Nervous and Nonnervous Cell Transduction by Recombinant Adenoviruses That Inducibly Express the Human PrP

Biochemical and Biophysical Research Communications 285, 623– 632 (2001) doi:10.1006/bbrc.2001.5208, available online at http://www.idealibrary.com on

Nervous and Nonnervous Cell Transduction by Recombinant Adenoviruses That Inducibly Express the Human PrP Samuel Arrabal,* ,† Maryse Touchard,† Franck Mouthon,* Bernard Klonjkowski,† Jean-Philippe Deslys,* Dominique Dormont,* and Marc Eloit† ,1 *CEA, Service de Neurovirologie, DSV/DRM, CRSSA, EPHE, BP 6 92265 Fontenay-aux-Roses Cedex, France; and †URA INRA de Ge´ne´tique Mole´culaire et Cellulaire, Ge´ne´tique Virale, Ecole Nationale Ve´te´rinaire d’Alfort, 94704 Maisons Alfort, France

Received June 15, 2001

The study of the prion protein (PrP) physiological functions or its specific role in transmissible spongiform encephalopathies (TSE) requires new tools, particularly those able to induce PrP overexpression in a large range of cells, in vivo as well as in vitro. Here we describe the construction of two recombinant adenoviruses encoding the human PrP either with a valine at position 129 (AdTRVal) or a methionine (AdTRMet). Both genes were put under the control of the tetracycline-responsive promoter, allowing tight regulation of PrP expression. AdTRVal and AdTRMet induced high expression of the human PrP in CHO-KI cells and in organotypic brain slices in culture. The proteins expressed from these viruses exhibited a glycosylphosphatidyl inositol (GPI) anchor, proper glycosylation and sensitivity to proteinase K digestion. AdTRVal and AdTRMet will allow future studies on the human PrP and on the role of the codon 129 polyphormism in human TSE. © 2001 Academic Press

Transmissible spongiform encephalopathies (TSE) or prion diseases, are fatal, neurodegenerative diseases that include Creutzfeldt–Jakob disease (CJD) in humans, and bovine spongiform encephalopathy (BSE) in cattle. The prion protein (PrP) is a host-encoded glycoprotein which is attached to the membrane by a glycosylphosphatidyl inositol (GPI) anchor (1). A posttranscriptionally modified, pathological form of the normal PrP, designated PrP-res, seems to be an essential factor in the transmission and propagation of prion diseases, as TSE are characterised by a brain accumulation of PrP-res. The normal, cellular PrP (PrP-c) plays an essential role in individual sensitivity to TSE To whom correspondence should be addressed. Fax: ⫹33-1-4396-71-31. E-mail: [email protected]. 1

agents and in their ability to cross the species barrier. In humans, a polymorphism has been described at codon 129 of the human PrP gene (PRNP), encoding either a valine or a methionine, which is known to play a key role in human predisposition to TSE and in the length of the incubation period (2). In contrast, the biological function of PrP-c still remains unknown. Available data point to a function either in synaptic transmission (3), in long-term survival of Purkinje cells (4) or in the alteration of circadian activity rhythms and sleep (5). More recently, it has been suggested that PrP might harbour a superoxide dismutase activity (6), or play a role in signal transduction (7). The function and metabolism of PrP-c have been studied through the observation of transgenic and knock-out mice (3–5, 8, 9), or through the establishment of stably transfected cell lines (10 –12). The development of such material requires very painful and time-consuming technology, pointing out the need of practical tools, allowing high expression of PrP in vivo as well as in vitro, such as gene transfer vectors. Recently, a recombinant retrovirus encoding the murine PrP has been described (13), but this vector only transduces dividing cells, excluding neurones, the last being a very interesting model to study PrP, as PrP-c is mainly expressed in cells from neural origin. Recombinant adenoviruses are vectors allowing high gene transfer capacity in a wide range of cell types both in vivo and in vitro, and very efficient transgene expression. Here we report the construction of two recombinant adenoviruses expressing the human PrP protein encoding either a Valine or a Methionine at position 129, under the control of the minimal and inducible promoter of the tetracycline system (P hCMV-1) (14, 15). This promoter requires the presence of the tTA transactivator to induce PrP expression, which can be down regulated by addition of tetracycline. The induc-

