Neurofilament-deficient axons and perikaryal aggregates in viable transgenic mice expressing a neurofilament-β-galactosidase fusion protein

Neuron,

Vol. 12, 389-405,

February,

1994, Copyright

0 1994 by Cell Press

Neurofilament-Deficient Axons and Perikaryal Aggregates in Viable Transgenic Mice Expressing a Neurofdament-P-Gaiactosidase Fusion Protein Joel Eyer* and Alan Peterson Department of Neurology and Neurosurgery McGill University Royal Victoria Hospital, H-5 687 Pine Avenue West Montreal, Quebec Canada H3A IA1

Summary Interactions between neurofilament side arms may modulate axon caliber. To investigate this hypothesis, we derived transgenic mice expressing a fusion protein in which the carboxyl terminus of the high molecular weight neurofilament protein (NFH) was replaced by g-galactosidase. The transgene, regulated by NFH sequences, was expressed in projection neurons. However, the fusion protein remained in perikarya precipitating large filamentous aggregates. Axons were not invested with neurofilaments and developed only small calibers. Perikaryal aggregates, with similar structural features, are associated with neurodegenerative diseases, but these mice showed few ill effects and their neurons rarely degenerated. We conclude that an organized neurofilament cytoskeleton is required by axons to achieve large calibers but is not essential for neuronal function or extended survival. Introduction The various stages of neuronal maturation are distinguished by the expression of different intermediate filament proteins. Neuroepithelial stem cells coexpress vimentin and nestin (Lendahl et al., 1990), whereas in postmitotic neurons, nestin is downregulated and a-internexin appears (Kaplan et al., 1990). During axon outgrowth, the neurofilament light (NFL) and neurofilament medium (NFM) proteins are coexpressed. When axons reach their targets vimentin disappears (Cochard and Paulin, 1984), and thereafter the high molecular weight neurofilament (NFH) protein is expressed (Shaw and Weber, 1982; Pachter and Liem, 1984; Julien et al., 1986; Carden et al., 1987a). In mature neurons, the three neurofilament proteins copolymerize to form IO nm thick neurofilaments (Geisler et al., 1983). These are distributed throughout perikarya, dendrites, and axons, but in the axonal compartment they appear to develop inter-filament interactions and become densely packed (Hirokawa et al., 1984; Hirokawa, 1991).

*Present France.

address:

INSERM

Unit

298, Angers,

Cedex

01, 49033

The entire intermediate filament gene family has a highly conserved structure (Balcarek and Cowan, 1985; Franke, 1987) and is regulated in a strict tissuespecific and developmentally specific manner (reviewed in Steiner? and Roop, 1988). Nonetheless, the cellular functions of intermediate filaments are largely unknown, and the specific role neurofilaments play in either developing or mature neurons remains the subject of much speculation (reviewed in Brady, 1993, and Liem, 1993). Despite the fact that perturbations of the neurofilament cytoskeleton occur in response to several neurotoxins (Griffin et al., 1’978; Griffin and Price, 1980; Troncoso et al., 1985, 1986; Carden et al., 1986, 1987b; Watson et al., 1989) and in transgenic mice (Cot6 et al., 1993; Xu et al., 1993) and are diagnostic of diverse human neurodegene,rative diseases (Goldman and Yen, 1986; Toyoshima et al., 1989; Schmidt et al., 1987, 1989, 1991), the relationship of such neurofilament abnormalities to the pathogenesis of neuropathies is far from clear. Several observations support the hypothesis that neurofilaments play a role in modulation of axon caliber (Lasek et al., 1983). Accumulation of NFH and the apparent development of interactions between axonal neurofilaments coincide with the stage of neuronal maturation during which axon calibers markedly increase (Carden et al., 1987a; Mirokawa et al., 1984; Hoffman et al., 1983,1984, 1985a, 1985b, 1987), and certain neurofilament epitopes are revealed only in those axonal domains in which maximal calibers are achieved (de Waegh et al., 1992). Moreover, in circumstances in which neurofilament expression is altered (Hoffman et al., 1985b; Wong and Oblinger, 1987; Goldstein et al., 1988; Oblinger and Lasek, 1988; Muma et al., 1990) or in which their apparent transport is accelerated (Monaco et al., 1989), axon caliber is modified. Similarly, axons atrophy in diseases in which neurofilament distribution within axons is perturbed (Carpenter, 1968), and only small caliber axons develop in neurofilament-deficient qwail bearing a null mutation in the NFL gene (Yamasaki et al., 1991, 1992; Sakaguchi et al., 1993; Osamu et al., 1993). Typical of the entire intermediate filament family, the three neurofilament proteins, NFL, NFM, and NFH, contain a conserved a-helical rod domain. Their respective apparent molecular masses of 68,145, and 200 kd reflect differences in the amino- and carboxyterminal amino acid sequences that flank the rod domain, as well as posttranslational modifications, of which phosphorylation is the most notable (Julien and Mushynski, 1982). Various lines of investigation have yielded a model of neurofilament assembly in which the NFM and NFH proteins are anchored to a core of NFL via their central rod domains (reviewed in Fliegner and Liem, 1991; Hirokawa, 1991, Parry and Steinert, 1992). The long lateral projections originating

