Neuregulin-1α and β isoform expression in cardiac microvascular endothelial cells and function in cardiac myocytes in vitro

Experimental Cell Research 311 (2005) 135 – 146 www.elsevier.com/locate/yexcr

Research Article

Neuregulin-1a and h isoform expression in cardiac microvascular endothelial cells and function in cardiac myocytes in vitro Gregory M. Cote, Thomas A. Miller, Nathan K. LeBrasseur, Yukio Kuramochi, Douglas B. Sawyer* Whitaker Cardiovascular Institute and Molecular Stress Response Unit, Cardiovascular Division, Department of Medicine, Boston University Medical Center, 650 Albany Street, Boston, X-320, MA 02118, USA Received 16 January 2004, revised version received 26 August 2005, accepted 29 August 2005 Available online 26 September 2005

Abstract Neuregulins (NRGs) are a family of alternatively spliced growth factors that act through receptor tyrosine kinases of the epidermal growth factor (EGF) receptor family in diverse tissues. The NRG-erbB signaling axis is a critical mediator of cardiac development, and growing evidence supports a role for this system in the intricate cross-talk between the microvascular endothelium and myocytes in the adult heart. The purpose of this study was first to examine the expression of splice variants of the NRG1 gene in adult rat cardiac microvascular endothelial cells and second to compare the function of these variants in cardiac myocytes. We demonstrate that cardiac microvascular endothelial cells in rat culture express multiple Type I NRG1 gene products, including both a and h variants. Comparison of the activity of recombinant NRG1a and NRG1h EGF-like domain proteins in cardiac myocytes shows that the h ligand is a more potent activator of receptor phosphorylation and intracellular signaling than the a ligand, and only the h ligand stimulated glucose uptake and protein synthesis in these culture conditions. Thus, cardiac microvascular endothelial cells express multiple NRG1 isotypes, but only h-variants are biologically active on cardiac myocytes. D 2005 Elsevier Inc. All rights reserved. Keywords: Neuregulin; erbB2; Cardiac microvascular endothelial cell; Cardiac myocyte

Introduction Neuregulins (NRGs) are a family of growth factors that are ligands for receptor tyrosine kinases in the epidermal growth factor (EGF) receptor family (for review, see [1,2]). NRGs are made from alternatively spliced transcripts of one of four known genes (NRG1, -2, -3 and -4) and are expressed in diverse tissues. NRGs were originally identified in search of a ligand for the oncogene neu (a.k.a. HER2, erbB2) and have been shown to activate growth, differentiation and survival signaling pathways in multiple cell types including breast epithelial cells, glial cells, neurons, skeletal and cardiac myocytes [3 –8]. In the developing heart, mice deficient in NRG1, or the erbB2 or erbB4 * Corresponding author. Fax: +1 617 414 1719. E-mail address: [email protected] (D.B. Sawyer). 0014-4827/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2005.08.017

receptors, die in mid-gestation due to a virtually identical malformation of heart trabeculae [9 –11]. In addition, NRG1 and the erbB receptors have been shown to play a role in both murine cardiac conduction system development [12] and heart-valve mesenchyme formation [13]. The importance of the NRG-erbB signaling axis in the adult heart was demonstrated by an unforeseen cardiotoxicity of a novel chemotherapeutic agent targeting the erbB2 receptor: trastuzumab [14,15]. Characterization of the effects of trastuzumab on cardiac structure and function remains incomplete. At the least, this cardiotoxic effect suggests that alteration of NRG-erbB signaling in the heart can lead to changes in ventricular function, particularly in the setting of myocardial injury. This clinical observation highlights the need for a more complete understanding of the molecular details of NRG-erbB signaling in the heart beyond its role in cardiac development.

136

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

Post-natal cardiac myocytes continue to express the erbB2 and erbB4 receptors, but not erbB3, while cardiac microvascular endothelial cells (CMEC) express NRG1 [16]. Neonatal and adult rat ventricular myocytes (NRVM/ ARVM) in primary culture respond to recombinant NRG1 II-h3 (rhGGF2) with increased protein synthesis and fetal gene expression [16]. NRG1 II-h3 treatment also improves survival of myocytes through inhibition of apoptotic cell death [16], and rNRG1 EGFh modulates anthracyclineinduced myofilament degradation [17]. These data suggest a role for NRG1h/erbB signaling in the cross-talk between the microvascular endothelium and myocytes in the adult heart that regulates the adaptation of myocardial structure and function to changes in hemodynamic load (see Brutsaert, 2003 for a review of the microvascular endothelium/ myocyte relationship [18]). The NRG1 gene has a complicated structure encoding at least 15 different isoforms from approximately 1.4 megabases of DNA [6,19]. Distinct NRG isoforms were initially isolated from diverse tissues and with names that reflected their ascribed function including glial growth factor (GGF), acetylcholine-receptor-inducing activity (ARIA), heregulin (derived from Fregulator of HER2_) and neu differentiation factor (NDF). The defining motif common to all NRG isoforms is an epidermal growth factor-like (EGF) domain that is both necessary and sufficient for activation of receptors (Fig. 1A). The EGF domain is a three-loop structure containing six cysteine residues that form three disulfide bridges. Alternative splicing at the carboxyterminus of this domain leads to NRGa and h variants, which have distinct affinity for the erbB3 and erbB4 receptors [20]. Depending on the cell and its receptor complement, NRG1h has been reported to be 10 –100 times more active than NRG1a [21]. Defects in post-natal breast development are seen in mice lacking NRG1a, but not NRG1h [22], supporting a model where NRGa and h variants serve distinct tissue-specific functions. The NRG1 gene products can be subdivided into three types (Type I, II and III). Type I and II NRG1 proteins are expressed invariably with a C-2 immunoglobulin-like (Ig) domain that is thought to be involved in the binding of heparan –sulfate proteoglycans in extracellular matrix to increase ligand half-life and thereby activity [23]. In addition, at the amino terminus, Type II NRG1 products include a kringle fold of unknown function. Type III NRG1 are unique in that, rather than expressing an Ig domain, they contain a cysteine-rich domain (CRD). This CRD includes a 5V hydrophobic sequence that readily associates with the cell membrane. Therefore, unlike Type I and II NRG1, which are type 1 transmembrane proteins that only span the membrane once, it is thought that Type III (CRD) NRG1 has two membrane-spanning regions [24,25]. Type I NRG1 also express sites for N- and O-linked glycosylation between the Ig and EGF domains (spacer domain). The glycosylation domain is present in nearly all Type I NRG1, but absent from most Type II and all Type III.