623

0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

Vol. 285, No. 3, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

ible system was carefully investigated in the context of recombinant adenoviruses, before the PrP sequences were introduced in the vectors. The adenovirusmediated PrP expression and regulation was tested and analysed in different types of cells. METHODS Cells and viruses. The 293 cell line (16) was used for DNA transfection, and adenovirus amplification and titration. Cells were cultured in Dulbecco’s MEM (Life Technology) supplemented with 10% FCS. The A549 cell line was purchased at the American Type Culture Collection. Cells were cultured in Dulbecco’s MEM (Life Technology) supplemented with 10% FCS. CHO-KI and G9PLAP.85, were used for in vitro transduction assays. They were kindly provided by V. L. Stevens (Emory University School of Medicine, Atlanta, GA) (17). The G9PLAP.85 cell line is derived from CHO-KI and exhibits a mutation in the second step of GPI biosynthesis and it is unable to anchor GPI proteins at the cell membrane. Both cell lines were maintained in NutF12 medium (Life Technology) supplemented with 10% FCS. The AxCMNtTA virus encoding the transactivator of the tetracycline-regulated system, under the control of the CMV promoter and in fusion with a nuclear localisation signal, was kindly provided by Dr. H. Hamada (Cancer Institute, Tokyo, Japan) (18). Construction of recombinant DNA. The plasmid containing the coding region for human PrP with a valine at position 129 (pAFHum) has been described elsewhere (19). To create a human PRNP sequence encoding a methionine at position 129, a PCR with 5⬘ primer PRPMET1 (GGTGTCTGCAGCAGCTGGGGCAGTGGTGGGGGGCCTTGGCGGCTACATGCT) and 3⬘ primer PRPMET2 (CTGCAGAATTCGGCTTCCCTCAAGC) was realised on pAFHum (conditions: 30 s denaturation at 94°C, 1 min hybridisation at 63°C, 1 min 30 s elongation at 72°C. Number of cycles: 25). This set of primers allowed a specific mutation of the GTG 129 codon into an ATG, leading to the change of a valine into a methionine. The pAFMet plasmid was obtained by ligation of the PstI and EcoRI digested PCR product into the PstI and EcoRI sites of the pAFHum plasmid. The pTRVal and pTRMet plasmids were constructed by subcloning the valine and methionine human PRNP sequences into pUHD10-3 (Display System Biotechnology), downstream of the minimal CMV TATA box (PhCMV-1) of the tetracycline-regulated promoter, and upstream of the SV40 polyadenylation signal. The PRNP sequences were extracted from pAFHum and pAFMet as HindIII–EcoRI fragments, blunted in HindIII, and subcloned between SacII and EcoRI in pUHD10-3 multiple cloning sites, blunted in SacII. Construction of the shuttle plasmids and recombinant adenoviruses. The transfer vectors pAd5linkLR and pAd5linkRL were derived from pAd5link plasmid (20), which contains the human adenovirus type 5 (Ad5) 5⬘-inverted terminal repeat, the Ad5 encapsidation signal, the E1a enhancer, multiple cloning sites, and Ad5 sequence from 3328 to 5778. The pAd5linkLR plasmid was obtained by insertion of the BamHI–EcoRV fragment of pUHC13-3 (Display System Biotechnology) into the BamHI–EcoRV sites of the multiple cloning sites of pAd5link. The pAd5linkRL plasmid was obtained by insertion of the BamHI–EcoRV fragment of pUHC13-3 into the BglII–EcoRV sites of the multiple cloning sites of pAd5link. The construction of pAdTRLucLR and pAdTRLucRL (Figs. 1a and 1b) was done by subcloning a fragment of pUHC13-3 containing the tetracycline-regulated promoter, the firefly luciferase gene (Luciferase) and the SV40 polyadenylation signal, into the multiple cloning sites of pAd5linkLR and pAd5linkRL. This step was done by insertion of the XhoI–HpaI fragment of pUHC13-3 into the SalI–EcoRV sites of the pAd5linkLR and pAd5linkRL multiple cloning sites. The construction of pAdTRVal and pAdTRMet (Figs. 1c and 1d) was done by subcloning a fragment of pTRVal and pTRMet containing the tetracycline-regulated promoter, the PRNP sequence and the SV40 polyadenylation signal, into the multiple cloning sites of

