Neuroendocrine stress response in Atlantic salmon (Salmo salar) and Coho salmon (Oncorynchus kisutch) during sea lice infestation

Accepted Manuscript Neuroendocrine stress response in Atlantic salmon (Salmo salar) and Coho salmon (Oncorynchus kisutch) during sea lice infestation

L. Vargas-Chacoff, J.L.P. Muñoz, J. Saravia, R. Oyarzún, J.P. Pontigo, M.P. González, O. Mardones, C. Hawes, J. Pino, S. Wadsworth, F.J. Morera PII: DOI: Reference:

S0044-8486(18)32486-4 https://doi.org/10.1016/j.aquaculture.2019.04.046 AQUA 634080

To appear in:

aquaculture

Received date: Revised date: Accepted date:

20 November 2018 11 April 2019 15 April 2019

Please cite this article as: L. Vargas-Chacoff, J.L.P. Muñoz, J. Saravia, et al., Neuroendocrine stress response in Atlantic salmon (Salmo salar) and Coho salmon (Oncorynchus kisutch) during sea lice infestation, aquaculture, https://doi.org/10.1016/ j.aquaculture.2019.04.046

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Neuroendocrine stress response in Atlantic salmon (Salmo salar) and Coho salmon (Oncorynchus kisutch) during sea lice infestation L. Vargas-Chacoff1,2,* [email protected],1, J.L.P. Muñoz3,* [email protected],1, J. Saravia1,2,4, R. Oyarzún1,2,4, J.P. Pontigo1, M.P. González4, O. Mardones3, C. Hawes5, J. Pino5, S. Wadsworth5, F.J. Morera6.

T

Instituto de Ciencias Marinas y Limnológicas, Laboratorio de Fisiología de Peces,

IP

1

Universidad Austral de Chile, Valdivia, Chile.

Centro Fondap de Investigación de Altas Latitudes (IDEAL), Universidad Austral de

CR

2

3

US

Chile, casilla 567, Valdivia, Chile.

Centro de Investigación y Desarrollo i~mar, Universidad de los Lagos, Casilla 557, Puerto

4

AN

Montt, Chile.

Programa de Doctorado en Ciencias de la Acuicultura, Universidad Austral de Chile, Los

Cargill Innovation Center-Colaco”. Camino Pargua KM57 Colaco KM5 Puerto Montt,

ED

5

M

Pinos s/n, Balneario Pelluco, Puerto Montt, Chile.

Chile.

Instituto de Farmacología y Morfofisiología, Facultad de Ciencias Veterinarias,

PT

6

Universidad Austral de Chile, Valdivia, Chile.

CE

*

AC

Corresponding authors.

ABSTRACT

The aquaculture industry has many problems associated with bacteria, viruses, and parasites, and the stress caused by these infections can modulate the physiological response in fish. In Chile, the sea lice Caligus rogercresseyi constitutes a major problem affecting the Chilean salmonid industry, having a strong negative effect on salmon production. For this reason, the aim of this study was to investigate the neuroendocrine and stress response

1

These authors contributed equally to this work.

ACCEPTED MANUSCRIPT of the most commonly cultured salmonid species in Chile, the Atlantic salmon (Salmo salar) and the Coho salmon (Oncorynchus kisutch), which were experimentally infested with the sea lice Caligus rogercresseyi. We analyzed the monoamine response in the telencephalon, optic tectum, and hypothalamus, as well as cortisol levels in plasma. In the liver and muscle we analyzed the cellular response by measuring heat shock proteins (60, 70, 90) and glucocorticoid mRNA transcription. After 14 days post infection C.

T

rogercresseyi infestation modified the neuroendocrine and stress response in Atlantic and

IP

Coho salmon, with Coho salmon presenting a faster and higher response than the Atlantic

CR

salmon.

US

Keywords:

AN

Serotonin, 5HT, 5HIAA, HSPs, C. rogercresseyi, Salmonids

INTRODUCTION

M

In fish, stress has been defined as a physiological response that restores homeostasis after exposure to environmental perturbations (Wendelaar Bonga, 1997), and can be categorized

ED

as primary, secondary, or tertiary (Barton, 2002). The primary response involves neuroendocrine/endocrine responses (Iwama et al., 1998) including alterations in serum

PT

hormone levels such as cortisol and adrenaline (Iwama et al., 1998; Wendelaar Bonga, 1997). Secondary responses include changes in the expression of several proteins including

CE

“heat shock proteins” (HSPs), in addition to metabolic changes such as alterations in glucose metabolism and hematological parameters, as well as osmotic regulation. The

AC

tertiary response includes changes to processes such as reproduction, growth, and eventually leads to necrosis and significant physiological changes in the whole animal and population level (Wendelaar Bonga, 1997). The plasma cortisol level is used as a stress indicator, being a product of the hypothalamuspituitary-interrenal axis (HPI); cortisol release is controlled by the adrenocorticotropic hormone (ACTH) and secretion of this hormone secretion is controlled by corticotropinreleasing factor (CRF). When cortisol binds with glucocorticoid receptors (GR) it generates several physiological effects in peripheral tissues in order to overcome stress and recover the pre-stress homeostatic state. (Wendelaar Bonga, 1997). GR is a ligand-activated

ACCEPTED MANUSCRIPT transcription factor, which upon activation translocates to the nucleus and interacts with specific DNA sequences in the promoter regions of target genes (Vijayan et al., 2010). In teleost fish, 2 GRs, called GR1 and GR2, have been described. They have been reported in several tissues and with differential expression profiles in teleost fish, with GR1 being markedly modulated under stress conditions (Teles et al., 2013). However, the specific roles of the GR in different types of stress and its relationship with cortisol is widely

T

unknown in commercially important salmonids, such as Salmo salar and Oncorhynchus

IP

kisutch

CR

Heat shock protein (HSPs) are indicators of stress, useful and important biomarkers of several abiotic variables, which induce changes in HSPs. These proteins are highly

US

conserved and have been studied in several species (Iwama et al., 1998). Studies with fish have demonstrated that temperature, salinity, and many other stressors, can induce HSP

AN

expression (Iwama et al., 2004). During stress, HSP function is related to cytoprotection as these proteins can prevent and repair protein damage (Fowler et al., 2009; Hori et al., 2010;

M

LeBlanc et al., 2012, 2011; Niforou et al., 2014).

Some cerebral monoamine neurotransmitters such as noradrenaline (NAd), dopamine (DA),

ED

or serotonin (5-HT) are involved in the control and integration of responses to physiological stress in teleost fish (Overli et al., 2001, 1999). Several studies have reported

PT

that 5-HT has a stimulating influence on the HPI axis in fish (Hoglund et al., 2000; Lepage et al., 2000). However, how 5-HT controls the HPI axis is not clear. In mammals it appears

CE

that different serotoninergic pathways, depending on the region of the brain, are involved in both the development and termination of the adrenocortical response to stress exist (Markus

AC

et al., 2000). Moreover Höglund et al. (Höglund et al., 2002) describe opposite serotoninergic agonist responses in plasma cortisol levels of the alpine trout Salvelinus alpinus according to the stress conditions. Cerebral catecholaminergic systems also appear to stimulate HPI axis activity in fish, as occurs in mammals (Höglund et al., 2000; Overli et al., 2001). Several authors have described an increase of brain serotoninergic activity after exposure to different types of stressors often found in the fish farming context such as handling, isolation, predator exposure, pollutant exposure, social stress, crowding, and the presence