Neuron 390

Mouse NFH gene ATG f I I Kpn,EmnsI II 111 NFH-LacZ construct

in the DNAconstruct, expression of the fusion protein should begin in neurons coincident with completion of axon outgrowth. Second, the relative levels of transgene expression in different neuronal populations should correlate positively with those of the endogenous NFH gene, with highest levels occurring in projection neurons. Third, if the fusion protein coassembled with the endogenous intermediate filament proteins, the presence of g-galactosidase on some neurofilament side arms should disturb normal interfilament interactions (Hirokawa, 1982; Hirokawa et al., 1984), disrupting both the ultrastructural characteristics and function of the neurofilament cytoskeleton. Finally, because &galactosidase activity requires the association of b-galactosidase monomers (Zabin, 19821, the presence or absence of enzymatic activity would reveal the nature of the interactions that developed between NFH-g-galactosidase fusion molecules in different neuronal compartments. Unexpectedly, expression of the fusion protein disrupted export from perikarya of all endogenous intermediate filament proteins, including the neurofilaments. As a consequence, neurons established their final associations with targets and developed their mature relationships with oligodendrocytes and Schwann cells without axonal neurofilaments and in the presence of massive filamentous aggregates in their perikarya. Axons maintained a fetal-like cytoskeleton throughout life and failed to achieve normal calibers. Despite the seemingly complete disruption of their neurofilament cytoskeleton, such affected neurons survive, and mice bearing this transgene could not be reliably distinguished from their normal littermates by either reproductive performance or general behavior into advanced age.

, EcoRV

Xmnl

Truncated mouse NFH gene -

-

Ml

pGNA vector-

NFH - I3 galactosidase fusion protein Head /

Rod I:-

Tad 45 KSP repwts :a . . . . . ** . . . ..I........

Truncated NFH protein

“,

a.,

;

;.

,

B galactosidase

Figure 1. Genomic Structure of the Mouse egy Used toCeneratetheNFH-lacZConstruct,and Structure of the Fusion Protein It Encodes

NW

Gene, the Stratthe Predicted

The NfH gene was truncated at the EcoRV site and ligated inframe to the /acZgene at the Xmnl site in the pGNA vector. Prior to injection, the NFH-lacZ fusion gene was isolated from the vector by digestion with Kpnl and Sail. The fusion protein encoded by the transgene includes, from NFH, the N-terminal head domain, the central a-helical rod domain, and 45 KSP repeats from the C-terminal domain and is followed by the complete amino acid sequence of E. coli B-galactosidase.