pAd5linkRL. This step was done by insertion of the XhoI–HpaI fragment of pTRVal and pTRMet into the SalI–EcoRV sites of the pAd5linkRL multiple cloning sites. Construction of the recombinant adenoviruses was done according to the method described by Chartier et al. Briefly, a NsiI–PvuI fragment of pAdTRVal or pAdTRMet was cotransformed in E. coli BJ5183 with a ClaI linearised pRVnls␤-gal plasmid (Fig. 1e), product of the recombination between pRSVnls␤-gal (21) and pTG3652 (Transgene). The recombination step led to two circular pRVVal and pRVMet plasmids containing the whole genomes of the recombinant viruses. The same method was used to construct pRVLucLR and pRVLucRL. Production of recombinant adenoviruses. The resulting plasmids were digested by PacI and 10 ␮g of the linear DNA corresponding to the genomes of the AdTRVal and AdTRMet recombinant viruses were transfected into 293 cells, plated onto a 60-mm culture dish the day before transfection at density 1 ⫻ 10 6 cells/dish, by calcium phosphate coprecipitation method (Cell Phect kit, Pharmacia). One week after transfection, the cell lysates were collected and the AdVal and AdMet viruses were amplified by two additional passages on 293 cells. Large-scale production of high titre recombinant adenoviruses was performed by a standard procedure (22), and titres were determined by a plaque assay on 293 cells. Transfection/transduction assay. A549 cells were plated onto 24well plates the day before transfection at density 5 ⫻ 10 4 cells/well. One microgram of pRVLucLR, pRVLucRL and pUHC13-3 plasmids was transfected by calcium phosphate coprecipitation method (Cell Phect kit, Pharmacia). After an overnight exposition to precipitated DNA, cells were rinsed in PBS and fresh medium containing 5 ⫻ 10 4 TCID 50 of AxCMNtTA virus was added to each well (MOI ⫽ 100). Cells were cultured for 24 h and assayed for luciferase activity. In some wells, 1 ␮g/ml of doxycycline was added to the medium. Luciferase activity test. The luciferase activity was measured using the Luciferase Activity kit (Promega). Briefly, each well was lysed in 250 ␮l of lysis buffer, and lysates were centrifuged for 10 min at 12,000g at 4°C. Twenty microliters of the supernatant were added to 100 ␮l of a luciferine solution. The luciferase activity of this solution was measured in a scintillation counting machine. The cpm value in counts per minute (cpm) was converted into ng of protein/ml by the use of a reference curve. CHO cells transduction. CHO-KI and G9PLAP.85 cells were plated onto 75 cm 2 flasks two days before transduction at density 1.5 ⫻ 10 7 cells/flask. Transduction was performed in 5 ml of serum free NutF12 medium containing 1 ⫻ 10 8 TCID 50 of each virus (MOI ⫽ 50). After 1 h of contact with the virus at 37°C, 20 ml of fresh medium were added. The cells were maintained for 24 h at 37°C in 5% CO 2, distributed in 6-well plates at density 1 ⫻ 10 6 cells/well and cultured for 48 h in complete NutF12 medium containing different doxycycline concentrations. Cells were then treated for flow cytometry analysis or semiquantitative RT PCR. Flow cytometry analysis. The cells were collected using cell dissociating buffer in PBS (Sigma) and labelled with mouse Pri 308 anti-human PrP monoclonal antibody (23), followed by phycoerythrin (PE) goat anti-mouse IgG1 (Dako, 1:15 in PBS) for 30 min each at 4°C. Cells were fixed in 1⫻ CellFix solution (Becton– Dickinson) and membrane associated PrP was detected by flow cytometry using Becton–Dickinson FACScan machine. For each sample, 10,000 events were counted. The analysis was carried out using CellQuest software. For PIPLC-treated cells, PIPLC (Sigma) was used at 25 U/ml in PBS solution for 1 h at 37°C before immunostaining. mRNA assessment by semiquantitative RT PCR. Cells were lysed with Guanidium thiocyanate and total RNA was obtained by a phenol/chloroform extraction method (RNAble, Eurobio). Total RNA was resuspended in 30 ␮l of DNase buffer (RNAse inhibitor 30 U; DNase 10 U). Genomic DNA digestion was performed at room tem-

624

Vol. 285, No. 3, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

perature for 45 min. The reaction was stopped by heating 3 min at 93°C. The RNAs were then collected in reverse transcription (RT) buffer (Tris–HCl 0.25 M, pH 8.3; KCl 0.375 M; MgCl 2 15 mM; RNase inhibitor 30 U; dNTP 30 ␮M; oligo(dT) 30 ␮M) and retrotranscribed by 150 U of MMLV reverse transcriptase for 1 h at 42°C. The reaction was stopped by heating 3 min at 93°C. cDNAs obtained by RT were amplified by PCR using the following primers. Human PrP: 5⬘ primer, AGTCAGTGGAACAAGCCGAGTA; 3⬘ primer, CATGCTCGATCCTCTCTGGTAA. GAPDH: 5⬘ primer, GAGCCAAAAGGGTCATCATCT; 3⬘ primer, AGTGGGTGTCGCTGTTGAAGT. Serial dilutions of 5 ␮l of cDNA were amplified by PCR in the presence of 10⫻ Taq buffer, 5 ␮l; dNTP 5 mM, 2 ␮l; primers 20 mM, 1 ␮l; Taq polymerase (Appligene), 0.04 ␮l; water 35.9 ␮l. Conditions were: 45 s denaturation at 94°C, 1 min hybridisation at 56°C for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 57°C for PrP and 1 min elongation step at 72°C. GAPDH gene was amplified by 32 cycles and PrP gene was amplified by 35 cycles. PCR products were subjected to electrophoresis, numerised and quantified by means of a NIH image 1.2 software. The linearity of the PrP signal was verified on each gel by means of dilution scale of the PrP gene as previously described (24). The expression of GAPDH was used as reference. Immunofluorescence and confocal microscopy. Twenty-four hour adenovirus-transduced cells (MOI ⫽ 50) were seeded in 8-well Labtek culture slides at 2.10 4 cells/well and cultured in complete NutF12 medium at 37°C in 5% CO 2. After 2 days in culture, cells were fixed with 3% paraformaldehyde solution in PBS for 15 min, and permeabilised with a 0.1% Triton X-100 solution diluted in PBS for 10 min. Saturation of non-specific sites was achieved by incubation in PBS supplemented with 10% goat serum for 45 min. Cells were incubated with FITC conjugated Pri308 antibody (1:50 in saturation buffer) for 30 min. Slides were mounted under fluoromount and examined using an axiovert (Zeiss) fluorescence microscope. Confocal analysis was performed using a MRC-1024 (Bio-Rad) confocal scanning laser with a microscope (Nikon Optiphot Fluorescence). Image analysis was performed using Lasershap version 2.0 software (Bio-Rad). Infection of cerebellar and hippocampal explant cultures. Hippocampal and cerebellar slices were prepared from 4 day-old PrP 0/0 mice. The cerebellum and hippocampus were dissected from the isolated brain and placed in petri dishes containing MEM medium (Life Technology). Transverse slices, 400 ␮m thick, were made using a mechanical tissue chopper (McIlwain). Slices were transferred onto 30 mm membrane (Millipore Millicell-CM, Milford, MA), placed in 6-well plates and cultured in MEM medium (Life Technology) supplemented with D-glucose 10 g/L (Merck), insulin 5 mg/L (Sigma), apo-transferrin 100 mg/L (Sigma), progesterone 20 nM (Sigma), putrescin 100 nM (Sigma), Na selenite 30 nM and tri-iodothryonin 30 nM (Sigma). The medium was replaced three times a week. Cultures were maintained at 37°C in 5% CO 2 . Cultures were grown for 24 h prior to addition of virus. A drop of 5 ␮l of a solution containing 5 ⫻ 10 7 TCID 50 of each virus was applied to the surface of the slices. Western blot analysis. After 24 h of culture, transduced slices were homogenised in reaction buffer (Hepes 25 mM pH 7.4, NaCl 150 mM) with or without 100 ␮g/ml proteinase K and incubated for 1 h at 37°C. The samples were then heated at 100°C for 5 min and resuspended in Laemmli buffer. Proteins were separated by SDS– PAGE, transferred onto a nitrocellulose membrane and probed with Pri308 antibody at a dilution of 1:10,000. This was followed by a detection step with horseradish peroxidase-conjugated goat anti mouse IgG (H ⫹ L) (1:5000, Southern Biotechnology). Immunopositive signals were developed by using the chemoluminescent substrate ECL (Amersham) according to the manufacturer’s instructions.