ACCEPTED MANUSCRIPT of ectoparasites (Gesto et al., 2009, 2008; Øverli et al., 2014; Weber et al., 2012; Winberg et al., 1993). The brain serotoninergic system displays complex reciprocal interactions with the HPI axis and is associated to other elements of the stress response (Chaouloff, 2000; Winberg et al., 1997). In teleosts the ratio between the 5HIAA metabolite and serotonin has been used as an indicator of serotoninergic activity (Gesto et al., 2013). Temperature is considered the most important abiotic factor influencing fish growth

T

(Donaldson et al., 2008; Oyarzún et al., 2018). During fish farming there are also biotic

IP

factors that affect fish growth, such as stocking density (Mancera et al., 2008; Vargas-

CR

Chacoff et al., 2014) or disease produced by bacteria, viruses, or parasites (González et al., 2015; Martínez et al., 2017b, 2017a). Parasites, such as endoparasites (with minimal effect

US

on fish farming) and ectoparasites, can substantially affect hosts by impacting behavioral, physiological, and morphological traits as well as by damaging the integument (Bunkley-

AN

Williams and Williams, 1998; Lehmann, 1993; Vargas-Chacoff et al., 2017, 2016; Wagner et al., 2003; Wendelaar Bonga, 1997). These ectoparasites activate the stress systems and

M

can induce changes in fish physiology responses (Barton, 2002; Vargas-Chacoff et al., 2014, 2009; Wendelaar Bonga, 1997). Several authors indicated that some teleost fish

ED

exposed to parasitism stress can mobilize energy metabolites to modulate immunological responses to pathogens (Barton, 2002; Mommsen et al., 1999; Vargas-Chacoff et al., 2017;

PT

Wendelaar Bonga, 1997), with glucose and lactate being the most important energetic metabolites, but it is not clear which are the endocrine effects. In Atlantic salmon (Salmo

CE

salar) the effects of sea lice (Lepeophtheirus salmonis) on serotoninergic brain activity have been described; finding significant effects on the brain stem (Øverli et al., 2014). In

AC

Chile, the sea lice Caligus rogercresseyi constitutes a major problem affecting the Chilean salmonid industry, having a strong negative effect on salmonid production. We hypothesize that sea lice Caligus rogercresseyi modify the neuroendocrine and stress response in salmonids that are important to the aquaculture industry. Therefore, the aim of this study was to describe the neuroendocrine stress response. We used Serotonin (5-HT), 5hidroxindolacetic acid (|5HIAA), cortisol in plasma, mRNA transcription of the Glucocorticoid receptor, and HSPs 60, 70, 90 responses as markers of main salmonids culture in the Chilean Atlantic salmon (Salmo salar) and Coho salmon (Oncorynchus kisutch) infested experimentally with sea lice Caligus rogercresseyi.

ACCEPTED MANUSCRIPT

MATERIAL and METHODS Ethical Process The experiments were performed following the guidelines for the use of laboratory animals established by the Universidad Austral de Chile and Chilean National Commission of

IP

T

Scientific and Technological Research (CONICYT).

CR

Experimental Conditions Fish

US

The same specimens and experimental procedures used in Vargas-Chacoff et al. (VargasChacoff et al., 2017) were applied in the present study. Briefly, groups of juvenile postsmolt Atlantic salmon (166.4 ± 17.5 g body weight, n = 250) and Coho salmon (161.2 ±

AN

15.8 g body weight, n = 250) were purchased from the Puerto Phillipi and Chaparano fish farms, respectively. The accredited laboratories certified that the fish were pathogen-free.

M

The salmon were transported to the Lenca Laboratory of Fundación Chile (Quillaipe, Chile)

ED

and distributed into seawater (35 psu) tanks (500 L) with a continuous flow-through system, 12:12 h light:dark photoperiod cycle, and a water temperature of 12 ± 2 °C. The fish were acclimated for two weeks and maintained under the same conditions for a further

PT

three weeks. During these acclimation and maintenance stages, fish were fed ad libitum

CE

using EWOS Transfer 100 pellet feed, without boost.

Triplicate infested (50 fish per tank) and duplicate control (50 fish per tank) groups were

AC

established for each salmonid species. For the infestation procedure, the water flow was stopped, and then the water level was reduced for about 2/3 of each one of the tanks. Then, plastic containers with the copepodids were added into the tanks, in an infestation pressure of 35 individuals per fish, in darkness. After four hours, both the water flow and light conditions were restored. The control group was treated as the same, but the plastic containers were added with only water inside. The infestation pressure was 35 copepodids per fish, which were between 3 – 5 days old from the moult, since infestation trials began when 90% of the free-living lice reached the copepodid stage. For the cohort, development

ACCEPTED MANUSCRIPT was expected when 60% of the parasites were attached at 1 dpi, giving an abundance of 21 parasites per fish (copepodid stage); followed by 70% adherence at 7 dpi, giving an abundance of 15 parasites per fish (Chalimus I-II stages); and an 80% of adherence at 14 dpi, giving an abundance of 12 parasite per fish (Chalimus II-III stages) to see table 2. All values were approximated. Parasite loss probably occurs due to accidental ingestion of parasites by the salmon individuals, or expulsion from tanks due to the seawater flow-

T

through system. A mesh of 220 μm was used as a filter in order to retain detached parasites,

IP

but these were not reincorporated into the tanks because the mesh or filter retained the

CR

parasites from all tanks. Sea lice were obtained from previously collected specimens maintained at the Fundación Chile Laboratory (Puerto Montt, Chile) according to the

US

protocols defined by Gonzalez et al. (González et al., 2015). The control tanks were not subjected to parasite infection. Tissue samples were taken at time 0 (prior to infection;

AN

these samples were not assessed for gene transcription), and at 1, 3, 7, and 14 days postinfection (dpi). Ten fish were sampled from each tank at each sampling time-point, including the non-infected control tank. mRNA expression was not analyzed at time zero

M

“0”, because we used the control group (Iwama et al., 1998; LeBlanc et al., 2011; Lepage et

ED

al., 2000; Wendelaar Bonga, 1997) as the threshold, unlike the plasma or neuroendocrine

Sampling Procedure

PT

response.

CE

Fish were netted, submitted to a lethal dose of AQUI-S™ (50 mg L−10; Bayer Company), and euthanized by spinal sectioning before tissue removal (Vargas-Chacoff et al., 2016).

AC

The fish, water, and collection trays were inspected for detached parasites, which were counted and classified by developmental stage (González and Carvajal, 2003). Fish blood was collected from the caudal peduncle in 1 mL heparinized syringes (25.000 U of ammonium heparin, 3 mL of 0.6% NaCl saline solution). Plasma was separated from cells by centrifuging whole blood for 5 min at 2.000 ×g at 4 °C. The collected plasma, muscle tissue (all samples were taken under the dorsal fin, with a maximum size of 1x1 cm), telencephalon, optic tectum, hypothalamus, and the complete liver were each snap-frozen in liquid N2 and stored at -80 °C until analysis.

ACCEPTED MANUSCRIPT

Plasma Cortisol Plasma cortisol levels were analyzed with an ELISA kit (product 500360; Cayman Chemical Company, Ann Arbor, MI, USA) following the manufacturer´s instructions. Plasma cortisol measurements were measured with a Multiskan GO Microplate Reader

IP

Telencephalon, Optic Tectum, and Hypothalamic Monoamines

T

(Thermo Fisher Scientific) using SkanIt v.3.2.

