, 351–358. Omole, J.G., Ayoka, O.A., Alabi, Q.K., Adefisayo, M.A., Asafa, M.A., Olubunmi, B.O., Fadeyi, B.A., 2018. Protective effect of kolaviron on cyclophosphamide-induced cardiac toxicity in rats. J. Evid. Based. Integr. Med. 23, 1–11. Organisation, W.H., 2018. Cancer Statistics. Park, J.M., Hahn, S.M., Han, J.W., Lyu, C.J., 2018. A case of successfully treated severe heart failure due to cyclophosphamide induced cardiomyopathy. Clin. Pediat. Hematol. Oncol. 25, 71–75. Profita, M., Bonanno, A., Siena, L., Ferraro, M., Montalbano, A.M., Pompeo, F., Riccobono, L., Pieper, M.P., Gjomarkaj, M., 2008. Acetylcholine mediates the release of IL-8 in human bronchial epithelial cells by a NFkB/ERK-dependent mechanism. Eur. J. Pharmacol. 582, 145–153. Richa, R., Yadawa, A.K., Chaturvedi, C.M., 2017. Hyperglycemia and high nitric oxide level induced oxidative stress in the brain and molecular alteration in the neurons and glial cells of laboratory mouse, Mus musculus. Neurochem. Int. 104, 64–79.

5. Conclusion Taken together, our study showed that cyclophosphamide significantly induced oxidative stress, nitritive stress, cardiac inflammation, cardiac apoptosis and cardiac fibrosis, that contributed to histological and ultrastructural changes leading to cardiac dysfunction. NER 400 significantly reversed these cardiotoxic effects and showed cardioprotection which was comparable with FF 80. NER 200, however did not show any significant cardioprotection. Conflicts of interest The authors declare no conflict of interests. Funding source None. Acknowledgement Authors are thankful to Jamia Hamdard for providing the necessary facilities to perform the experimental work. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ejphar.2019.172666. References Aktan, F., 2004. iNOS-mediated nitric oxide production and its regulation. Life Sci. 75, 639–653. Ashry, N.A., Gameil, N.M., Suddek, G.M., 2013. Modulation of cyclophosphamide-induced early lung injury by allicin. Pharm. Biol. 51, 806–811. Asiri, Y.A., 2010. Probucol attenuates cyclophosphamide-induced oxidative apoptosis, p53 and Bax signal expression in rat cardiac tissues. Oxid. Med. Cell. Longev. 3, 308–316. Avci, H., Epikmen, E., Ipek, E., Tunca, R., Birincioglu, S., Akşit, H., Sekkin, S., Akkoç, A., Boyacioglu, M., 2017. Protective effects of silymarin and curcumin on cyclophosphamide-induced cardiotoxicity. Exp. Toxicol. Pathol. 69, 317–327. Bujak, M., Frangogiannis, N.G., 2007. The role of TGF-β signaling in myocardial infarction and cardiac remodeling. Cardiovasc. Res. 74, 184–195. Chan, W.-K., Tan, L., Chan, K.-G., Lee, L.-H., Goh, B.-H., 2016. Nerolidol: a sesquiterpene alcohol with multi-faceted pharmacological and biological activities. Molecules 21, 529–569. Chen, M.M., Lam, A., Abraham, J.A., Schreiner, G.F., Joly, A.H., 2000. CTGF expression is induced by TGF-β in cardiac fibroblasts and cardiac myocytes: a potential role in heart fibrosis. J. Mol. Cell. Cardiol. 32, 1805–1819. Claiborne, A., 1986. Catalase Activity. CRC Handbook of Methods for Oxygen Radical Research. pp. 283–284. Colin, J.Y., Wu, C.O., Tee, M., Liu, C.-Y., Volpe, G.J., Prince, M.R., Hundley, G.W., Gomes, A.S., Van Der Geest, R.J., Heckbert, S., 2015. The association between cardiovascular risk and cardiovascular magnetic resonance measures of fibrosis: the Multi-Ethnic Study of Atherosclerosis (MESA). J. Cardiovasc. Magn. Reson. 17, 15–26. De Carvalho, R.B., De Almeida, A.A.C., Campelo, N.B., Lellis, D.R.O.D., Nunes, L.C.C., 2018. Nerolidol and its pharmacological application in treating neurodegenerative diseases: a review. Recent Pat. Biotechnol. 12, 158–168. Dessein, A., Chevillard, C., Arnaud, V., Hou, X., Hamdoun, A.A., Dessein, H., He, H., Abdelmaboud, S.A., Luo, X., Li, J., 2009. Variants of CTGF are associated with hepatic fibrosis in Chinese, Sudanese, and Brazilians infected with schistosomes. J. Exp. Med. 206, 2321–2328. El-Agamy, D.S., El-Harbi, K.M., Khoshhal, S., Ahmed, N., Elkablawy, M.A., Shaaban, A.A., Abo-Haded, H.M., 2019. Pristimerin protects against doxorubicin-induced cardiotoxicity and fibrosis through modulation of Nrf2 and MAPK/NF-kB signaling pathways. Cancer Manag. Res. 11, 47–61. El-Sheikh, A.A., Morsy, M.A., Okasha, A.M., 2017. Inhibition of NF-κB/TNF-α pathway may be involved in the protective effect of resveratrol against cyclophosphamideinduced multi-organ toxicity. Immunotoxicol 39, 180–187. Elmariah, H., Kasamon, Y.L., Zahurak, M., Macfarlane, K.W., Tucker, N., Rosner, G.L., Bolaños-Meade, J., Fuchs, E.J., Wagner-Johnston, N., Swinnen, L.J., 2018. Haploidentical bone marrow transplantation with post-transplant cyclophosphamide