RESULTS Efficient Regulation of the Tetracycline-Responsive Promoter in the Context of the Adenovirus To test the influence of the adenoviral sequences on the tetracycline regulable promoter, we have constructed two plasmids containing the genomes of two recombinant adenoviruses encoding the firefly luciferase reporter gene under the control of the tetracycline regulable promoter (Fig. 1). In the pRVLucLR construction, derived from pAdTRLucLR (Fig. 1b), the transgene was inserted so that its transcription occurs from the left to the right. The pRVLucRL plasmid, derived from pAdTRLucRL (Fig. 1a), harbours the other orientation. Both plasmids and pUHC13-3 (from which the inducible luciferase cassette was extracted) were tested for correct luciferase expression and regulation in A549 cells after transfection and transduction with the AxCMNtTA. As shown in Fig. 2, the pUHC13-3 plasmid exhibited a high expression of the luciferase gene, no detectable background expression in the absence of the NtTA transactivator, and proper doxycycline regulation, the addition of the antibiotic to the medium leading to complete repression of the transgene expression. Both the pRVLucLR and pAdLucRL constructions exhibited high luciferase expression; however, the pRVLucLR exhibited higher basal luciferase expression in the absence of NtTA transactivator than pRVLucRL (10 times higher). This could be explained by the presence of the E1a enhancer upstream of the transgene expression cassette in the pAdLucLR plasmid. In pRVLucRL, the inducible promoter is not under the influence of the E1a enhancer. In the two plasmids, correct regulation was observed, as the basal expression level was reached by addition of doxycycline to the medium. Construction of AdTRVal and AdTRMet In order to construct adenoviruses that inducibily express the human PrP genes, we first constructed two shuttle plasmids containing the two PRNP coding sequences. The pAdTRVal and pAdTRMet plasmids were constructed by inserting the transgene expression cassette (corresponding to the PRNP coding sequence under the control of the inducible promoter) into the multiple cloning sites of pAd5link plasmid. This plasmid contains the extreme left end of the Ad genome (nucleotides 1–357), encompassing the ITR, the encapsidation sequences and the enhancer of the E1A promoter, followed by a polylinker and a second homology region with the Ad genome (nucleotides 3322–5778). The resulting plasmids (Figs. 1c and 1d), were used in E. coli BJ5183 for the recombination step and the genomes of the recombinant AdTRVal and AdTRMet viruses were generated. The transgene expression cassette was oriented so that the PRNP sequence was not

625

Vol. 285, No. 3, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 1. Plasmids used for viral vector constructions. For each recombinant virus, a shuttle plasmid was constructed containing the transgene expression cassette (corresponding to the transgene and the tetracycline regulable promoter) framed by adenovirus sequences. The luciferase gene was cloned in two orientations (a, b) to study the influence of the E1a enhancer (Enh), located in the virus encapsidation signals (⌿), on the gene regulation. The PRNP genes were cloned in the RL orientation (c, d), where transcription occurs from the right to the left. The recombinant viruses’ backbone is harboured by pRVnls␤gal (e). Recombinant adenoviruses were generated by recombination in bacteria by transforming a PvuI–NsiI fragment of the shuttle plasmid with a ClaI linearised pRVnls␤gal in Escherichia coli. For details, see the Methods.

under the influence of the E1a enhancer located in the encapsidation signals of the virus. After several passages on 293 cells and a caesium chloride purification step, high titre stocks of the two viruses were obtained.