CR

The tissues were weighed and then homogenized by ultrasonic disruption in 0.5 mL of HPLC mobile phase. The homogenates were then centrifuged (16.000 g, 10 min) and

US

supernatants were further diluted 1:2 (supernatant: mobile phase) prior to the HPLC analysis. Data were expressed as ng per g of tissue. An HPLC system with electrochemical

AN

detection (HPLC-EC) was used for 5-HT and 5-hydroxyindole-3-acetic acid (5HIAA, a major 5HT oxidative metabolite) quantification, following Gesto et al. (2006). The HPLC

M

system consisted of a Dionex ISO-3100 isocratic pump, a 5 μm analytical column (waters, Atlantis C18, 150 mm length x 4.6 mm diameter), and an ESA Coulochem III

ED

electrochemical detector. The chromatographic conditions, particularly analytical cell condition and mobile phase are similar to that described by Mardones et al., (2018). All

PT

measurements were performed at a flow of 0.8 ml/min. A Dionex (Sunnyvale, CA, USA) Chromeleon, version 6.8, chromatography data management system was used for system

CE

control and data collection. Quantification of the samples peaks was estimated in relation to

AC

the peak areas of their respective standards.

Total RNA Extraction Liver and muscle samples were taken aseptically and used for total RNA extraction. Total RNA was extracted using the Total RNA Mini Kit (Geneaid), and the samples were treated with amplification-grade DNase I (1U/μg RNA, Invitrogen). RNA was quantified in a spectrophotometer (NanoDrop Technologies), and the quality was verified through electrophoresis on 1% agarose gels. First-strand cDNA was synthesized by M-MLV

ACCEPTED MANUSCRIPT Reverse Transcriptase (200 U/μL, Invitrogen) from 1 μg of total RNA using the oligo-dT18 primer at 50 °C for 50 min.

RT-qPCR Analysis of mRNA Transcription Reactions were carried out using an AriaMx Real-Time PCR System. RT-qPCR analyses used cDNA diluted to 100 ng as a template and the Brilliant SYBR® Green qPCR Master

T

Mix (Stratagene). Primers were designed for HSP60, HSP70, HSP90, Glucocorticoid

IP

Receptor, and 18s (housekeeping gene). We initially designed primers for Atlantic salmon

CR

and later these same primers were tested for Coho Salmon. In both species the primers gave good results with a single melting curve (pure qPCR product) and with very similar

US

efficiency between both salmonid species. All reactions were performed in triplicate and in a total volume of 15 μL, which contained 6 μL SYBR® Green, 2 μL cDNA template, 1 μL

AN

of each primer, and 5 μL PCR-grade water. The applied qPCR protocol was as follows: 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 1 min, and finally 95 °C

M

for 15 s. Melting curve analysis of amplification products was performed at the end of each qPCR to confirm the detection and amplification of only one product. HSPs (60, 70, 90)

ED

and Glucocorticoid Receptor were analyzed using the comparative Ct (∆∆Ct) method (Livak and Schmittgen, 2001) (Table 1). The PCR products were resolved on 2% agarose

PT

gel, purified using the E.Z.N.A Gel Extraction Kit (Omega Biotek), and sequenced by Macrogen Inc. Sequences were identified through BLAST analysis

CE

(http://blast.ncbi.nlm.nih.gov) against sequences in the NCBI GenBank database. All data are given in terms of relative transcription and are expressed as the mean ± standard error

AC

of the mean (S.E.M.). qPCR efficiencies were determined by linear regression analysis (Ramakers et al., 2003).

Statistical Analyses Assumptions of variance homogeneity and normality were tested. Data were logarithmically transformed when needed to fulfil conditions for parametric analysis of variance (ANOVA). Brain monoamines, plasma cortisol, and gene expression was tested by Two-way ANOVA, using infection and time as main factors. ANOVA were followed by a

ACCEPTED MANUSCRIPT Tukey’s post-hoc test to identify different groups. Differences were considered significant when P < 0.05.

RESULTS

T

No mortality or changes in behavior were observed during the experimental period.

IP

C. rogercresseyi Development and Abundances

CR

The tanks with infested fish showed a prevalence of 100% throughout the experiment. At 1 dpi, all parasites were copepodids. A progress in the cohort development was observed, since at 3 dpi individuals were at the copepodid and Chalimus I–II stages (Table 2) in both

US

salmonids species. Later, at 7 dpi the parasite individuals were at chalimus I-II stages, however, the mean abundance of parasites decreased in coho salmon, meanwhile, increased

AN

for Atlantic salmon, being 11 times higher for the latter fish species. At 14 dpi, the individuals were among chalimus I and IV stages, although for coho salmon a considerably

M

low parasite mean abundance was observed, being 15 times lower than Atlantic salmon

PT

Plasma Cortisol

ED

abundances (Table 2).

The cortisol levels in the plasma of both salmonids showed increased concentrations during

CE

the experiment, being highest levels in fish infested with C. rogercresseyi than control group. During the time course experiment the Coho and Atlantic salmon presented a peak

AC

in cortisol levels on the first day post infection (dpi), and at 3 dpi in Atlantic salmon the highest cortisol levels were observed. Statistical differences compared to the control group were found only at 1 dpi in Coho salmon and at 1 and 3 dpi in Atlantic salmon (Figure 1 A, B).

Brain Monoamines

ACCEPTED MANUSCRIPT Serotonin levels presented different patterns depending on the tissue, having highest levels in fish infested with C. rogercresseyi than control group on telencephalon in both salmonids species, just hypothalamus in coho salmon presented increasing of serotonin levels meanwhile Atlantic salmon did not presented differences among control versus infested fish group. During the time course experiment the serotonin levels in the telencephalon in both infested salmon presented the same peak at 1 dpi. In infested Coho

T

salmon serotonin increased almost 4 fold compared to the control group, while infested

IP

Atlantic salmon increased almost 2 fold compared to the control group. Meanwhile in optic

CR

tectum both salmonids did not present significant differences. The hypothalamus in infested Coho salmon presented a peak at 1 dpi, being double in the infested group compared to the

US

control group. The Atlantic salmon did not present significant differences (Figure 2 A-F). Similarity, 5HIAA levels presented different patterns depending on the tissue having

AN

highest levels in fish infested with C. rogercresseyi than control group on telencephalon and hypothalamus in both salmonids species, just optic tectum in coho salmon presented

M

increasing of 5HIAA levels meanwhile Atlantic salmon did not presented differences among control versus infested fish group. During the time course experiment the 5HIAA

ED

levels in telencephalon peaked at 1 dpi in both infested salmonids, being 6 fold higher in Coho salmon compared to the control group, meanwhile levels in Atlantic salmon was

PT

double compared to the control group. The optic tectum in infected Coho salmon peaked at 1 dpi compared to the control group. The Atlantic salmon did not present significant

CE

differences (P<0.05). The hypothalamus of infested Coho salmon presented 2 peaks, 4 fold at 1dpi and 3 fold at 7 dpi, in the infested group compared to the control group, and Atlantic

AC

salmon presented only 1 peak at 1dpi, being almost 3 fold in infested fish compared to the control group (Figure 3 A-F). The 5HIAA/5HT ratio is the metabolization rate of serotonin and presented different patterns depending on the tissue having highest ratio in fish infested with C. rogercresseyi than control group on hypothalamus in both salmonids species, while the telencephalon 5HIAA/5HT ratio in coho salmon presented increasing, meanwhile Atlantic salmon did not presented differences among control versus infested fish group. Also, optic tectum in Atlantic salmon presented increasing of 5HIAA/5HT ratio meanwhile coho salmon did not presented differences among control versus infested fish group. During the time course

ACCEPTED MANUSCRIPT experiment the 5HIAA/5HT ratio presented a high level in Coho and Atlantic salmon at 1dpi in the telencephalon but without statistical differences. However, in optic tectum only the Atlantic salmon presented significant differences at 3 and 14 dpi, and the hypothalamus presented a significant peak at 1 dpi (P<0.05) in both salmonid species (Figure 4 A-F).