Immediately adjacent to the transmembrane domain is the stalk domain. Alternative splicing of the stalk domain is responsible for formation of soluble NRG1 (i.e. h3) or one of several full-length transmembrane NRG1 or ‘‘pro-NRG’’ variants (e.g. h1, h2, h4), which are available for proteolytic processing to a soluble ligand. Putative enzymes responsible for stalk cleavage and activation of pro-NRG include members of the ADAM (a disintegrin and metalloprotease) family of metalloproteases, such as tumor necrosis factor a converting enzyme (TACE/ADAM17) [26] or meltrin-h (ADAM19) [27]. Transmembrane NRG1 is expressed with three possible cytoplasmic tail exon combinations (termed ‘‘cytoplasmic a, b and c’’). Immediately adjacent to the transmembrane region is the common cytoplasmic region, which is followed by exons encoding either the cytoplasmic a or b domains. The cytoplasmic c exon includes an immediate stop codon so the protein is expressed only with the common region. The functions of the cytoplasmic domains remain unknown, but they appear to be required for membrane localization and proteolytic release [28,29]. Recent evidence suggests that cytoplasmic domains could be involved in ‘‘reverse signaling’’ where the cleaved cytoplasmic tail can migrate to the nucleus as a regulator of transcription [30,31]. We have previously determined that CMEC express the NRG1 ligand by Northern blot analysis using an extracellular probe common to all Type I and II NRG1 [16]. However, the probe used did not distinguish between the NRG1 isoforms. We therefore developed a strategy to examine specific NRG1 isoforms expressed in CMEC. We found that CMEC express multiple Type I NRG1 including both EGF-like domain a and h splice variants. We compared the effects of recombinant NRG1a and h EGFlike domain proteins (referred to as rNRG1 EGFa and rNRG1 EGFh, respectively) on cardiac myocytes and found that the h isotype is a more potent activator of erbB receptor phosphorylation and intracellular signaling than a ligand. Moreover, we found that only rNRG1 EGFh was bioactive in stimulating glucose uptake and protein synthesis in these cardiac myocyte cultures. These data point to a role for NRG1h on target cardiac myocytes, while the function of NRG1a in CMEC remains unknown.

Materials and methods Primary culture of cardiac microvascular endothelial cells Coronary microvascular endothelial cells (CMEC) from adult Sprague –Dawley rat hearts were isolated as described by Nishida et al. [32]. Isolated cells were plated at a density of ¨100 cells/mm2 on tissue culture plates coated with laminin. One hour after plating, cells were washed twice with DMEM (Gibco BRL) and then maintained in DMEM supplemented with 20% fetal bovine serum (FBS, Gibco BRL) at 37-C and 5% CO2. Unless otherwise indicated,

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

137

Fig. 1. CMEC expression of NRG1a and h splice variants. (A) A diagram of Type I NRG1 protein is shown. Alternate known domains are indicated. I: Type Isequence-specific region. Ig: the immunoglobulin-like domain, composed of two exons, Ig1 and Ig2 (also referred to as Iga and Igb), is a proposed extracellular matrix-binding region. Sp: the spacer domain (also referred to as the glycosylation domain) is a putative site for N- or O-linked glycosylation. This domain is composed of two exons as well, termed s1 and s2. EGF: the EGF-like domain is responsible for receptor activation. It is expressed with a common region and either a or h sequence modifications at the carboxy-terminus. St: the stalk domains are expressed 3V to the EGF-like sequences. Exons in this region include sequences 1, 3 and 4. The stalk 3 sequence includes a stop codon resulting in a soluble, non-transmembrane protein. In NRG1 expressed without stalk regions 1, 3 or 4, the EGFlike a or h sequence is joined directly to the transmembrane domain; these isoforms are labeled a2 or h2 in the literature. Tm: the transmembrane region. Cytoplasmic: the cytoplasmic domain is composed of a common cytoplasmic domain of 3 exons followed by three alternate exons termed a, b and c. The cytoplasmic c exon includes an immediate stop codon so that the ligand is expressed only with the common region (that is, beyond the common region, there is no c-specific protein sequence). Figure modified from Cote and Sawyer [43]. (B) PCR analysis showing CMEC expression of Type I, but not Type II or CRD Type III NRG1. Top panel: cDNA generated from primary culture CMEC RNA underwent PCR amplification with intron-spanning primer sets (see Table 1 for primer list) to the NRG1 immunoglobulin domain (primer 2) and either the a (primer 4) or h domains (primer 5). PCR products were consistent with the predicted sizes and are 392 for Ig-a and 401 for Ig-h. These RT-PCR results indicate that at least one NRG1 isoform with an EGF-like domain type a and at least one NRG1 isoform with an EGF-like domain type h are present. Similar reactions using Type-II-specific primers (Kringle 1 and 2) or Type III (CRD) show no evidence for the expression of these isoforms in CMEC, though the appropriately sized products were expressed in whole brain mRNA. Gel shown is representative of 3 independent RT-PCR analyses with CMEC or Brain RNA isolates from 3 different animals. (C) Further RT-PCR analysis to identify other expressed domains including primers targeting (in order from top to bottom) NRG1 immunoglobulin domain (primer 2) and stalk sequences 1 (primer 7) and 4 (primer 9; expected product sizes of 456 and 510), immunoglobulin domain (primer 2) and exon sequence 3 (primer 8; expected product size of 453), and transmembrane domain (primer 6) or immunoglobulin domain (primer 2) and cytoplasmic domain a (primer 10). Note that when the exon for cytoplasmic domain-b is expressed the cytoplasmic domain a is included in the mRNA molecule downstream of a stop codon (in the cyt-b exon). Therefore, when both cyt-a and cyt-b are expressed, the RT-PCR reaction using the Tm upstream and cyt-1 downstream primers yields two products with expected sizes of 506 and 649 respectively. Two bands of appropriately larger size are detected with the Ig upstream primer. Gels shown are representative of 4 – 6 independent experiments. Cytoplasmic c isoforms were also detected by RT-PCR using a cyt-cspecific sequence downstream of the immediate stop codon in this exon (primer 11, expected product sizes 1073 to 1094 using primer 1 as forward primer; results not shown). (D) Representation of Type I NRG1 gene products expressed in CMEC identified by PCR/plasmid-based cloning strategy. Pools of Type I NRG1 PCR product were generated with the primers targeting the Type-I-sequence-specific start codon region (primer 1) and either the cytoplasmic a (primer 10) or cytoplasmic c (primer 11) domains. These products were cloned into plasmids, and bacterial colonies were screened for expression of different Type I NRG1 isoforms using the primers listed in Table 1. NRG1 isoform identity was confirmed by sequencing. This analysis revealed expression of at least 11 different Type I NRG1 isoforms. Accession numbers corresponding to each sequence are shown at the right (*novel isoforms identified). The number of clones identified is indicated, giving an estimate of the relative frequency of each isoform. NRG1h3 was sequenced directly from its PCR product.

138

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

CMEC were grown until confluent (typically 5 –7 days), changing media every 3 days, before lysing for analysis of NRG expression.

University Medical Center Gencore Sequencing Facility (ABI 377– 96). For the identification of other domains, RTPCR was carried out as above with the primer pairs indicated (Table 1, no-template controls not shown).