Expression of the Human PrP The efficiency of adenovirus mediated PrP expression was measured by cotransduction of AdTRVal or

626

Vol. 285, No. 3, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 2. Doxycycline regulation of the luciferase activity. A549 cells were transiently transfected with either a plasmid containing the inducible luciferase expression cassette (pUHC13-3), or plasmids containing the whole genomes of recombinant adenoviruses harbouring the inducible luciferase expression cassette, cloned in two different orientations (pRVLucLR and pAdLucRL). Luciferase activity was measured in the absence of the NtTA transactivator (black bars), after transduction with the AxCMNtTA virus (white bars), or after transduction with the AxCMNtTA virus and addition of 1 ␮g/ml of doxycycline (grey bars).

AdTRMet together with AxCMNtTA in CHO-KI cell line or G9PLAP.85, a CHO-KI derived cell line with a mutation in GPI metabolism. PrP expression was detected by immunostaining with a fluorescent Pri 308 antibody. As shown in Figs. 3a, 3c, 3e, and 3g, no PrP expression could be detected in cells transduced with AdTRVal or AdTRMet viruses alone. Similar results were obtained in cells transduced with the AxCMNtTA

virus alone (data not shown). On the other hand, when cotransduced with AxCMNtTA and AdTRVal or AdTRMet, both CHO-KI and G9PLAP.85 cell lines showed high PrP expression (Figs. 3b, 3d, 3f, and 3h); however the pattern of PrP expression seemed to be different from one cell line to the other: in CHO-KI cell line, PrP seemed to be mainly located at the cell surface, whereas in G9PLAP.85 cell line, PrP expression

FIG. 3. Immunodetection of PrP expression. CHO-KI (a– d) and G9PLAP.85 (e– h) cells were transduced either with AdTRMet (a, e) or AdTRVal (c, g) viruses alone, or cotransduced with AxCMNtTA and either AdTRMet (b, f) or AdTRVal (d, h). Cells were fixed, permeabilised, and stained with a fluorescent anti-PrP Pri308 antibody. 627

Vol. 285, No. 3, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 4. Immunolocalisation of PrP expression. Confocal optical sections of CHO-KI (a) and G9PLAP.85 (b) cotransduced with AxCMNtTA and AdTRMet. Cells were fixed, permeabilised, and stained with a fluorescent anti-PrP Pri308 antibody.

seemed to be restricted to the intra cellular compartments. This pattern of PrP expression was also observed in confocal microscopy as shown in Fig. 4. CHO-KI cell line seemed to exhibit PrP expression at the cell membrane (Fig. 4a), and G9PLAP.85 cell line only seemed to show expression of the protein in some intra cellular compartments (endoplasmic reticulum or Golgi, Fig. 4b). Cell Surface Localisation of PrP and Doxycycline Regulation of PRNP Gene Expression Cell surface expression of PrP, as well as efficient doxycycline regulation of the gene expression were verified by flow cytometry experiments. CHO-KI cells were transduced with AxCMNtTA and AdTRVal, or AdTRMet. High levels of PrP expression were detected at the cell surface using Pri308 antibody in flow cytometry. When CHO-KI cells were cultured in the presence of increasing doxycycline concentrations, the percentage of cell transduction, with a complete extinction of the PrP expression at a doxycycline concentration of 0.1 ␮g/ml (Figs. 5a–5f). This result was confirmed by semiquantitative RT-PCR. As shown in Fig. 6, total repression of the transgene expression was apparently observed in the presence of doxycycline at 0.1 ␮g/ml. In G9PLAP.85 cells, no PrP expression could be detected by flow cytometry at the cell surface, independently of the doxycycline concentration in the culture medium (Fig. 5i). However semiquantitative RT-PCR showed sufficient expression of the transgene, with negative regulation by the addition of doxycycline to the culture medium and a complete repression at 0.1 ␮g/ml of doxycycline (Fig. 6). This result suggests that the PrP produced by the two recombinant viruses are adequately attached to the cell membrane by a GPI anchor. This observation was confirmed by treatment of PrP overexpressing CHO-KI cells by PIPLC. In flow cytometry, the result of this treatment led to a decrease