from neurofilaments are attributed to the carboxyterminal sequences of NFM and NFH (Geisler et al., 1983,1984,1985). These side arms are thought to mediate inter-filament interactions (Hirokawa, 1982; Hisanaga and Hirokawa, 1989; Leterrier and Eyer, 1987; Gotow et al., 1992), with the phosphorylation levels of NFH sequences modulating the strength of such interactions (Willard and Simon, 1983; Carden et al., 1985; Lee et al., 1987, 1988; Eyer and Leterrier, 1988; Hisanaga and Hirokawa, 1989; de Waegh et al., 1992). In one model, inter-filament interactions affect their rate of transport and intra-axon accumulation, thus leading to their influence on axon caliber (Hoffman et al., 1984; Wuiek and Gambetti, 1986). To investigate directly the role of neurofilament side arms in inter-filament interactions, transgenic mice werederived bearingan NFH-lacZfusiongeneencoding a partially truncated mouse NFH protein followed by Escherichia coli P-galactosidase. In these mice we evaluated four predictions. First, if the major elements regulating the endogenous NFH gene were included

Figure

2. Histochemical

Detection

of Enzymatic

Activity

Associated

Results NW-/acZ Transgenic Mice The DNA construct derived for this investigation contains 14.9 kb of the mouse NFH gene, from -2.9 kb to the middle of exon 4, ligated in-frame to the E. coli /acZgenefollowed by an SV4Opolyadenylation signal. Thefusion proteinencoded bythisconstruct includes the complete NFH amino-terminal and a-helical rod domains followed by approximately one-half of the

with

the NFH-B-Galactosidase

Fusion

Protein

during

Development

(A) Dorsal root ganglia began to express B-galactosidase activity on E14, (whole mount, line 44A). (6) Ventral view of cervical level El5 spinal cord reveals transgene expression in motor neurons, seen as columns running parallel to the ventral midline, (whole mount, line 44A). (C) P5 sacral level spinal cord showing a high density of reaction product in dorsal root ganglion neurons (whole mount, line 44A). (D) Cross section of thoracic level spinal cord from a Zmonth-old mouse. Neurons throughout the gray matter reveal intense, sometimes punctate, labeling (12 urn thick cryostat cross section, line 448). (E) Parasagittal section of brain from a 3-month-old, line 53, mouse. Throughout the CNS, large projection neurons label intensely, whereas granular neurons are unstained. Thus, in the olfactory bulb, only the large mitral cells stained. Similarly, cortical layers known to contain the large projecting pyramidal cells are heavily labeled, whereas layer 3, containing only interneurons, remains unstained. Purkinje cells of the cerebellum are all labeled intensely, whereas adjacent granular cells are not. Also, throughout the brain stem, seemingly all large projection neurons are prominently labeled (1 mm thick section). Note that all enzymatic activity is associated with perikarya. Bar, 390 urn (A); 1.56 mm (B); 975 urn (C); 780 urn (D); 1.9 mm (E).

$yble

Mice with

Neurofilament-Deficient

Axons

Neuron 392

V$ble

Mice with

Neurofilament-Deficient

Axons

NFH carboxyl terminus up to and including the 45th repeated KSP sequence. This was joined to the complete B-galactosidase protein (Figure 1). Eighty-five potential transgenic mice were derived by zygote pronuclear injection, and of these, 7 contained transgene sequences. Five lines were established, of which three (designated 44A, 44B, and 53) were found to express the construct. Hemizygous mice from the three expressing lines were analyzed. Expression of the NFH-fl-Galactosidase Fusion Protein Histochemical analyses of mice from all three lines revealed readily detectable, neuronally restricted 8-galactosidase activity (Figure 2). The earliest stage at which NFH is expressed in the developing mouse is controversial, but in most investigations, high level expression is observed only after birth (Shaw and Weber, 1982; Cochard and Paulin, 1984; Glicksman and Willard, 1985; Carden et al., 1987a). In the two lines examined during development (44A and 44B), expression of the fusion protein appeared to follow this pattern faithfully. Activity was first detected in the fetus on embryonic day 14(E14) in dorsal root ganglion neurons; lower motor neurons began to label on E15. On the basis of histochemical staining intensity, the level of activity in these populations increased progressively through the first few weeks of ex utero develop ment, and during this period, further neuronal populations became B-galactosidase positive. The mature phenotype, in which projection neurons appeared to label intensely, was realized throughout the nervous system by approximately 3 weeks of age and was maintained into advanced age (examined at 14 months). Neurons projecting only short axons, such as granular cells, did not express the transgene at detectable levels. Except for barely perceptible levels of label found as small but discrete spots in spinal roots during fetal development, all reaction product was associated with neuronal perikarya.Of significanceforthis investigation, readily detectable levels of the transgeneencoded fusion protein were realized at or near the