Primary culture of ventricular myocytes RT-PCR/plasmid cloning strategy Neonatal rat ventricular myocytes (NRVM) were isolated as previously described [16,33] from 1- to 2-day-old Sprague – Dawley rat pups by enzymatic digestion. After pre-plating to minimize non-myocyte contamination, cells were plated at a density of ¨250 cells/mm2 in DMEM supplemented with 7% FBS and cultured for 24 to 48 h at 37-C and 5% CO2. Under these conditions, adherent NRVM spread over a period of 48 h to become a confluent monolayer. Prior to treatment, media was changed to serumfree DMEM for 18 to 24 h. Adult rat ventricular myocytes (ARVM) were isolated and plated on laminin-coated culture ware at a density of ¨60 cells/mm2 as previously described [16]. One hour following isolation, plating media was removed along with non-adherent cells, leaving a final density of ¨20 cells/mm2 (¨40% confluence). ARVM were cultured in DMEM supplemented with albumin (0.2% w/v), carnitine (2 mM), creatine (5 mM) and taurine (5 mM) for 24 h at 37-C and 5% CO2 prior to initiating. NRG1a and b isoform identification by RT-PCR A cDNA pool was generated by reverse transcriptase (SuperScript First Strand Synthesis System, Gibco BRL) with oligo(dT) priming from total RNA isolated from rat CMEC primary cultures grown to confluence over 6 – 7 days. For initial NRG1 detection, the cDNA product subsequently underwent PCR amplification with primer sets designed from known rat exon sequences to the NRG1 Ig domain (Table 1, primer 2) and either the a (primer 4) or h (primer 5) domains (see Fig. 1A). The PCR products were TA-cloned into the pCR 2.1-TOPO vector (Invitrogen), and plasmid NRG1 sequences were confirmed at the Boston

To clone specific NRG1 isotypes, cDNA product underwent PCR amplification with primer sets including a common upstream primer targeting the Type I start codon (Table 1, primer 1) and downstream primers targeting either cytoplasmic domain a/b (primer 10, cytoplasmic b isoforms express cytoplasmic a exon behind a stop codon; therefore, the primer will detect mRNAwith either exon) or cytoplasmic c exon (primer 11). The PCR products were TA-cloned into the pCR 2.1-TOPO vector, as above, generating plasmid pools of all Type I NRG1a and h expressed in CMEC. Over 200 colonies in total were screened for unique inserts by PCR (see Table 1 for primer list), and sequences of selected plasmids were confirmed as above. Neuregulin-1 siRNA treatment We designed NRG1 siRNA (synthesized by Xeragon Oligoribonucleotides) to target the EGF-like domain, which is present in all NRG1 splice variants. Isolated CMEC were plated on 6-well plates at approximately 60% confluence. Following serum starvation, CMEC were changed to media without antibiotics immediately before RNA transfection (Qiagen TransMessenger Transfection Reagent) with either 2 Ag of double-stranded randomly generated control siRNA (uucuccgaacgugucacgu) or NRG1 siRNA (ccuggauucacuggagcaa) (Genbank Reference number RNU02324, bases 684 to 702). After 4 h of treatment, the transfection complexes were removed, and media was changed back to serum-free media with antibiotics. After 24 h of further incubation, cells were lysed and analyzed for NRG1 expression by Western blot.

Table 1 Primers for NRG1 PCR and sequencing Primer #(name)

Domain

Sequence

Direction

Genbank ID

1 2 3 4 5 6

5V terminus Immunoglobulin Glycosylation EGF-a EGF-h Transmembrane

atcttcggcgagatgtctga cagaagaagccagggaagtc aacagaaggcgcaaacactt gctccagtgaatccaggttg tggcaacgatcaccagtaaa gtggtggcctactgcaaaac gttttgcagtaggccaccac cgcctccataaattcaatcc cagagacagaaagggagtgga cgctttcgattctttcacaag ggtggtcatggctgatacat cttaggagagaccgcaggtg gaggagggtcagggtaggag ggtccccagtagtagcagca ggtgagccgatggagattta

Forward/sense Forward/sense Forward/sense Reverse/Anti-sense Reverse/Anti-sense Forward/sense Reverse/Anti-sense Reverse/Anti-sense Reverse/Anti-sense Reverse/Anti-sense Reverse/Anti-sense Reverse/Anti-sense Forward/sense Reverse/Anti-sense Forward/sense

RNU02323 RNU02323 RNU02323 RNU02323 RNU02322

(Ig) (a) (h) (TM)

7 (St1) 8 (St3) 9 10 11 12 13 14

Stalk 1 Stalk 3 Stalk 4 Cytoplasmic a Cytoplasmic c Type II Kringle-like Type II Kringle-like Cysteine-rich Domain

RNU02322 NM013956 RNU02315 RNU02322 RNU02322 RNU02324 AF194994 AF194994 AF194439

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

139

Detection of NRG1 protein expression

Detection of erbB2 and erbB4 phosphorylation

CMEC were lysed in modified RIPA buffer containing Tris (50 mM, pH 7.5), NaCl (150 mM), EDTA (500 mM), NP-40 (1% v/v), deoxycholate (0.25% w/v), sodium fluoride (1 mM), sodium orthovanadate (100 mM), leupeptin (1 Ag/ml) and PMSF (1 mM). Prior to loading, samples were adjusted to equal protein concentrations using measurements obtained by Bradford analysis (Bio-Rad). Samples were separated on 4 –20% Tris –HCL gradient gels (Cambrex) and transferred to PVDF membranes (Bio-Rad). Signal intensity was determined by densitometry using Molecular Analyst software (Bio-Rad). Membranes were probed with NRG1 antibody (Neomarkers, Ab-1, Cat# MS272, mouse monoclonal clone 7D5) targeting a common extracellular domain (hereafter referred to as ‘‘common 7D5 antibody’’), NRG1a antibody (Neomarkers, Ab-3, Cat# RB277, rabbit polyclonal), NRG1h antibody (chicken polyclonal IgY [34]) and cytoplasmic a antibody (Santa Cruz Biotechnology, C-20, Cat# sc-348, rabbit polyclonal). The common 7D5 NRG1 antibody immunogen is the extracellular domain of recombinant NRG. According to the manufacturer, it reacts with both ‘‘NRG1a and h’’. It is unknown if this antibody will react with Type II and Type III NRG; therefore, the potential exists that it could recognize all NRG1 isoforms. For Western blot analysis with the common 7D5 NRG1, the membrane was blocked in 2.5% BSA in 0.1% TBST (Tris (20 mM, pH 7.5), NaCl (136 mM), Tween 20 (0.1% v/v)), and the antibody was diluted 1:1000 v/v in 5% BSA/0.1%TBST. NRG1a, h and cytoplasmic a antibodies were blocked and diluted 1:1000 v/ v in 5% milk/0.1% TBST. Equivalent sample loading was confirmed by Western blot with total actin antibody (Sigma, clone AC-40) where membranes were stripped in IgG Elution Buffer (Pierce) according to the manufacturer’s instructions. Actin blots were blocked in 5% milk/0.1% TBST and probed with antibody diluted 1:1000 v/v in 5% milk/0.1% TBST. Secondary antibodies were HRP-conjugated goat anti-rabbit IgG (SC2004, Santa Cruz Biotechnology), goat anti-chicken IgG (SC2428, Santa Cruz Biotechnology) and goat anti-mouse IgG (SC2005, Santa Cruz Biotechnology). Chemiluminescence was purchased from Pierce (34080 and 24075).