of the percentage of transduced cells, as well as a drop of the fluorescence intensity, indicating that GPI anchored PrP was digested by PIPLC (Fig. 5h). PrP Expression in Organotypic Brain Slices The ability of the recombinant AdTRVal and AdTRMet viruses to transduce cells from neural origin was tested by transduction assays of organotypic brain slices. Hippocampal and cerebellar slices from PrP 0/0 mice were cotransduced with AxCMNtTA and AdTRMet. PrP expression was detected by Western blot analysis. As shown in Fig. 7, the results showed no PrP expression in slices transduced with AxCMNtTA alone, but high PrP expression in the two regions studied when AxCMNtTA was cotransduced with AdTRMet. The protein produced by the viruses had a higher molecular mass than the proteinase K (PK) digested PrP-res purified from a CJD brain homogenate, as the PK treatment leads to the clivage of the N-terminal region of the PrP-res. The protein pattern showed the three characteristic bands of the PrP, indicating that the proteins produced by the recombinant viruses were correctly glycosylated. PK digestion of the transduced slices led to the disappearance of the PrP signal, indicating that the PrP produced by the AdTRMet virus was apparently sensitive to PK digestion. DISCUSSION We have established a high expression system of the human PrP genes, encoding either a valine or a methionine at position 129, by constructing adenoviruses that inducibily express these proteins. To our knowledge, this is the first time that such tools have been described. The adenovirus-mediated inducible expression system will be useful for basic studies on the PrP function or its role in transmissible spongiform enceph-

628

Vol. 285, No. 3, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 5. Cell surface expression of PrP by flow cytometry. CHO-KI cells were cotransduced with AxCMNtTA and either AdTRVal (a– c) or AdTRMet (d–f). Cells were cultured in the absence (a, d) or presence of 0.05 (b, e) or 0.1 ␮g/ml (c, f) of doxycycline. Cells were incubated at 4°C with an anti-PrP Pri308 antibody or with its isotypic IgG1 control, followed by PE-conjugated goat anti-mouse incubation. The level of cell surface expression is indicated by the shift of the solid histogram to the right from the open control histogram. The percentage of cell transduction (Cell Trs.) and the fluorescence intensity (Fluo. Int.) is indicated on each histogram. As a control, CHO-KI were transduced with AxCMNtTA vector alone (g). To verify the GPI anchorage of the PrP at the cell surface, AxCMNtTA and AdTRMet cotransduced CHO-KI cells were treated with PIPLC (h); and a GPI mutated G9PLAP.85 cell line was cotransduced by AxCMNtTA and AdTRMet (i). Similar results were obtained with AdTRVal (not shown).

629

Vol. 285, No. 3, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 6. Quantitative evaluation of PrP mRNA in CHO-KI (white bars) or G9PLAP.85 (black bars) cell lines. Cells were transduced with AxCMNtTA virus alone or cotransduced with AxCMNtTA and either AdTRMet (a) or AdTRVal (b) viruses. Cotransduced cells were cultured in the absence or presence of 0.05 or 0.1 ␮g/ml of doxycycline. Signal intensities have been normalised with GAPDH control.

alopathies (TSE). Until now, PrP has been mainly overexpressed in vitro in order to render cells more susceptible to TSE infection (25). However, this approach has not always given positive results and it is difficult to predict if specific cells, including neurones, will be susceptible to TSE infection after PrP overexpression. For example, no infection has been reported in a CHO cell line overexpressing the hamster PrP (26), or in a human neuroblastoma SH-SY5Y cell line overexpressing the wild type or mutated human PrP (27). This illustrates the relevance of adenovirusmediated PrP transfer which can easily induce high expression of the protein in a wide variety of cells, in vivo as well as in vitro, especially primary-cultured cells, which are difficult to transduce by conventional transfection methods. The large range of cells susceptible to adenovirus transduction raises the possibility to develop in vitro models for TSE infection or PrP

fundamental studies. The use of transduced primary Prnp-deleted neurones would allow, for example, to further investigate the superoxide dismutase activity of the PrP (6), or its role in neuronal cell death (28) and in signal transduction (7). In our constructions, the PrP gene was put under the control of a regulable promoter for two specific reasons. The first one corresponds to concerns about biosafety, as adenoviruses are highly dispersible vectors that can be airborne propagated. In the tetracycline-regulable system presented here, the PRNP gene expression requires the presence of the tTA transactivator, which is expressed from a second adenovirus. To avoid propagation of viruses that constitutively express the human PrP, the virus encoding the PrP gene and the virus encoding tTA were cultured and amplified separately in E1-complementing cells, and put together just before transduction of non-complementing cells. The second reason concerns the control of PrP expression in the models that might be developed with adenovirusmediated PrP gene transfer. The tetracyclineregulable expression system allows a control of the PrP expression at multiple steps (multiplicity of infection of the viruses and regulation of the tTA function by tetracycline dosage): then, quantitative factors in levels of PrP overexpression effects may be estimated. A tetracycline-inducible murine PrP N2a cell line has already been described (29); but it is a stably transfected cell line in which the effects of PrP overexpression are difficult to estimate as it has a high level of endogenous PrP expression. In order to optimise the inducible adenovirus-mediated gene expression system, we have chosen the NtTA transactivator described by Yoshida et al. (18), and doxycycline which allow a better regulation activity than tTA and tetracycline.