Figure

3. lmmunocytochemical

Analysis

Reveals

Colocalization

stage of development when axons normally begin to be invested with a prominent neurofilament cytoskeleton. Thus, the fusion protein is expressed at the beginning of the developmental period in which axon caliber normally increases and the mature relationships between axons and glia are achieved. Subcellular Distribution of the Fusion Protein 8-Galactosidase monomers are not by themselves enzymatically active (Zabin, 1982), and the histochemical detection of B-galactosidase activity in the neurons of these mice indicated that the fusioln protein assembled into some form of polymer. However, the fusion protein contains the sequences involved in B-galactosidase multimer formation as welt as the neurofilament sequences thought to participate in the assembly of intermediate filaments. Whether polymers realized through intermediate filament sequences would have enzymatic activity is unknown. To investigate the possibilitythat the fusion protein was also present in an enzymatically inactive form, more widely distributed than indicated by the histochemical assays, we used anti-Bgalactosidase immunocytochemistry. In this assay also, perikarya labeled prominently whereas axons and most dendrites did not. This result indicates that all B-galactosidase epitopes were associated with B-galactosidase activity. These immunocytochemical preparations also provided high resolution images of the intracellulardistribution of thefwsion protein (Figure 3). In Purkinje cells and in mamy spinal cord interneurons, one or two distinct bodies adjacent to the nucleus labeled, whereas motor neiurons were filled with labeled material that seemingly distended their perikarya. Smaller bodies were frequently observed in proximal Purkinje cell dendrites and in the gray matter of the spinal cord, but axons in both the PNS and CNS failed to label. Subcellular Distribution of Endogenous Intermediate Filament Proteins The possibility that one or more of the endogenous neurofilament proteins were included in the peri-

of Fusion

Protein

and intermediate

Filaments

in Perikaryal

Aggregates

(A-D) Cerebellar Purkinje cells contain one or more discrete perikaryal aggregates revealed by polyclonal antiserum to B-galactosidase in (A); monoclonal RM0217, recognizing moderately phosphorylated forms of NFH in (B); RT-97, recognizing highly phosphorylated forms of NFH in (C); and polyclonal antiserum to NFL in (D). In addition, small, but equally well-labeled, bodies are revealed in dendrites with all antibodies except RT-97. With most antibodies, many Purkinje cells expressed little or no immunolabeling outside of the aggregates themselves. However, with monoclonal RM0217, a light labeling was observed in the remainder of many Purkinje cell bodies and in some dendrites. With all antibodies directed to epitopes on endogenous proteins, but not with anti-B-galactosidase antibodies, the occasional diffusely labeled axon was also encountered. (E-J) Lumbar level spinal cord cross sections from 3-month-old line 44A mice. Ventral lateral views are shown with each micrograph containing profiles of motor neurons at the top and left and white matter to the bottom and right. (E) Antiserum to B-galactosidase labeled cell bodies and smaller discrete bodies in adjacent gray matter, likely within dendrites, whereas in white matter, only the rare labeled axonal profile was encountered. (F) Labeling with RT-97 yielded similar results. In normal neurons, this antibody recognizes phosphorylation epitopes restricted to the axonal compartment. (G) Although similar cell body labeling was observed with the RM0217 antibody, which recognizes the partially phosphorylated form of NFH, relatively more labeled axonal profiles were encountered. Antibodies to NFL (H), a-internexin (I), and peripherin (I) labeled cell bodies, some smaller bodies in surrounding gray matter, and only the rare axon. Bar, 40 urn (A-D); 66 urn (E-J).

Neuron 394

-- .