ErbB receptor phosphorylation was detected as previously described [16] by immunoprecipitation from cell lysates in modified RIPA buffer. A brief description with modifications is as follows: 500 Ag of total protein at 1 Ag/Al in modified RIPA buffer was pre-cleared with protein A/G plus agarose beads (Santa Cruz Biotechnology, 30 Al of 50% beads in modified RIPA) for 1 h. The beads were pelleted by centrifugation, and the supernatant was collected. Samples were immunoprecipitated with antibodies to erbB2 (SC284, Santa Cruz Biotechnology, rabbit polyclonal) or erbB4 (SC283, Santa Cruz Biotechnology, rabbit polyclonal), 2 Al per sample with protein A/G plus agarose beads (30 AL of 50% beads), for 18– 24 h. Sample/antibody/ bead complexes were centrifuged, washed and subsequently resolved by SDS-PAGE and electroblotted to PVDF membranes (Bio-Rad). Membranes were blocked in 5% milk/0.1% TBST and developed with anti-phosphotyrosine antibody (SC7020, Santa Cruz Biotechnology) diluted 1:1000 v/v in 5% BSA/0.1% TBST. Secondary antibody was HRP-conjugated goat anti-mouse IgG (SC2005, Santa Cruz Biotechnology), and chemiluminescence was performed as above. To confirm receptor precipitation, membranes were stripped with IgG elution buffer (Pierce) and reprobed with anti-erbB2 or anti-erbB4 used for immunoprecipitation.

Recombinant ligands The recombinant NRG1 ligands used were R&D Systems NRG1h EGF domain (Cat# 396-HB FNRG-1-h1_, amino acid residues 176– 246 corresponding to Genbank sequence NM_013856, approximate MW 8 kDa; referred to as rNRG1 EGFh in the text) and R&D Systems NRG1a EGF domain (Cat# 296-HR, amino acid residues 177 –241 corresponding to Genbank sequence NM_013964, approximate MW 7 kDa, referred to as rNRG1 EGFa in the text). Both ligands were prepared using an E. coli expression system.

Detection of Erk1/2 and Akt activation Erk1/2 and Akt activations were assessed using immunoblots for phosphorylated kinases. Following 10 min of rNRG1 treatment, myocytes were lysed and analyzed by SDS-PAGE/Western blotting for phosphorylated-Erk1/2 (Thr 202/Tyr 204, Cell Signaling Technology, Cat# 9101) or phosphorylated-Akt (Ser 473, Cell Signaling Technology, Cat# 9271). Membranes were blocked in 5% milk/0.1% TBST (1 h), and each antibody was diluted in 5% BSA/ 0.1% TBST, 1:1000 v/v according to the manufacturer’s instructions, with subsequent membrane incubation overnight. Secondary antibodies were HRP-conjugated goat anti-rabbit IgG (SC2004, Santa Cruz Biotechnology), and chemiluminescence was performed as above. Signal intensity was determined by densitometry using the Molecular Analyst software package (Bio-Rad). 3

H-2-deoxyglucose uptake

Twenty-four hours following ARVM isolation, media was replaced with a transport solution containing HEPES (20 mM), NaCl (137 mM), KCl (4.7 mM), MgSO4 (1.2 mM), KH2PO4 (1.2 mM), CaCl2 (2.5 mM) and pyruvic acid (2 mM, pH 7.5) for 30 min. Myocytes were treated with rNRG1 for 20 min before the addition of 2-deoxy-d-glucose (D-6134, Sigma) to a final concentration of 0.2 mM and 2deoxy-d-3H-glucose (NET328, Perkin-Elmer) to a final

140

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

concentration of 2 ACi for 10 min at 37-C. Cells were lysed in 0.1 M NaOH with 0.1% SDS after washing twice with 5 ml ice-cold PBS. Samples were measured in triplicate by scintillation. For PI-3-kinase and MEK inhibition studies, ARVM were pretreated with LY294002 (10 AM final concentration, 10 mM stocks in DMSO stored at 20-C, Calbiochem) and U0126 (10 AM final concentration, 10 mM stocks in DMSO stored at 20-C, Calbiochem), respectively, 1 h before the addition of labeled glucose; DMSO was present in all samples tested at the same final concentration. Incorporation of 3H-leucine as a measure of protein synthesis 3

H-leucine incorporation was assayed as previously described [16]. Briefly, following 18 to 24 h in serum-free conditions, NRVM were stimulated with rNRG1 in the presence of 3H-leucine (1 Al/ml, TRK636, Amersham) for 24 h. Samples were measured in triplicate by scintillation.

cytoplasmic domain (Fig. 1C, primers listed in Table 1; cytoplasmic c data not shown). We detected multiple domains including stalk 1, stalk 4, stalk 3 and each cytoplasmic variant. However, it was unclear which of these are expressed with which NRG1 EGF-like domain (i.e. a or h). To address this, we generated two pools of Type I NRG1 PCR product with common primers from the Type I start codon (primer 1) or Ig (primer 2) and cytoplasmic domains a, b and c (primers 10 and 11). As demonstrated in Fig. 1C, downstream primer 10 amplifies both cytoplasmic a and b variants that differ in size by 142 bases. These product pools were cloned into plasmids, and bacteria colonies were screened for unique sequences by PCR. The NRG1 inserts in plasmids were confirmed by sequence analysis as above. Through this method, we determined that CMEC express at least 11 distinct Type I NRG1 ligands (Fig. 1D). While both ligand groups (i.e. a and h) are synthesized with each

Statistical analysis Results are expressed as mean T SD or SE (as indicated) of at least 3 different experiments. Data were analyzed by paired Student’s t test; P < 0.05 was considered statistically significant.

Results Multiple neuregulin-1a and b isoforms are expressed in cardiac microvascular endothelial cells in culture To determine if NRG1a isoforms, NRG1h isoforms or both a and h isoforms are expressed in the heart, we performed RT-PCR on CMEC RNA with intron-spanning primers specific to Ig-NRG1a and Ig-NRG1h (primers listed in Table 1). Identity of PCR products was confirmed by sequence analysis. These products demonstrate that CMEC express at least one Ig-NRG1 with an a EGF-like domain and at least one Ig-NRG1 with a h EGF-like domain (Fig. 1B). Both of these include the spacer glycosylation domain and are therefore likely Type I NRG1; however, some Type II NRG also include this domain so it is possible that they could be Type II NRG1 as well. To determine if Type II and Type III NRG1 were present, we screened CMEC RNA by RT-PCR with kringle domain (Type II) and CRD (Type III) primers. We were unable to detect any Type II or Type III NRG1 in CMEC. In a control experiment, we found that these primers did amplify the expected 245 bp and 842 bp products from RNA extracted from rat brain. Thus, Type II and Type III NRG1 gene product does not appear to be expressed in cultured rat CMEC. To determine which other domains are expressed in the Type I NRG1 products, we PCR-amplified from CMEC mRNA using primer sets targeting each NRG stalk and

Fig. 2. NRG1 protein expression. (A) NRG1 protein in CMEC was examined by standard Western blot analysis with the common (7D5) extracellular, cytoplasmic a, NRG1 EGFa and NRG1 EGFh antibodies. Immunoblots reveal multiple bands whose identity were unknown. Each blot shown is representative of at least 6 independent experiments. (B) To determine the specificity of the antibodies employed, CMEC were transfected with either control or NRG1 siRNA. Immunoblots were probed with NRG1 antibodies as above. RNA interference reduced the expression of the 114 kDa cluster by each antibody identifying this as NRG1 gene products. The 160 kDa protein in the common 7D5 Western immunoblots decreased with siRNA, suggesting this is also a NRG1 gene product. Each blot shown is representative of 4 – 6 independent experiments.