Gene Transcription

T

Liver and muscle HSP60 transcription presented different patterns having highest levels in

IP

fish infested with C. rogercresseyi than control group in both salmonids species. During the

CR

time course experiment the liver HSP60 transcription was decreased in Atlantic salmon at 14 dpi, meanwhile in Coho salmon it showed a “U form”, being increased by 3-fold at 1

US

and 14 dpi to respect at control group (Figure 5 A and B). Muscle HSP60 mRNA transcription in Atlantic salmon at 14 dpi presented a 5-fold peak compared to the control

AN

group, and Coho salmon presented a peak at 3 and 7 dpi, being increased by 10 and 150 fold respectively compared to the uninfected group (Figure 5 C and D).

M

Liver and muscle HSP70 transcription presented different patterns showing highest levels in fish infested with C. rogercresseyi than control group in both salmonids species. During

ED

the time course experiment the liver HSP70 transcription was decreased in Atlantic salmon at 1-3 dpi but increased at 14dpi, meanwhile Coho salmon presented a 3 fold increase in

PT

transcription at 1 and 7 dpi compared to the control group. In muscle the mRNA transcription was 10 fold higher at 7 dpi in Atlantic salmon, while in Coho salmon it was

CE

decreased at 1-3-14 dpi, but increased at 7dpi (35 fold) (Figure 6 A-D). Liver HSP90 transcription presented different patterns having highest levels in fish infested

AC

with C. rogercresseyi than control group in both salmonids species, while muscle HSP90 transcription in Atlantic salmon presented increasing of HSP90 transcription meanwhile coho salmon did not presented differences among control versus infested fish group. During the time course experiment the HSP90 in liver of Atlantic salmon showed high mRNA transcription at 3 and 14 dpi with a 2- and 4-fold increase respectively compared to the control group, and Coho salmon presented a peak at 1 dpi and increased 4-fold at 14 dpi. Muscle HSP90 mRNA transcription was increased 10 and 8-fold at 3 and 7 dpi respectively in Atlantic salmon, and in Coho salmon it decreased at 1 and 7 dpi (Figure 7 A-D).

ACCEPTED MANUSCRIPT Transcription of the liver Glucocorticoid Receptor mRNA presented different patterns having highest levels in fish infested with C. rogercresseyi than control group in both salmonids species, while muscle the Glucocorticoid Receptor transcription in coho salmon presented increasing of Glucocorticoid Receptor transcription meanwhile Atlantic salmon did not presented differences among control versus infested fish group. During the time course experiment the transcription of the liver Glucocorticoid Receptor mRNA in Atlantic

T

salmon increased 4-fold at 1 dpi and 15 fold at 3 dpi, but decreased at 14 dpi, meanwhile

IP

Coho salmon increased 2 fold at 1 dpi, but decreased at 3, 7, and 14 dpi. In the muscle both

CR

salmonids presented a peak at 7 dpi but this was not statistically significant (P>0.05)

US

(Figure 8 A-D).

AN

DISCUSSION

Sea lice C. rogercresseyi infestation modified the neuroendocrine stress response in

M

Atlantic salmon (Salmo salar) and Coho salmon (Oncorynchus kisutch). The neuroendocrine stress responses were different during of infestation, which is consistent

ED

with studies reported on other responses in salmonids and sea lice (Dawson et al., 1999; Øverli et al., 2014; Vargas-Chacoff et al., 2017, 2016; Wells et al., 2006). Apparently, the

PT

earlier neuroendocrine and stress response of coho salmon could be related to the ability to reject the parasite, which is in agreement with the findings of Johnson & Albright (1992),

CE

who mentioned that coho salmon has a greater ability to reject L. salmonis due to nonspecific host responses. The rejection ability was also observed in present study, since the

AC

mean parasite abundance of coho salmon decreased during the cohort development. Cortisol levels confirm that both selected salmons display differential HPI axis activity when suffering from stress (Wendelaar Bonga, 1997), being in synergy with the neuroendocrine response, and being earlier in Coho salmon rather than in Atlantic salmon. In fish, little is known on the potential role of cortisol in the regulation of monoamine synthesis (Overli et al., 2001). Also, our results show that cerebral tissues have differentiated monoamines responses, in agreement with the reports of Höglund et al (Höglund et al., 2005) in carp. Shaw et al., (2009) (Shaw et al., 2009) studied California

ACCEPTED MANUSCRIPT killifish (Fundulus parvipinnis) infected with the trematode Euhaplorchis californiensis, and described the correlation between a high parasite density with brain monoaminergic activity, particularly in the hippocampus, hypothalamus, and raphe nuclei. The brain serotoninergic system is strongly preserved in the stress response between teleost fish and mammals (Lillesaar, 2011; Winberg et al., 1993). Our results demonstrate that

T

serotoninergic activity of the brain responds differentially according to the zone, while

IP

telecenphalon increases in both species at different days post infestation, observing a clear variation at 1 dpi. The optic tectum serotoninergic activity in both species does not respond

CR

at the beginning of the infestation, however, at day 7 and 14 dpi infested animals increased their serotoninergic activity. Recently, Øverli et al (2014 2014) described the effects of the

US

ectoparasite sea lice (Lepeophtheirus salmonis) on brain serotoninergic activity in Atlantic salmon, finding a rise in brain stem levels of the 5-HT, catabolite 5-HIAA, and 5-HIAA/5-

AN

HT ratios. Elevated 5-HIAA levels and/or 5-HIAA/5-HT ratios and other indicators of serotoninergic activity are commonly observed after a range of stressors (Gesto et al.,

M

2013). Our results and previous studies reporting the effects of several stressors on cerebral 5-HT under stress, show an increase of 5-HT turnover in different cerebral zones (Overli et

ED

al., 1999; Weber et al., 2012; Winberg and Nilsson, 1993). An important viewpoint is that the serotoninergic system could have a dual role in the stress response, responding as an

PT

early signal during initiation but also as a late response during chronic stress (Gesto et al., 2013). Our data in optic tectum and telencephalon show late infection responses.

CE

Particularly, Øverli et al (2014) showed the significant effects of serotoninergic activity only in the brain stem and speculate that the region-specific effect of ectoprasitic sea lice

AC

(restricted to the brain stem,), rather than a general stress reaction. In our study we did not evaluate the brain stem, but we found significant variation in hypothalamus and telencephalon, the difference may be related to the experimental design. We highlight the results found regarding serotoninergic activity in the hypothalamus, where each species responds differently to the presence of infestation with the ectoparasite. This response is similar to that described in other parameters evaluated within this work and others already published. Recently our lab group with the same experiment, described the variation between both species in the expression proinflammatory cytokines; the variation in serotoninergic activity could be associated to the differential inflammatory responses.