FIG. 7. Western blot analysis of PrP-c in cerebellar or hippocampal brain slices transduced with AxCMNtTA virus alone or cotransduced with AxCMNtTA and AdTRMet. Slices homogenates were loaded before or after proteinase K treatment (⫹PK). As a control, 2 mg of a proteinase K-digested Creutzfeldt–Jakob disease brain homogenate (CJD) was loaded.

630

Vol. 285, No. 3, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

We have first evaluated the influence of the adenovirus genome on the tetracycline-regulable promoter. Particular attention was given to the E1a enhancer that is located in the encapsidation signal of the virus, upstream of the E1 region which is substituted by the transgene expression cassette. To test the efficiency of the tetracycline-regulable system in the context of recombinant adenoviruses, we have constructed two plasmids containing the whole genome of recombinant adenoviruses including the firefly luciferase reporter gene under the control of the tetracycline-regulable promoter. The reporter gene was cloned in two orientations. In the pRVLucLR construction, the transgene expression cassette is oriented in such a way that the transcription of the gene occurs from the left to the right. In this plasmid, the inducible promoter is located immediately downstream of the E1a enhancer. The pRVLucRL plasmid exhibits the other orientation, where the E1a enhancer does not influence the tetracycline-regulable promoter. When tested for luciferase activity, both plasmids exhibited high expression of the transgene in the presence of the NtTA transactivator. However, pRVLucLR showed a significantly higher basal expression (in the absence of NtTA or in the presence of doxycycline) than pRVLucRL, probably due to the influence of the E1a enhancer. In the pAdLucRL construction, the adenovirus sequences located upstream of the transgene expression cassette did not seem to interfere in the transgene expression and regulation. In order to avoid a deregulation of the PRNP gene due to the E1a enhancer, the recombinant viruses expressing the human PrP were constructed in the RL orientation. The results obtained by transduction of CHO-KI cells with AdTRVal or AdTRMet confirmed those obtained by Yoshida et al. High expression of the PrP was obtained in the presence of NtTA transactivator, and complete repression was obtained with concentrations of doxycycline at concentrations as low as 0.1 ␮g/ml. The human PrP expressed from the AdTRVal and AdTRMet viruses had a clear membrane location, where they were attached by a GPI anchor, as demonstrated by the sensitivity of the proteins to PIPLC digestion and by the absence of membrane expression in a GPI mutated cell line. The successful transduction of organotypic brain slices showed the ability of AdTRVal and AdTRMet to transduce cells from neural origin. In fact, these brain explants overexpressing PrP might be a good model for future studies, as it mimics the in vivo conditions. The recombinant adenoviruses that inducibily express the PrP gene will be used in future experiments aiming to solve some of the problems in prion research, such as the PrPc function and metabolism, or the consequences of its transconformation into PrP-res.

REFERENCES 1. Prusiner, S. B., Scott, M. R., DeArmond, S. J., and Cohen, F. E. (1998) Prion protein biology. Cell 93, 337–348. 2. Palmer, M. S., Dryden, A. J., Hughes, J. T., and Collinge, J. (1991) Homozygous prion protein genotype predisposes to sporadic Creutzfeldt–Jakob disease. Nature 352, 340 –342. 3. Collinge, J., Whittington, M. A., Sidle, K. C. L., Smith, C. J., Palmer, M. S., Clarke, A. R., and Jefferys, J. G. R. (1994) Prion protein is necessary for normal synaptic function. Nature 370, 295–297. 4. Sakaguchi, S., Katamine, S., Nishida, N., Moriuchi, R., Shigematsu, K., Sugimoto, T., Nakatani, A., Kataoka, Y., Houtani, T., Shirabe, S., Okada, H., Hasegawa, S., Miyamoto, T., and Noda, T. (1996) Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene. Nature 380, 528 –531. 5. Tobler, I., Gaus, S. E., Deboer, T., Achermann, P., Fischer, M., Rulicke, T., Moser, M., Oesch, B., Mcbride, P. A., and Manson, J. C. (1996) Altered circadian activity rhythms and sleep in mice devoid of prion protein. Nature 380, 639 – 642. 6. Brown, D. R., Wong, B. S., Hafiz, F., Clive, C., Haswell, S. J., and Jones, I. M. (1999) Normal prion protein has an activity like that of superoxide dismutase. Biochem. J. 344(Pt 1), 1–5. 7. Mouillet-Richard, S., Ermonval, M., Chebassier, C., Laplanche, J. L., Lehmann, S., Launay, J. M., and Kellermann, O. (2000) Signal transduction through prion protein. Science 289, 1925– 1928. 8. Bu¨eler, H., Fischer, M., Lang, Y., Bluethmann, H., Lipp, H.-P., DeArmond, S. J., Prusiner, S. B., Aguet, M., and Weissmann, C. (1992) Normal development and behaviour of mice lacking the neuronal cell surface PrP protein. Nature 356, 577–582. 9. Prusiner, S. B. (1993) Transgenetic investigations of prion diseases of humans and animals. Philos. Trans. R. Soc. London B Biol. Sci. 339, 239 –254. 10. Harris, D. A., Huber, M. T., van Dijken, P., Shyng, S. L., Chait, B. T., and Wang, R. (1993) Processing of a cellular prion protein: Identification of N- and C-terminal cleavage sites. Biochemistry 32, 1009 –1016. 11. Lee, H. G., Park, S. J., Choi, E. K., Carp, R. I., and Kim, Y. S. (1999) Increased expression of prion protein is associated with changes in dopamine metabolism and MAO activity in PC12 cells. J. Mol. Neurosci. 13, 121–126. 12. Petersen, R. B., Parchi, P., Richardson, S. L., Urig, C. B., and Gambetti, P. (1996) Effect of the D178N mutation and the codon 129 polymorphism on the metabolism of the prion protein. J. Biol. Chem. 271, 12661–12668. 13. Tumas, D. B., Spangrude, G. J., Brooks, D. M., Williams, C. D., and Chesebro, B. (1996) High-frequency cell surface expression of a foreign protein in murine hematopoietic stem cells using a new retroviral vector. Blood 87, 509 –517. 14. Gossen, M., and Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89, 5547–5551. 15. Gossen, M., Bonin, A. L., and Bujard, H. (1993) Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements. Trends Biochem. Sci. 18, 471– 475. 16. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977) Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 36, 59 –74. 17. Stevens, V. L., Zhang, H., and Harreman, M. (1996) Isolation and characterization of a Chinese hamster ovary (CHO) mutant defective in the second step of glycosylphosphatidylinositol biosynthesis. Biochem. J. 313, 253–258. 18. Yoshida, Y., and Hamada, H. (1997) Adenovirus-mediated inducible gene expression through tetracycline-controllable transacti-