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

cytoplasmic domain, NRG1h, but not NRG1a, is expressed with stalk domains 1, 3 and 4. Based upon the proportion of clones expressing particular splice variants, we estimate that the predominant Type I NRG1 isoforms expressed at the mRNA level are NRG1as. The predominant Fcytoplasmic a_ was NRG1a2a (10 of 12 colonies). Of the 2 (of 12) NRG1ha clones, 1 was stalk 1, and 1 was stalk 2. The predominant Fcytoplasmic b_ isotype was NRG1a2b (6 of 8 colonies). Of the 2 (of 8) NRG1hb clones, 1 was stalk 1, and 1 was stalk 4. Of the Fcytoplasmic c_ colonies screened, the predominant clone was NRG1a2c (19 of 30 colonies). Of the 11 (of 30) NRG1hc clones, 3 were stalk 4, 3 were stalk 1, and 5 were stalk 2. To verify NRG1a and h protein expression, confluent CMEC lysates were analyzed for isotype expression by standard SDS-PAGE/Western blot with the common 7D5 antibody, the anti-cytoplasmic a antibody, the anti-NRG1a antibody and the anti-NRG1h antibody. The calculated molecular weights, based on amino acid sequences, for Type I transmembrane NRG1 range from 46.1 kDa to 73 kDa. However, immunoblots for NRG1 protein typically yield clusters of several protein bands with varying molecular

141

weights [25,35], which may represent splice variants, immature protein, post-translationally modified protein or non-specific immunoreactivity. In CMEC, multiple proteins are detected with each antibody (Fig. 2A). All four antibodies show immunoreactivity at 60 kDa. For the common 7D5 antibody, this is a single band, while, with the anti-cyt-a, anti-NRGa and anti-NRGh antibodies, this appears as a cluster of at least two bands, depending on gel resolution. At 114 kDa, both the common 7D5 and antiNRGa antibodies show a single band, while the anticytoplasmic a and anti-NRGh antibodies appear as doublets. Only the common 7D5 antibody is immunoreactive with a 160 kDa protein, and only anti-NRG1h antibody shows binding to a 180 kDa protein. To determine if the observed immunoreactive proteins are NRG1 gene products, we used siRNA targeting the EGF-like domain common to all NRG isoforms. CMEC at 60% confluence were transfected with control or NRG1 siRNA sequences, and, 24 h later, cell lysates were analyzed for protein expression by Western blot (Fig. 2B). NRG1 siRNA reduced expression of the 114 kDa band and, to a lesser extent, the 60 kDa bands, detected by each antibody.

Fig. 3. rNRG1 EGFa and h activation of erbB receptor in ventricular myocytes. NRVM in culture were treated with rNRG1 for 10 min. (A) erbB2 and erbB4 phosphorylation was detected by immunoprecipitation with antibodies to erbB2 or erbB4 followed by SDS-PAGE/Western blot immunodetection using antiphosphotyrosine antibody. rNRG1 EGFh caused activation of both erbB receptors at concentrations of 10 ng/ml, whereas concentrations as high as 1000 ng/ml of rNRG1 EGFa caused minimal if any increase in erbB2 or erbB4 phosphorylation. Blots are representative of up to 4 experiments. (B) Densitometric analysis of the erbB2 and erbB4 phosphorylation over a limited concentration range for rNRG1 EGFa and rNRG1 EGFh. Data are presented as mean T SE for at least 3 experiments per concentration (*P = 0.02; **P = 0.04 vs. control).

142

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

Densitometric analysis showed on average a 40 – 50% reduction in the expression of the 114 kDa band (e.g. 39 T 13% for Fcommon_ extracellular immunoblots; 48 T 18% for NRG1 EGFh immunoblots, n = 4). These data support the conclusion that the 114 kDa immunoreactive proteins are NRG1 isoforms. Given that the cloning data demonstrate that NRG1a is expressed with stalk 2 only and that the cytoplasmic antibody targets domain a, the 114 kDa NRG1a is likely NRG1a2a. Similarly, the 114 kDa NRG1h is likely a NRG1ha. The stalk domain (1, 4 or neither) in the 114 kDa NRG1h band is not known since all three of these are expressed at the mRNA level. The predicted difference in molecular weight between these stalk variants is at most 3 kDa, such that the SDS-PAGE methods used do not allow us to determine how many of these are expressed at the protein level. It is unclear from these data what the 60 kDa bands represent. As these are reactive to the siRNA and detected

Fig. 5. rNRG1 EGFh stimulates glucose uptake in ventricular myocytes. (A) ARVM were treated with rNRG1 EGFa or h for 20 min before the addition of 0.2 mM 2-deoxy-d-glucose and 2 ACi 2-deoxy-d-3H-glucose for 10 min. Results are reported as mean T SE of four independent experiments. NRG1h stimulated glucose uptake at 10 ng/ml (*P = 0.007) and 100 ng/ml (**P = 0.02). rNRG1 EGFa did not significantly increase glucose uptake, even up to 500 ng/ml. (B) ARVM were treated as above with or without rNRG1 EGFh in the presence of DMSO, LY294002 or U0126 and then assayed for 2-deoxy-d-glucose uptake. Results are reported as mean T SD of at least three independent experiments. rNRG1 EGFh plus DMSO (*P = 0.0004) and rNRG1 EGFh plus U0126 (**P = 0.04) increased glucose uptake. The addition of LY294002 prior to rNRG1 EGFh completely blocked glucose uptake (#P = 0.001 versus rNRG1 EGFh plus DMSO).

Fig. 4. rNRG1 EGFa and h activation of intracellular signaling in ventricular myocytes. NRVM in culture were again treated with rNRG1 EGFa or h for 10 min. Samples underwent SDS-PAGE/Western blot analysis with antibody to either phosphorylated Akt or phosphorylated Erk1/2. (A) rNRG1 EGFa at 100 ng/ml (*P = 0.03) and rNRG1 EGFh at 10 ng/ml (**P = 0.03) stimulated Akt phosphorylation. Akt phosphorylation by rNRG1 EGFa (100 ng/ml) versus h (10 ng/ml) was not significantly different. Data are reported as mean T SE of at least four independent experiments. (B) rNRG1 EGFa at 100 ng/ml (*P = 0.02) and NRG1h at 10 ng/ml (**P = 0.002) stimulated Erk1/2 phosphorylation. Data are reported as mean T SE of at least five independent experiments.

by each antibody, they would appear to at least in part represent immature preglycosylated proteins or perhaps NRG1 with the smaller cytoplasmic b or c domains. siRNA did suppress expression of the 160 kDa band reactive with the common 7D5 antibody, suggesting that this could be an NRG1 gene product. We are unable to make any conclusions about the identity of the 180 kDa anti-NRG1h antibody-reactive proteins, as we have found that, under the subconfluent conditions required for the siRNA transfection, this band is not detected (data not shown). Bioactivity of rNRG1 EGFa and rNRG1 EGFb in cardiac myocytes Given that both NRG1a and h isotypes are expressed by CMEC, we hypothesized that these may have distinct