ACCEPTED MANUSCRIPT Verburg-van Kemenade et al. (2009) describe that the inflammatory response activates the central nervous system in fish. The response of 5-HT activity in our results occurs before or could suggest that cortisol levels in plasma increase concomitantly. Direct stimulation of cortisol secretion by 5-HT from head kidney tissue has been reported in the goldfish (Lim et al., 2013) and toadfish (Medeiros and McDonald, 2012). In goldfish, Lim et al (Lim et al., 2013) hypothesized that locally-produced 5-HT released by chromaffin cells, together

T

with catecholamines, could stimulate cortisol production from inter-renal cells. Other

IP

studies endorse raised cortisol as a result of ectoparasitic copepods (Fast et al., 2006). Sea

CR

lice infestation produce stress, which occur once the parasites moult to the mobile preadult and adult stages (Bjørn, PA, 1997; Dawson et al., 1999; Finstad et al., 2000). Feeding

US

activity by preadult–adult sea lice could increase skin damage (Bjørn and Finstad, 1998; Nolan et al., 1999; Pike and Wadsworth, 1999). The sea lice studies mainly describe

AN

Lepeophtheirus salmonis infecting cultured salmonids, and their focusses are determined by behavior and some physiological changes, such as cortisol levels (Øverli et al., 2014). In

M

the present study, plasma cortisol levels were related to GR mRNA levels in the liver of both salmonid species, with the highest levels of cortisol and up-regulation of GR1 during

ED

the first days of infestation (1-3 dpi) and downregulation of GR in the later days (7-14 dpi). These results are similar to those reported by other authors (Aluru and Vijayan, 2007;

PT

Sathiyaa and Vijayan, 2003) suggesting a higher affinity of GR1 with high plasma levels of cortisol with species-specific patterns. Additionally, no significant differences were

CE

detected in the GR transcription levels in muscle, suggesting a specific-tissue pattern. This is quite logical due to the wide physiological functions that are involved with

AC

glucocorticoid receptors, such as growth, metabolism, immune, stress, and osmotic and ionoregulatory responses (Faught et al., 2016; Vijayan et al., 2010). Wells et al. (Wells et al., 2006) indicated that cortisol levels in Brown Trout were observed as early as 3 dpi, but after 7 dpi no effect was apparent (30 lice·fish–1), in agreement with our data with both salmonid species infected by Caligus rogercresseyi, also being in line with glucocorticoid mRNA transcription levels in both salmonids at 1 dpi. In addition, we incorporated another stress biomarker named Heat Shock Proteins “HSPs”; normally HSPs are quantified to observe protein damage caused by temperature, salinity, or several stressors (Iwama et al., 2004). Tang et al (Tang and Lee, 2013) found that in carp the gill HSP70 and HSP90

ACCEPTED MANUSCRIPT expression levels were up-regulated as early as 3 h following hypertonic stress; Chadwick et al (Chadwick et al., 2015; Chadwick and McCormick, 2017) in brook trout, showed that induced HSP70 increased over 20°C. In our study the HSPs showed different patterns depending on tissue and obviously according to the salmon species; for example HSP60 in the liver of Atlantic salmon was over expressed at 7 dpi and Coho salmon liver presented over-expression at 1 and 14 dpi, meanwhile Atlantic salmon muscle presented over

T

expression at 14 pdi and Coho salmon at 3-7 dpi. HSP70 mRNA expression in the liver of

IP

Coho salmon was over expressed at 7 dpi, and Atlantic salmon at 14 dpi, and muscle was

CR

higher at 7 dpi in both salmonids. HSP90 mRNA expression in liver was higher at 7 dpi n both salmonids and finally in muscle the mRNA expression response occurred early on, 3

US

dpi. This data indicates that molecular chaperones are being induced by infestation at different times of infection, presumably to refold and repair damaged proteins (Bjørn, PA,

AN

1997; Bukau et al., 2006; Hightower, 1991). Also, sea lice eat the skin and produce muscle injuries (González et al., 2015), which probably activates the HSP response . Elevated

M

HSPs and levels in the cell are associated with a high degree of protein damage and for this reason are considered a good indicator of the integrity of the cell (Breukelen and H., 2002;

ED

Hofmann and Somero, 1995; Velickovska et al., 2005; Wing et al., 1995). It is possible that the differences in molecular chaperones responses between both salmon species are part of

PT

the ability of eliminate the parasite during the infestation, being greater the ability of coho salmon, since the number of coho salmon decreased, meanwhile, in Atlantic salmon

AC

Conclusion

CE

increased.

This is the first study to focus on the neuroendocrine and stress response in Atlantic and Coho salmon during infection by Caligus rogercresseyi sea lice. The obtained results suggest that infected fish increase the monoamines and cortisol responses early after infection, meanwhile HSPs have a different expression depending on the tissue and time course, and refold and repair damaged proteins in response to sea lice infection. Differences in physiological responses between both salmon species may be due the differential ability to reject the parasite, being greater for coho salmon. The evidence in present study indicates

ACCEPTED MANUSCRIPT that fish can feel the disturbance of being parasitized, and confirms that C. rogercresseyi is an animal welfare issue, besides their deleterious effects on salmon farm production.

T

Conflict of Interest

CR

IP

The authors declare no conflicts of interest.

Acknowledgments

US

This work was funded by Fondap-IDEAL Grant N°15150003, Fondecyt Regular Grant N°1160877 and 1190857, and the Vicerrectoría de Investigación (ex DID), Universidad

M

AN

Austral de Chile.

ED

References

Aluru, N., Vijayan, M.M., 2007. Hepatic transcriptome response to glucocorticoid receptor

PT

activation in rainbow trout. Physiol. Genomics 31, 483–491. doi:10.1152/physiolgenomics.00118.2007

CE

Barton, B.A., 2002. Stress in Fishes: A Diversity of Responses with Particular Reference to Changes in Circulating Corticosteroids. Integr. Comp. Biol. 42, 517–525.

AC

doi:10.1093/icb/42.3.517 Bjørn, PA, F.B., 1997. The physiological effects of salmon lice infection on sea trout post smolts. Nord. J. Freshw Res 73, 60–72. Bjørn, P.A., Finstad, B., 1998. The development of salmon lice ( Lepeophtheirus salmonis ) on artificially infected post smolts of sea trout ( Salmo trutta ). Can. J. Zool. 76, 970– 977. doi:10.1139/z98-003 Breukelen, F. van, H., C., 2002. Ubiquitin conjugate dynamics in the gut and liver of hibernating ground squirrels. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol.

ACCEPTED MANUSCRIPT 172, 269–273. doi:10.1007/s00360-002-0252-5 Bukau, B., Weissman, J., Horwich, A., 2006. Molecular Chaperones and Protein Quality Control. Cell 125, 443–451. doi:10.1016/J.CELL.2006.04.014 Chadwick, J.G., McCormick, S.D., 2017. Upper thermal limits of growth in brook trout and their relationship to stress physiology. J. Exp. Biol. 220, 3976–3987.

IP

T

doi:10.1242/jeb.161224

Chadwick, J.G., Nislow, K.H., McCormick, S.D., 2015. Thermal onset of cellular and

CR

endocrine stress responses correspond to ecological limits in brook trout, an iconic cold-water fish. Conserv. Physiol. 3, cov017. doi:10.1093/conphys/cov017

US

Dawson, L., Pike, A., Houlihan, D., McVicar, A., 1999. Changes in physiological parameters and feeding behaviour of Atlantic salmon Salmo salar infected with sea

AN

lice Lepeophtheirus salmonis. Dis. Aquat. Organ. 35, 89–99. doi:10.3354/dao035089 Donaldson, M.R., Cooke, S.J., Patterson, D.A., Macdonald, J.S., 2008. Cold shock and fish.