10

European Journal of Pharmacology 863 (2019) 172666

A. Iqubal, et al.

the fibroblast awakens. Circ. Res. 118, 1021–1040. Tripathi, D., Jena, G., 2010. Astaxanthin intervention ameliorates cyclophosphamideinduced oxidative stress, DNA damage and early hepatocarcinogenesis in rat: role of Nrf2, p53, p38 and phase-II enzymes. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 696, 69–80. Vainio, L.E., Szabó, Z., Lin, R., Ulvila, J., Yrjölä, R., Alakoski, T., Piuhola, J., Koch, W.J., Ruskoaho, H., Fouse, S.D., 2019. Connective tissue growth factor inhibition enhances cardiac repair and limits fibrosis after myocardial infarction. JACC Basic. Transl. Sci. 4, 83–94. Wynn, T.A., 2008. Cellular and molecular mechanisms of fibrosis. J. Pathol. Soc. Great B. Irel. 214, 199–210. Zhang, D., Ma, D., Yao, Z., Fu, C., Shi, Y., Wang, Q., Tang, Q., 2016. ERK1/2/p53 and NFκB dependent-PUMA activation involves in doxorubicin-induced cardiomyocyte apoptosis. Eur. Rev. Med. Pharmacol. Sci. 20, 2435–2442. Zhao, D., Feng, P., Sun, Y., Qin, Z., Zhang, Z., Tan, Y., Gao, E., Lau, W.B., Ma, X., Yang, J., 2018. Cardiac-derived CTRP9 protects against myocardial ischemia/reperfusion injury via calreticulin-dependent inhibition of apoptosis. Cell Death Dis. 9, 723–736. Zhou, X., Chang, B., Gu, Y., 2018. MicroRNA-21 abrogates palmitate-induced cardiomyocyte apoptosis through caspase-3/NF-KB signal pathways. Anatol. J. Cardiol. 20, 336–346.

Sedlak, J., Lindsay, R.H., 1968. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman's reagent. Anal. Biochem. 25, 192–205. Shanmugarajan, T., Arunsundar, M., Somasundaram, I., Krishnakumar, E., Sivaraman, D., Ravichandiran, V., 2008. Cardio protective effect of Ficus hispida Linn on cyclophosphamide provoked oxidative myocardial injury in a rat model. Int. J. Pharmacol. 1, 1–10. Sharma, S., Khan, V., Najmi, A.K., Alam, O., Haque, S.E., 2018. Prophylactic treatment with icariin prevents isoproterenol-induced myocardial oxidative stress via nuclear Factor-Like 2 activation. Pharmacogn. Mag. 14, 227. Singh, B.K., Pillai, K.K., Kohli, K., Haque, S.E., 2016. Cissampelos pareira Linn. ameliorates thyroxin-induced cardiac hypertrophy in rats. J. Ethnopharmacol. 178, 281–288. Song, Y., Zhang, C., Wang, C., Zhao, L., Wang, Z., Dai, Z., Lin, S., Kang, H., Ma, X., 2016. Ferulic acid against cyclophosphamide-induced heart toxicity in mice by inhibiting NF-κB pathway. Evid. Based. Complement. Alternat. Med. 1–8 2016. Swamy, A.V., Patel, U., Koti, B., Gadad, P., Patel, N., Thippeswamy, A., 2013. Cardioprotective effect of Saraca indica against cyclophosphamide induced cardiotoxicity in rats: a biochemical, electrocardiographic and histopathological study. Indian J. Pharmacol. 45, 44–48. Travers, J.G., Kamal, F.A., Robbins, J., Yutzey, K.E., Blaxall, B.C., 2016. Cardiac fibrosis:

11