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

functions in the heart. We therefore compared the effects of rNRG1 EGFa versus rNRG1 EGFh ligands in vitro on myocyte erbB2/4 phosphorylation, intracellular signaling and biological response. rNRG1 EGFa ligand induced minimal phosphorylation of erbB2 and 4 and only at high concentrations of peptide (Fig. 3). In contrast, rNRG1 EGFh induced erbB2 phosphorylation with low concentrations of ligand (10 ng/ml). Similarly, higher concentrations of rNRG1 EGFa were required to induce Akt (Fig. 4A) and Erk1/2 (Fig. 4B) phosphorylation than rNRG1 EGFh. We have previously shown that recombinant human NRG1 II-h3 (a.k.a. GGF2) promotes cardiac myocyte survival in a PI-3-kinase/Akt-dependent manner [16]. Glucose uptake due to GLUT4 translocation is also a well-known downstream effect of this pathway (e.g. see Ueki et al., 1998 [36]), and recent findings in skeletal muscle demonstrate NRG-dependent glucose transport [37]. To determine if rNRG1 increases glucose uptake in ventricular myocytes, we treated ARVM with rNRG1 EGFa or h and measured uptake of 2-deoxy-d-3H-glucose. rNRG1 EGFh stimulated glucose uptake at concentrations as low as 10 ng/ml, while rNRG1 EGFa had no significant effect, even up to 500 ng/ml (Fig. 5A). To examine if rNRG1 EGFh-mediated glucose uptake is through PI3kinase activity, we pre-treated ARVM with the PI-3-kinase inhibitor LY294002 and the MEK inhibitor U0126 to confirm that Erk1/2 is not involved. rNRG1 EGFhstimulated glucose uptake was completely abolished by PI3-kinase inhibition (Fig. 5B). We have previously shown that recombinant human NRG1 II-h3 (a.k.a. GGF2) stimulates protein synthesis in an Erk-dependent manner [38]. We compared the effects of rNRG1 EGFa and h on myocyte protein synthesis over a range of concentrations. We found that rNRG1 EGFh, but not rNRG1 EGFa, significantly increased NRVM protein synthesis (Fig. 6). Thus, while both Type I NRG1a and h are expressed in CMEC, only rNRG1 EGFh demonstrates bioactivity on myocytes under these conditions.

Fig. 6. rNRG1 EGFh stimulates protein synthesis in myocytes in culture. NRVM were treated with rNRG1 EGFa or h in the presence of 3H-leucine for 24 h. Results are reported as mean T SD of at least three independent experiments. rNRG1 EGFh at 10 ng/ml (*P = 0.02) but not rNRG1 EGFastimulated protein synthesis.

143

Discussion The NRG-erbB signaling axis is a critical mediator of cardiac development, and growing evidence supports a role for this system in the intricate cross-talk between the CMEC and the cardiac myocyte in the adult heart. In this study, we begin to elucidate the complexity of NRG/erbB biology in these cells. We found that CMEC in culture express multiple Type I NRG1 gene products, including both a and h variants. Comparison of soluble rNRG1 EGFa and h in cardiac myocyte bioassays demonstrates that, while both ligands activate target erbB receptors and intracellular signaling cascades, only rNRG1 EGFh stimulates glucose uptake and protein synthesis. Consistent with the complexity of the NRG1 gene structure and the number of potential splice variants, we detected expression of a large set of Type I NRG1a and h isoforms in CMEC. The majority of clones were Type I NRG1 EGFa sequences, expressing cytoplasmic domains a, b or c. The Type I NRG1 EGFh domain is expressed with stalks 1 or 4 and cytoplasmic domains a, b and c. Several of these sequences, while predictable splice variants, have not been previously reported. Interestingly, Montero et al. [26] have shown in an in vitro overexpression system that Type I NRG1h4a is more readily proteolytically solubilized to mature ligand than Type I NRG1h2a. Likewise, Shirakabe et al. have shown that meltrin h processes Type I NRG1h4 and h1 but not Type I NRG1a2 [27]. If release of Type I NRG1 proteins from CMEC is regulated similarly to their release from 293 [26] and/or L929 cells [27], then CMEC NRG1h expressing stalks 1 and 4 would be more readily available for release than NRG1a isoforms. In agreement with our RNA cloning results, we see expression of multiple NRG1 proteins by Western blot analysis. No definitive characterization of the exact nature of these proteins has been reported. Based on the effects of interference RNA targeting NRG1 protein expression, the 114 kDa immunoreactive bands appear to be NRG1 gene products. This molecular weight is consistent with that reported when recombinant Type I NRG1 constructs are expressed in vitro (for example, see Montero et al. for Type I NRG1 a2a [26]). Given that Type I NRG1a2a and Type I NRG1h2a differ in calculated molecular weight by 0.2 kDa, we would expect to see h ligands at this same location in immunoblots. The higher molecular weight band detected with the anti-NRG1h antibody (Fig. 2A) is similar to what we have found is expressed in skeletal muscle [35]. Thus, CMEC appear to express multiple NRG1 proteins. Recombinant NRG1a and rNRG1h have been compared in systems outside of the heart and generally show a 10- to 100-fold greater bioactivity of h that has been attributed to the differential affinity of these ligands for erbB receptors [20,21]. This has led to the general impression that NRG1a is a weak agonist that serves a similar function to NRG1h

144

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

[2]. In agreement with this literature, we also find that rNRG1 EGFh is more active than rNRG1 EGFa in stimulating cardiac myocyte erbB receptor phosphorylation and coupled intracellular signaling. We found that rNRG1 EGFh (but not a) stimulates glucose uptake in cardiac myocytes. This is consistent with recent observations in isolated skeletal muscle where rNRG1 EGFh1 (Genentech, Inc., amino acids 177– 244) was found to stimulate glucose uptake, glucose transporter translocation and transporter expression in a manner that is additive to insulin [37]. Similar to the mechanism for insulin-induced glucose uptake (e.g. see Ueki et al. [36]), we found that rNRG1 EGFh-induced glucose uptake was dependent on a PI-3-kinase pathway. Together, these observations suggest that NRG1h may serve an important function in controlling both skeletal and cardiac muscle glucose uptake. We have found that exercise is a potent activator of skeletal muscle NRG-erbB signaling [35]. The possibility that the salutary effects of exercise on glucose metabolism may in part be mediated by NRG-erbB signaling warrants further investigation. Consistent with our previous work with rNRG1 II-h3, rNRG1 EGFh stimulates protein synthesis in cardiac myocytes, which has been shown to occur via the Erk1/ 2 pathway [38]. NRG1a is a growth and development promoting ligand in some tissues, such as in the breast epithelium [22] and the skin [39,40], so we therefore tested whether this could occur in cardiac myocytes. Although rNRG1 EGFa showed low levels of activation of Erk1/2 in myocytes, there was no associated increase in protein synthesis. While both neonatal and adult myocytes were used in these experiments, we have previously demonstrated that both neonatal and adult myocytes express the same receptor complement and respond to rNRG1 II-h3 with similar patterns of growth and survival [16]. Thus, for the purposes of the assays used in this manuscript, neonatal and adult myocytes should be identical indicators bioactivity. The in vitro data we report compliment observations in NRG1-deficient transgenic mice. Knockout mice targeting the NRG1 EGF-like domain (total NRG1) [11], the NRG1 cytoplasmic/transmembrane domains [28] or the NRG1 Ig domain [41] die from cardiac developmental defects, while the NRG1a-deficient [22] and Type III CRD-NRG1 [42] knockout mice do not. The NRG1a knockout mouse survives with impaired lobuloalveolar development in the mammary gland [22], while the Type III CRD-NRG1 null mouse dies at birth due to a lack of neuromuscular synapse formation, apparently with normal cardiac function [42]. Thus, Type III NRG1 and Type NRG1a do not appear to be required for cardiac development. Collectively, these studies support the conclusion that a Type I transmembrane NRG1 gene product, such as the 114 kDa Type I NRG1h that we found is expressed in CMEC, is primarily responsible for normal cardiac development.