M

J. Fish Biol. 73, 1491–1530. doi:10.1111/j.1095-8649.2008.02061.x

ED

Faught, E., Aluru, N., Vijayan, M.M., 2016. The Molecular Stress Response, in: Fish Physiology. Academic Press, pp. 113–166. doi:10.1016/B978-0-12-802728-8.00004-7

PT

Fowler, S.L., Hamilton, D., Currie, S., 2009. A comparison of the heat shock response in juvenile and adult rainbow trout (Oncorhynchus mykiss) — implications for increased

AC

192

CE

thermal sensitivity with age. Can. J. Fish. Aquat. Sci. 66, 91–100. doi:10.1139/F08-

Gesto, M., López-Patiño, M.A., Hernández, J., Soengas, J.L., Míguez, J.M., 2013. The response of brain serotonergic and dopaminergic systems to an acute stressor in rainbow trout: a time course study. J. Exp. Biol. 216, 4435–42. doi:10.1242/jeb.091751 González, L., Carvajal, J., 2003. Life cycle of Caligus rogercresseyi, (Copepoda: Caligidae) parasite of Chilean reared salmonids. Aquaculture 220, 101–117. doi:10.1016/S00448486(02)00512-4

ACCEPTED MANUSCRIPT González, M.P., Marín, S.L., Vargas-Chacoff, L., 2015. Effects of Caligus rogercresseyi (Boxshall and Bravo, 2000) infestation on physiological response of host Salmo salar (Linnaeus 1758): Establishing physiological thresholds. Aquaculture 438, 47–54. doi:10.1016/J.AQUACULTURE.2014.12.039 Hightower, L.E., 1991. Heat shock, stress proteins, chaperones, and proteotoxicity. Cell 66,

T

191–197. doi:10.1016/0092-8674(91)90611-2

IP

Hofmann, G., Somero, G., 1995. Evidence for protein damage at environmental

CR

temperatures: seasonal changes in levels of ubiquitin conjugates and hsp70 in the intertidal mussel Mytilus trossulus. J. Exp. Biol. 198.

US

Hoglund, E., Balm, P.H., Winberg, S., 2000. Skin darkening, a potential social signal in subordinate arctic charr (Salvelinus alpinus): the regulatory role of brain monoamines

AN

and pro-opiomelanocortin-derived peptides. J. Exp. Biol. 203. Höglund, E., Weltzien, F.-A., Schjolden, J., Winberg, S., Ursin, H., Døving, K.B., 2005.

M

Avoidance behavior and brain monoamines in fish. Brain Res. 1032, 104–110.

ED

doi:10.1016/J.BRAINRES.2004.10.050

Hori, T.S., Gamperl, A.K., Afonso, L.O., Johnson, S.C., Hubert, S., Kimball, J., Bowman,

PT

S., Rise, M.L., 2010. Heat-shock responsive genes identified and validated in Atlantic cod (Gadus morhua) liver, head kidney and skeletal muscle using genomic techniques.

CE

BMC Genomics 11, 72. doi:10.1186/1471-2164-11-72 Iwama, G.K., Afonso, L.O.B., Todgham, A., Ackerman, P., Nakano, K., 2004. Are hsps

AC

suitable for indicating stressed states in fish? J. Exp. Biol. 207, 15–9. doi:10.1242/JEB.00707 IWAMA, G.K., THOMAS, P.T., FORSYTH, R.B., VIJAYAN, M.M., 1998. Heat shock protein expression in fish. Rev. Fish Biol. Fish. 8, 35–56. doi:10.1023/A:1008812500650 Johnson, S., Albright, L., 1992. Comparative susceptibility and histopathology oi the response of naive Atlantic, chinook and coho salmon to experimental infection with Lepeophtheirus salmonis (Copepoda: Caligidae). Dis. Aquat. Organ. 14, 179 - 193.

ACCEPTED MANUSCRIPT LeBlanc, S., Höglund, E., Gilmour, K.M., Currie, S., 2012. Hormonal modulation of the heat shock response: insights from fish with divergent cortisol stress responses. Am. J. Physiol. Integr. Comp. Physiol. 302, R184–R192. doi:10.1152/ajpregu.00196.2011 LeBlanc, S., Middleton, S., Gilmour, K.M., Currie, S., 2011. Chronic social stress impairs thermal tolerance in the rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 214,

T

1721–31. doi:10.1242/jeb.056135

IP

Lepage, O., Overli, O., Petersson, E., Järvi, T., Winberg, S., 2000. Differential stress

CR

coping in wild and domesticated sea trout. Brain. Behav. Evol. 56, 259–68. doi:10.1159/000047209

doi:10.1016/J.JCHEMNEU.2011.05.009

US

Lillesaar, C., 2011. The serotonergic system in fish. J. Chem. Neuroanat. 41, 294–308.

AN

Lim, J.E., Porteus, C.S., Bernier, N.J., 2013. Serotonin directly stimulates cortisol secretion from the interrenals in goldfish. Gen. Comp. Endocrinol. 192, 246–255.

M

doi:10.1016/J.YGCEN.2013.08.008

ED

Livak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25, 402–408.

PT

doi:10.1006/METH.2001.1262

Mancera, J.M., Vargas-Chacoff, L., García-López, A., Kleszczyńska, A., Kalamarz, H.,

CE

Martínez-Rodríguez, G., Kulczykowska, E., 2008. High density and food deprivation affect arginine vasotocin, isotocin and melatonin in gilthead sea bream (Sparus

AC

auratus). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 149, 92–97. doi:10.1016/J.CBPA.2007.10.016 Markus, R., Panhuysen, G., Tuiten, A., Koppeschaar, H., 2000. Effects of food on cortisol and mood in vulnerable subjects under controllable and uncontrollable stress. Physiol. Behav. 70, 333–342. doi:10.1016/S0031-9384(00)00265-1 Martínez, D., Oyarzún, R., Pontigo, J.P., Romero, A., Yáñez, A.J., Vargas-Chacoff, L., 2017a. Nutritional immunity triggers the modulation of iron metabolism genes in the sub-antarctic notothenioid Eleginops maclovinus in response to Piscirickettsia

ACCEPTED MANUSCRIPT salmonis. Front. Immunol. 8. doi:10.3389/fimmu.2017.01153 Martínez, D., Oyarzún, R., Vargas-Lagos, C., Pontigo, J.P., Soto-Dávila, M., Saravia, J., Romero, A., Núñez, J.J., Yáñez, A.J., Vargas-Chacoff, L., 2017b. Identification, characterization and modulation of ferritin-H in the sub-Antarctic Notothenioid Eleginops maclovinus challenged with Piscirickettsia salmonis. Dev. Comp. Immunol.

T

73, 88–96. doi:10.1016/J.DCI.2017.03.015

IP

Medeiros, L.R., McDonald, M.D., 2012. Elevated cortisol inhibits adrenocorticotropic

CR

hormone- and serotonin-stimulated cortisol secretion from the interrenal cells of the Gulf toadfish (Opsanus beta). Gen. Comp. Endocrinol. 179, 414–420.

US

doi:10.1016/J.YGCEN.2012.09.011

Niforou, K., Cheimonidou, C., Trougakos, I.P., 2014. Molecular chaperones and

doi:10.1016/J.REDOX.2014.01.017

AN

proteostasis regulation during redox imbalance. Redox Biol. 2, 323–332.