631

Vol. 285, No. 3, 2001

19.

20.

21.

22.

23.

24.

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

vator with nuclear localization signal. Biochem. Biophys. Res. Commun. 230, 426 – 430. Jaegly, A., Mouthon, F., Peyrin, J. M., Camugli, B., Deslys, J. P., and Dormont, D. (1998) Search for a nuclear localization signal in the prion protein. Mol. Cell Neurosci. 11, 127–133. Oualikene, W., Gonin, P., and Eloit, M. (1995) Lack of evidence of phenotypic complementation of E1A/E1B-deleted adenovirus type 5 upon superinfection by wild-type virus in the cotton rat. J. Virol. 69, 6518 – 6524. Ambriovic, A., Adam, M., Monteil, M., Paulin, D., and Eloit, M. (1997) Efficacy of replication-defective adenovirus-vectored vaccines: Protection following intramuscular injection is linked to promoter efficiency in muscle representative cells. Virology 238, 327–335. Graham, F. L., and Eb AJvd. (1973) A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456 – 467. Demart, S., Fournier, J. G., Creminon, C., Frobert, Y., Lamoury, F., Marce, D., Lasmezas, C., Dormont, D., Grassi, J., and Deslys, J. P. (1999) New insight into abnormal prion protein using monoclonal antibodies. Biochem. Biophys. Res. Commun. 265, 652– 657. Benveniste, O., Vaslin, B., Le Grand, R., Cheret, A., Matheux, F., Theodoro, F., Cranage, M. P., and Dormont, D. (1996) Comparative interleukin (IL-2)/interferon IFN-gamma and IL-4/IL-10

25.

26.

27.

28.

29.

632

responses during acute infection of macaques inoculated with attenuated nef-truncated or pathogenic SICmac251 virus. Proc. Natl. Acad. Sci. USA 93, 3658 –3663. Nishida, N., Harris, D. A., Vilette, D., Laude, H., Frobert, Y., Grassi, J., Casanova, D., Milhavet, O., and Lehmann, S. (2000) Successful transmission of three mouse-adapted scrapie strains to murine neuroblastoma cell lines overexpressing wild-type mouse prion protein. J. Virol. 74, 320 –325. Blochberger, T. C., Cooper, C., Peretz, D., Tatzelt, J., Griffith, O. H., Baldwin, M. A., and Prusiner, S. B. (1997) Prion protein expression in Chinese hamster ovary cells using a glutamine synthetase selection and amplification system. Protein Eng. 10, 1465–1473. Vetrugno, V., Malchow, M., Liu, Q., Marziali, G., Battistini, A., and Pocchiari, M. (1999) Expression of wild-type and V210I mutant prion protein in human neuroblastoma cells. Neurosci. Lett. 270, 41– 44. Kuwahara, C., Takeuchi, A. M., Nishimura, T., Haraguchi, K., Kubosaki, A., Matsumoto, Y., Saeki, K., Matsumoto, Y., Yokoyama, T., Itohara, S., and Onodera, T. (1999) Prions prevent neuronal cell-line death. Nature 400, 225–226. Windl, O., Lorenz, H., Behrens, C., Romer, A., and Kretzschmar, H. A. (1999) Construction and characterization of murine neuroblastoma cell clones allowing inducible and high expression of the prion protein. J. Gen. Virol. 80, 15–21.