Despite our inability to detect an rNRG1 EGFa-specific effect in myocytes, we suspect that cardiac expression of this ligand does serve some function in the heart, which has yet to be elucidated. While no obvious cardiac abnormalities were seen in the NRG1a knockout mouse, a detailed analysis of cardiac structure and function was not reported. One possibility under active investigation is that NRG1a serves an autocrine function in CMEC, which also express erbB family receptors (unpublished observation). The neuregulin-erbB network is a fundamental though complex system composed of multiple ligands and their cognate receptors that regulate diverse events in tissue morphogenesis, in response to injury and, perhaps, in response to metabolic stress. While the developmental importance of this system is clear, the unique role of each splice variant of NRG1 in the adult organism has yet to be examined. The function will likely differ among tissues depending on the receptor complement as well as the expression of other NRG genes and/or other EGF-like ligands that can activate receptors in the erbB family. A more complete understanding of the physiological role of this system in the heart will require that results from these in vitro experiments are complemented by in vivo studies in the intact organism.

Acknowledgments The authors would like to thank Xin-Xin Guo and David Pimentel for technical assistance. G.M.C. is supported by NIH predoctoral training grant HL007969. N.K.L. was supported by NIH postdoctoral training grant DK007201. This work was supported by NIH HL 68144 and a grant from the Juvenile Diabetes Research Foundation to D.B.S.

References [1] S. Burden, Y. Yarden, Neuregulins and their receptors: a versatile signaling module in organogenesis and oncogenesis, Neuron 18 (1997) 847 – 855. [2] D.L. Falls, Neuregulins: functions, forms, and signaling strategies, Exp. Cell Res. 284 (2003) 14 – 30. [3] D.L. Falls, K.M. Rosen, G. Corfas, W.S. Lane, G.D. Fischbach, Aria, a protein that stimulates acetylcholine-receptor synthesis, is a member of the neu ligand family, Cell 72 (1993) 801 – 815. [4] A.D.J. Goodearl, J.B. Davis, K. Mistry, L. Minghetti, M. Otsu, M.D. Waterfield, P. Stroobant, Purification of multiple forms of glial growth-factor, J. Biol. Chem. 268 (1993) 18095 – 18102. [5] W.E. Holmes, M.X. Sliwkowski, R.W. Akita, W.J. Henzel, J. Lee, J.W. Park, D. Yansura, N. Abadi, H. Raab, G.D. Lewis, H.M. Shepard, W.J. Kuang, W.I. Wood, D.V. Goeddel, R.L. Vandlen, Identification of heregulin, a specific activator of P185Erbb2, Science 256 (1992) 1205 – 1210. [6] M.A. Marchionni, A.D.J. Goodearl, M.S. Chen, O. Berminghammcdonogh, C. Kirk, M. Hendricks, F. Danehy, D. Misumi, J. Sudhalter, K. Kobayashi, D. Wroblewski, C. Lynch, M. Baldassare, I. Hiles, J.B. Davis, J.J. Hsuan, N.F. Totty, M. Otsu, R.N. Mcburney, M.D. Waterfield, P. Stroobant, D. Gwynne, Glial growth-factors are

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

[7]

[8]

[9]

[10]

[11] [12]

[13]

[14]

[15] [16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

alternatively spliced Erbb2 ligands expressed in the nervous-system, Nature 362 (1993) 312 – 318. E. Peles, S.S. Bacus, R.A. Koski, H.S. Lu, D.Z. Wen, S.G. Ogden, R. Benlevy, Y. Yarden, Isolation of the Neu/Her-2 stimulatory ligand-A 44Kd glycoprotein that induces differentiation of mammary-tumor cells, Cell 69 (1992) 205 – 216. D.Z. Wen, E. Peles, R. Cupples, S.V. Suggs, S.S. Bacus, Y. Luo, G. Trail, S. Hu, S.M. Silbiger, R. Benlevy, R.A. Koski, H.S. Lu, Y. Yarden, Neu differentiation factor-a transmembrane glycoprotein containing an Egf domain and an immunoglobulin homology unit, Cell 69 (1992) 559 – 572. M. Gassmann, F. Casagranda, D. Orioli, H. Simon, C. Lai, R. Klein, G. Lemke, Aberrant neural and cardiac development in mice lacking the Erbb4 neuregulin receptor, Nature 378 (1995) 390 – 394. K.F. Lee, H. Simon, H. Chen, B. Bates, M.C. Hung, C. Hauser, Requirement for neuregulin receptor Erbb2 in neural and cardiac development, Nature 378 (1995) 394 – 398. D. Meyer, C. Birchmeier, Multiple essential functions of neuregulin in development, Nature 378 (1995) 753. S. Rentschler, J. Zander, K. Meyers, D. France, R. Levine, G. Porter, S.A. Rivkees, G.E. Morley, G.I. Fishman, Neuregulin-1 promotes formation of the murine cardiac conduction system, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 10464 – 10469. T. Camenisch, J. Schroeder, J. Bradley, S. Klewer, J. McDonald, Heart-valve mesenchyme formation is dependent on hyaluronanaugmented activation of ErbB2 – ErbB3 receptors, Nat. Med. 8 (2002) 850 – 855. D.J. Slamon, B. Leyland-Jones, S. Shak, H. Fuchs, V. Paton, A. Bajamonde, T. Fleming, W. Eiermann, J. Wolter, M. Pegram, J. Baselga, L. Norton, Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2, N. Engl. J. Med. 344 (2001) 783 – 792. D.L. Keefe, Trastuzumab-associated cardiotoxicity, Cancer 95 (2002) 1592 – 1600. Y.Y. Zhao, D.R. Sawyer, R.R. Baliga, D.J. Opel, X.Q. Han, M.A. Marchionni, R.A. Kelly, Neuregulins promote survival and growth of cardiac myocytes—Persistence of ErbB2 and ErbB4 expression in neonatal and adult ventricular myocytes, J. Biol. Chem. 273 (1998) 10261 – 10269. D.B. Sawyer, C. Zuppinger, T.A. Miller, H.M. Eppenberger, T.M. Suter, Modulation of anthracycline-induced myofibrillar disarray in rat ventricular myocytes by neuregulin-1 beta and anti-erbB2—Potential mechanism for trastuzumab-induced cardiotoxicity, Circulation 105 (2002) 1551 – 1554. D.L. Brutsaert, Cardiac endothelial – myocardial signaling: its role in cardiac growth, contractile performance, and rhythmicity, Physiol. Rev. 83 (2003) 59 – 115. H. Stefansson, E. Sigurdsson, V. Steinthorsdottir, S. Bjornsdottir, T. Sigmundsson, J. Brynjolfsson, E. Gudmundsdottir, S. Gunnarsdottir, O. Ivarsson, V. Mutel, R. Harvey, A. Bjornsson, S. Sigfusson, M. Frigge, M. Gurney, A. Kong, J. Gulcher, H. Petursson, K. Stefansson, M. Lemke, Neuregulin 1 and susceptibility to schizophrenia, Am. J. Hum. Genet. 71 (2002) 185. J.T. Jones, R.W. Akita, M.X. Sliwkowski, Binding specificities and affinities of egf domains for ErbB receptors, FEBS Lett. 447 (1999) 227 – 231. R. Pinkaskramarski, M. Shelly, S. Glathe, B.J. Ratzkin, Y. Yarden, Neu differentiation factor neuregulin isoforms activate distinct receptor combinations, J. Biol. Chem. 271 (1996) 19029 – 19032. L. Li, S. Cleary, M.A. Mandarano, W.W. Long, C. Birchmeier, F.E. Jones, The breast proto-oncogene, HRG alpha regulates epithelial proliferation and lobuloalveolar development in the mouse mammary gland, Oncogene 21 (2002) 4900 – 4907. Q.F. Li, J.A. Loeb, Neuregulin – heparan – sulfate proteoglycan interactions produce sustained erbB receptor activation required for the induction of acetylcholine receptors in muscle, J. Biol. Chem. 276 (2001) 38068 – 38075.