M

Nolan, D.T., Reilly, P., Bonga, S.W., 1999. Infection with low numbers of the sea louse Lepeophtheirus salmonis induces stress-related effects in postsmolt Atlantic salmon (

ED

Salmo salar ). Can. J. Fish. Aquat. Sci. 56, 947–959. doi:10.1139/f99-021

PT

Overli, O., Harris, C.A., Winberg, S., 1999. Short-term effects of fights for social dominance and the establishment of dominant-subordinate relationships on brain

CE

monoamines and cortisol in rainbow trout. Brain. Behav. Evol. 54, 263–75. doi:10.1159/000006627

AC

Øverli, Ø., Nordgreen, J., Mejdell, C.M., Janczak, A.M., Kittilsen, S., Johansen, I.B., Horsberg, T.E., 2014. Ectoparasitic sea lice (Lepeophtheirus salmonis) affect behavior and brain serotonergic activity in Atlantic salmon (Salmo salar L.): Perspectives on animal welfare. Physiol. Behav. 132, 44–50. doi:10.1016/J.PHYSBEH.2014.04.031 Overli, O., Páll, M., Borg, B., Jobling, M., Winberg, S., 2001. Effects of Schistocephalus solidus infection on brain monoaminergic activity in female three-spined sticklebacks Gasterosteus aculeatus. Proceedings. Biol. Sci. 268, 1411–5. doi:10.1098/rspb.2001.1668

ACCEPTED MANUSCRIPT Oyarzún, R., Muñoz, J.L.P., Pontigo, J.P., Morera, F.J., Vargas-Chacoff, L., 2018. Effects of acclimation to high environmental temperatures on intermediary metabolism and osmoregulation in the sub-Antarctic notothenioid Eleginops maclovinus. Mar. Biol. 165, 22. doi:10.1007/s00227-017-3277-8 Pike, A.W., Wadsworth, S.L., 1999. Sealice on Salmonids: Their Biology and Control.

T

Adv. Parasitol. 44, 233–337. doi:10.1016/S0065-308X(08)60233-X

IP

Ramakers, C., Ruijter, J.M., Lekanne Deprez, R.H., Moorman, A.F.M., 2003. Assumption-

CR

free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339, 62–66. doi:10.1016/S0304-3940(02)01423-4

US

Sathiyaa, R., Vijayan, M.M., 2003. Autoregulation of glucocorticoid receptor by cortisol in rainbow trout hepatocytes. Am. J. Physiol. Physiol. 284, C1508–C1515.

AN

doi:10.1152/ajpcell.00448.2002

Shaw, J.C., Korzan, W.J., Carpenter, R.E., Kuris, A.M., Lafferty, K.D., Summers, C.H.,

M

Øverli, Ø., 2009. Parasite manipulation of brain monoamines in California killifish (Fundulus parvipinnis) by the trematode Euhaplorchis californiensis. Proceedings.

ED

Biol. Sci. 276, 1137–46. doi:10.1098/rspb.2008.1597

PT

Teles, M., Tridico, R., Callol, A., Fierro-Castro, C., Tort, L., 2013. Differential expression of the corticosteroid receptors GR1, GR2 and MR in rainbow trout organs with slow

CE

release cortisol implants. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 164, 506–511. doi:10.1016/J.CBPA.2012.12.018

AC

Vargas-Chacoff, L., Martínez, D., Oyarzún, R., Nualart, D., Olavarría, V., Yáñez, A., Bertrán, C., Ruiz-Jarabo, I., Mancera, J.M., 2014. Combined effects of high stocking density and Piscirickettsia salmonis treatment on the immune system, metabolism and osmoregulatory responses of the Sub-Antarctic Notothenioid fish Eleginops maclovinus. Fish Shellfish Immunol. 40. doi:10.1016/j.fsi.2014.07.024 Vargas-Chacoff, L., Muñoz, J.L.P., Hawes, C., Oyarzún, R., Pontigo, J.P., Saravia, J., González, M.P., Mardones, O., Labbé, B.S., Morera, F.J., Bertrán, C., Pino, J., Wadsworth, S., Yáñez, A., 2017. Ectoparasite Caligus rogercresseyi modifies the lactate response in Atlantic salmon (Salmo salar) and Coho salmon (Oncorhynchus

ACCEPTED MANUSCRIPT kisutch). Vet. Parasitol. 243. doi:10.1016/j.vetpar.2017.05.031 Vargas-Chacoff, L., Muñoz, J.L.P., Hawes, C., Oyarzún, R., Pontigo, J.P., Saravia, J., González, M.P., Morera, F.J., Labbé, B.S., Bertrán, C., Mardones, O., Pino, J., Wadsworth, S., 2016. Atlantic salmon (Salmo salar) and Coho salmon (Oncorhynchus kisutch) display differential metabolic changes in response to infestation by the

T

ectoparasite Caligus rogercresseyi. Aquaculture 464.

IP

doi:10.1016/j.aquaculture.2016.07.029

CR

Velickovska, V., Lloyd, B.P., Qureshi, S., van Breukelen, F., 2005. Proteolysis is depressed during torpor in hibernators at the level of the 20S core protease. J. Comp. Physiol. B

US

175, 329–335. doi:10.1007/s00360-005-0489-x

Vijayan, M.M., Aluru, N., Leatherland, J.F., 2010. Stress response and the role of cortisol.,

doi:10.1079/9781845935535.0182

AN

in: Fish Diseases and Disorders, Volume 2. CABI, Wallingford, pp. 182–201.

M

Wells, A., Grierson, C.E., MacKenzie, M., Russon, I.J., Reinardy, H., Middlemiss, C., Bjørn, P.A., Finstad, B., Bonga, S.E.W., Todd, C.D., Hazon, N., 2006. Physiological

ED

effects of simultaneous, abrupt seawater entry and sea lice ( Lepeophtheirus salmonis ) infestation of wild, sea-run brown trout ( Salmo trutta ) smolts. Can. J. Fish. Aquat.

PT

Sci. 63, 2809–2821. doi:10.1139/f06-160

CE

Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77, 591–625. doi:10.1152/physrev.1997.77.3.591

AC

Winberg, S., Myrberg, A.A., Nilsson, G.E., 1993. Predator exposure alters brain serotonin metabolism in bicolour damselfish. Neuroreport 4, 399–402. Wing, S.S., Haas, A.L., Goldberg, A.L., 1995. Increase in ubiquitin-protein conjugates concomitant with the increase in proteolysis in rat skeletal muscle during starvation and atrophy denervation. Biochem. J. 307 ( Pt 3), 639–45. doi:10.1042/BJ3070639

Table 1: Primer sequences.

ACCEPTED MANUSCRIPT Gene

Forward

R2

Efficien

Reverse

Accession

cy

GTGCCAGCCATGACAATTG CCATGTTGACGTACTCTCCT CTA

60

AGGGAACGCAACGTCCTGA ACTAACCAGGCGGTTGTCA

CATTCGTGGAACGCCTTCG

AGAGACAAGGGTCTTGCCG

AAA

TCATA

GCAGATGCTGAAGATCTCC

CCATCCTTTGGTACTGTGCT

ACTGA

GA

GTCCGGGAAACCAAAGTC

TTGAGTCAAATTAAGCCGC

90

18S

IP 97%

CR

HSP

9

T

AAGTC

71.1

0.99 XM_0141891

99%

TTT

70

RG1

5

US

HSP

0.99 XM_0141652

96%

TCCA

AN

HSP

Number

25.1

0.99 NM_0011737 0

02.1

0.99 GQ_179974.1

94%

0

98%

1

FJ710886.1

M

A

ED

Abbreviations: HSP60, heat shock protein 60, HSP70, heat shock protein 70; HSP90, heat shock protein 90;

PT

RG5, Glucocorticoid receptor; 18S, 18 subunit ribosomal.