145

[24] A. Schroering, D.J. Carey, Sensory and motor neuron-derived factor is a transmembrane heregulin that is expressed on the plasma membrane with the active domain exposed to the extracellular environment, J. Biol. Chem. 273 (1998) 30643 – 30650. [25] J.Y. Wang, S.J. Miller, D.L. Falls, The N-terminal region of neuregulin isoforms determines the accumulation of cell surface and released neuregulin ectodomain, J. Biol. Chem. 276 (2001) 2841 – 2851. [26] J.C. Montero, L. Yuste, E. Diaz-Rodriguez, A. Esparis-Ogando, A. Pandiella, Differential shedding of transmembrane neuregulin isoforms by the tumor necrosis factor-alpha-converting enzyme, Mol. Cell. Neurosci. 16 (2000) 631 – 648. [27] K. Shirakabe, S. Wakatsuki, T. Kurisaki, A. Fujisawa-Sehara, Roles of meltrin beta/ADAM19 in the processing of neuregulin, J. Biol. Chem. 276 (2001) 9352 – 9358. [28] X.F. Liu, H. Hwang, L.G. Cao, M. Buckland, A. Cunningham, J. Chen, K.R. Chien, R.M. Graham, M.D. Zhou, Domain-specific gene disruption reveals critical regulation of neuregulin signaling by its cytoplasmic tail, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 13024 – 13029. [29] X.F. Liu, H. Hwang, L.G. Cao, D.Z. Wen, N.L. Liu, R.M. Graham, M.D. Zhou, Release of the neuregulin functional polypeptide requires its cytoplasmic tail, J. Biol. Chem. 273 (1998) 34335 – 34340. [30] J.X. Bao, D. Wolpowitz, L.W. Role, D.A. Talmage, Back signaling by the NRG1 intracellular domain, J. Cell Biol. 161 (2003) 1133 – 1141. [31] J.Y. Wang, K.E. Frenzel, D.Z. Wen, D.L. Falls, Transmembrane neuregulins interact with LIM kinase 1, a cytoplasmic protein kinase implicated in development of visuospatial cognition, J. Biol. Chem. 273 (1998) 20525 – 20534. [32] M. Nishida, W.W. Carley, M.E. Gerritsen, O. Ellingsen, R.A. Kelly, T.W. Smith, Isolation and characterization of human and rat cardiac microvascular endothelial-cells, Am. J. Physiol. 264 (1993) H639 – H652. [33] J.P. Springhorn, O. Ellingsen, H.J. Berger, R.A. Kelly, T.W. Smith, Transcriptional regulation in cardiac-muscle-coordinate expression of Id with a neonatal phenotype during development and following a hypertrophic stimulus in adult-rat ventricular myocytes invitro, J. Biol. Chem. 267 (1992) 14360 – 14365. [34] Y. Kuramochi, G.M. Cote, X. Guo, N.K. LeBrasseur, L. Cui, R. Liao, D.B. Sawyer, Cardiac endothelial cells regulate reactive oxygen species-induced cardiomyocyte apoptosis through neuregulin1b/erbB4 signaling, J. Biol. Chem. 279 (2004) 51141 – 51147. [35] N.K. Lebrasseur, G.M. Cote, T.A. Miller, R.A. Fielding, D.B. Sawyer, Regulation of neuregulin/ErbB signaling by contractile activity in skeletal muscle, Am. J. Physiol.: Cell Physiol. 284 (2003) C1149 – C1155. [36] K. Ueki, R. Yamamoto-Honda, Y. Kaburagi, T. Yamauchi, K. Tobe, B.M.T. Burgering, P.J. Coffer, I. Komuro, Y. Akanuma, Y. Yazaki, T. Kadowaki, Potential role of protein kinase B in insulin-induced glucose transport, glycogen synthesis, and protein synthesis, J. Biol. Chem. 273 (1998) 5315 – 5322. [37] E. Suarez, D. Bach, J. Cadefau, M. Palacin, A. Zorzano, A. Guma, A novel role of neuregulin in skeletal muscle-neuregulin stimulates glucose uptake, glucose transporter translocation, and transporter expression in muscle cells, J. Biol. Chem. 276 (2001) 18257 – 18264. [38] R.R. Baliga, D.R. Pimental, Y.Y. Zhao, W.W. Simmons, M.A. Marchionni, D.B. Sawyer, R.A. Kelly, NRG-1-induced cardiomyocyte hypertrophy. Role of PI-3-kinase, p70(S6K), and MEK-MAPK-RSK, Am. J. Physiol. 277 (1999) H2026 – H2037. [39] V.R.J. Schelfhout, E.D. Coene, B. Delaey, A.A.T. Waeytens, L. De Rycke, M. Deleu, C.R. De Potter, The role of heregulin-alpha as a motility factor and amphiregulin as a growth factor in wound healing, J. Pathol. 198 (2002) 523 – 533. [40] M. Marikovsky, S. Lavi, R. Pinkaskramarski, D. Karunagaran, N. Liu, D.Z. Wen, Y. Yarden, Erbb-3 mediates differential mitogenic effects of Ndf heregulin isoforms on mouse keratinocytes, Oncogene 10 (1995) 1403 – 1411. [41] R. Kramer, N. Bucay, D.J. Kane, L.E. Martin, J.E. Tarpley, L.E. Theill,

146

G.M. Cote et al. / Experimental Cell Research 311 (2005) 135 – 146

Neuregulins with an Ig-like domain are essential for mouse myocardial and neuronal development, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 4833 – 4838. [42] D. Wolpowitz, T.B.A. Mason, P. Dietrich, M. Mendelsohn, D.A. Talmage, L.W. Role, Cysteine-rich domain isoforms of the

neuregulin-1 gene are required for maintenance of peripheral synapses, Neuron 25 (2000) 79 – 91. [43] G.M. Cote, D.B. Sawyer, Neuregulins, in: T.E. Creighton (Ed.), Wiley Encyclopedia of Molecular Medicine, John Wiley and Sons, Inc., New York, NY, 2002, pp. 2234 – 2236.