Table 2: Mean parasite per fish (standard deviation) of Caligus rogercresseyi at the

CE

different developmental stages in both Coho and Atlantic salmon at each day post

Fish Specie

AC

infestation (dpi).

Chalimus

Chalimus

Adult

Adult

dpi

Copepodid

I - II

III - IV

Female

Male

1

15 (5.9)

0

0

0

0

3

12.3 (14.5)

12.2 (5.4)

0

0

0

7

0

2.9 (1.1)

0

0

0

14

0

0.7 (1.3)

1.2 (1.3)

0

0

Atlantic

1

17.5 (3.5)

0

0

0

0

salmon

3

0.7 (0.6)

21.4 (7.3)

0

0

0

7

0

32.3 (1.8)

0

0

0

Coho salmon

ACCEPTED MANUSCRIPT 14

0

1 (1)

29.5 (6.3)

0

0

Figure 1. Cortisol plasma levels in (A) O. kisutch and (B) S. salar. Control (uninfected) and C. rogercresseyi-infected fish were sampled at day 0, and then at 1, 3, 7, and 14 days postinfection (dpi). Values are expressed as the mean ± SEM (n=30 infested fish and 20 control

T

fish). Different letters indicate significant differences between sampling days. Symbol (+)

IP

indicates significant differences between control and infested groups, control group did not

CR

present statistical differences (two-way ANOVA, post-hoc Tukey’s test, P < 0.05).

Figure 2. Seratonin (5HT) levels in (A) Telencephalon O. kisutch, (B) Telencephalon S.

US

salar, (C) Optic Tectum O. kisutch, (D) Optic Tectum S. salar, (E) Hypothalamus O. kisutch, (F) Hypothalamus S. salar. Control (uninfected) and C. rogercresseyi-infected fish

AN

were sampled 1, 3, 7, and 14 days post-infection (dpi). Values are expressed as the mean ± SEM (n=30 infested fish and 20 control fish). Different letters indicate significant

M

differences between sampling days. Symbol (+) indicates significant differences between control and infested groups, control group did not present statistical differences (two-way

ED

ANOVA, post-hoc Tukey’s test, P < 0.05).

PT

Figure. 3. 5-hydroxyindole-3-acetic acid (5HIAA) levels in (A) Telencephalon O. kisutch, (B) Telencephalon S. salar, (C) Optic Tectum O. kisutch, (D) Optic Tectum S. salar, (E)

CE

Hypothalamus O. kisutch, (F) Hypothalamus S. salar. Control (uninfected) and C. rogercresseyi-infected fish were sampled 1, 3, 7, and 14 days post-infection (dpi). Values

AC

are expressed as the mean ± SEM (n=30 infested fish and 20 control fish). Different letters indicate significant differences between sampling days. Symbol (+) indicates significant differences between control and infested groups, control group did not present statistical differences (two-way ANOVA, post-hoc Tukey’s test, P < 0.05). Figure. 4. Ratio between 5HT/5HIAA in (A) Telencephalon O. kisutch, (B) Telencephalon S. salar, (C) Optic Tectum O. kisutch, (D) Optic Tectum S. salar, (E) Hypothalamus O. kisutch, (F) Hypothalamus S. salar. Control (uninfected) and C. rogercresseyi-infected fish were sampled 1, 3, 7, and 14 days post-infection (dpi). Values are expressed as the mean ±

ACCEPTED MANUSCRIPT SEM (n=30 infested fish and 20 control fish). Different letters indicate significant differences between sampling days. Symbol (+) indicates significant differences between control and infested groups, control group did not present statistical differences (two-way ANOVA, post-hoc Tukey’s test, P < 0.05). Figure. 5. mRNA transcription of HSP60 in the liver of (A) O. kisutch and (B) S. salar.

T

mRNA transcription of HSP60 in the muscle of (C) O. kisutch and (D) S. salar. Control

IP

(uninfected) and C. rogercresseyi-infected fish were sampled 1, 3, 7, and 14 days post-

CR

infection (dpi). Relative expression was calculated using the 2_∆∆CT method and with the 18s ribosomal protein as the internal reference gene. Each value represents the mean ±

US

S.E.M (n=30 infested fish and 20 control fish). Different letters indicate significant differences between sampling days. Symbol (+) indicates significant differences between control and infested groups, control group did not present statistical differences (two-way

AN

ANOVA, post-hoc Tukey’s test, P < 0.05).

M

Figure. 6. mRNA transcription of HSP70 in the liver of (A) O. kisutch and (B) S. salar.

ED

mRNA transcription of HSP70 in the muscle of (C) O. kisutch and (D) S. salar. Control (uninfected) and C. rogercresseyi-infected fish were sampled 1, 3, 7, and 14 days post-

PT

infection (dpi). Relative expression was calculated using the 2_∆∆CT method and with the 18s ribosomal protein as the internal reference gene. Each value represents the mean ±

CE

S.E.M (n=30 infested fish and 20 control fish). Different letters indicate significant differences between sampling days. Symbol (+) indicates significant differences between control and infested groups, control group did not present statistical differences (two-way

AC

ANOVA, post-hoc Tukey’s test, P < 0.05). Figure. 7. mRNA transcription of HSP90 in the liver of (A) O. kisutch and (B) S. salar. mRNA transcription of HSP90 in the muscle of (C) O. kisutch and (D) S. salar. Control (uninfected) and C. rogercresseyi-infected fish were sampled 1, 3, 7, and 14 days postinfection (dpi). Relative expression was calculated using the 2_∆∆CT method and with the 18s ribosomal protein as the internal reference gene. Each value represents the mean ± S.E.M (n=30 infested fish and 20 control fish). Different letters indicate significant

ACCEPTED MANUSCRIPT differences between sampling days. Symbol (+) indicates significant differences between control and infested groups, control group did not present statistical differences (two-way ANOVA, post-hoc Tukey’s test, P < 0.05).

Figure. 8. mRNA transcription of Glucocorticoid receptor in the liver of (A) O. kisutch and (B) S. salar. mRNA transcription of Glucocorticoid receptor in the muscle of (C) O. kisutch

T

and (D) S. salar. Control (uninfected) and C. rogercresseyi-infected fish were sampled 1, 3,

IP

7, and 14 days post-infection (dpi). Relative expression was calculated using the 2_∆∆CT

CR

method and with the 18s ribosomal protein as the internal reference gene. Each value represents the mean ± S.E.M (n=30 infested fish and 20 control fish). Different letters

US

indicate significant differences between sampling days. Symbol (+) indicates significant differences between control and infested groups, control group did not present statistical

AN

differences (two-way ANOVA, post-hoc Tukey’s test, P < 0.05).

M

Highlights

The infestation of ectoparasites can be modulating the physiological response in fish



In Chile the sea lice Caligus rogercresseyi constitutes a major problem affecting the

ED



Chilean salmonids industry.

For Atlantic salmon and Coho salmon, the neuroendocrine response produced by the

PT



infestation of sea lice fluctuates in relation to the post-infestation period

CE

The sea lice C. rogercresseyi infestation modified differentially the neuroendocrine stress response in the Atlantic salmon (Salmo salar) and Coho salmon (Oncorynchus kisutch), presenting a quicker and higher response than the Atlantic salmon.

AC