;‘5ble

Mice with

Neurofilament-Deficient

Axons

karyal aggregates was investigated by immunocytochemistry.All threeof theendogenous neurofilament proteins were found to be localized in both Purkinje cells and motor neurons in a manner generally similar to that observed for the NFH-B-galactosidase molecule (Figures 3A-3H). Perikarya labeled, whereas most axons either failed to label or reacted veryweaklywith the anti-neurofilament antibodies (Figure 3). Certain phosphorylated epitopes on NFH are normally detected only in the axonal compartment (Sternberger and Sternberger, 1983), and these were also detected in the perikaryal aggregates (Figure 3F). However, antibodies recognizing hypophosphorylated NFH species (Lee et al., 1987) and electrophoretic analysis (see below) revealed an overall hypophosphorylation of the NFH protein (Figure 4). Thus, NFH within the perikaryal aggregates is subject to phosphorylation but not to the extent typically achieved in axons. In some neuronal populations, neurofilaments are coexpressed with two additional intermediate filament proteins, peripherin and a-internexin (Escurat et al., 1990; Fliegner et al., 1990). Peripherin is a neuron-specific intermediate filament protein expressed in PNS neurons and in the subpopulation of CNS neurons that project to the periphery; a-internexin is expressed widely in the nervous system. As both of these molecules are normally present in axons and can coassemble with neurofilaments (Hem, 1993), we investigated their intracellular distribution; like the neurofilament proteins, they also were found to be sequestered in motor neuron perikarya and deficient in axons (Figures 31-3J). Development and Structure of Perikaryal Aggregates The perikaryal aggregates revealed in the immunocytochemical preparations were examined by light and electron microscopy to evaluate their development and structural features. In newborn mice, the perikarya of motor and spinal cord interneurons contained large, filamentous aggregates, and these increased in volume with age. By postnatal day 5 (P5), they were a striking feature of most spinal cord neurons, and in samples prepared from mature mice, they frequently displaced cytoplasm and organelles into two thin shells, one applied to the cytoplasmic membrane and the other to the nuclear membrane (Figures

NFHNFM-

NFHNFM-

NFL -

NFL -

C T Figure enates

C

T

5. Electrophoretic Analysis of Crude Spinal Cord from Control and Line 44A Transgenic Mice

Homog-

Replicate samples were electrophoresed on a 7.5% acrylamide gel (A) and a 4.8% acrylamide gel (B) in the presence of SDS. Thegels were stained with Coomassie blue. Thetypical positions to which the endogenous neurofilament triplet proteins migrate are indicated in the control lanes. Note the diffuse migration of NFH in the transgenic sample 0, indicating different hypophosphorylated states of this protein. Thedistinctfusion protein (indicated by an asterisk in [B]) is resolved on the 4.8% gel. By amino acid composition, its predicted molecular mass is 214 kd versus 200 kd for fully phosphorylated NFH. C, control sample.

4A-4D). While most regions within these aggregates appeared to contain densely packed filaments, mitochondria and other organelles, seemingly trapped within the network, were also encowntered (Figures 4E and 4D). Notably, the filaments within these aggregates had many properties typically associated with axonal neurofilaments, including an approximate average diameter of 9.2 nm and a tendency to course in parallel bundles, with an inter-filament distance of approximately 26 nm (Figures 4G and 4H) (Hirokawa, 1982; Gotow et al., 1992). To characterize the biochemical features of these intermediate filament aggregates, crude spinal cord homogenates from line 44A mice were analyzed on

--Figure 4. Morphology of Developing and Mature and Ultrastructure of Perikaryal Aggregates

Spinal

Cords

from

Line 44A Transgenic

Mice,

Cytoarchitecture

of Neuronal

Perikarya,

(A) P5 lumbar level spinal cord (1 urn thick plastic section). Motor neurons in the ventral lateral region of the cord all appear to contain amorphous inclusions. (6) Lumbar level spinal cord from a >month-old mouse. Throughout the gray matter, neurons have obvious inclusions, whereas motor neurons appear distended with accumulated material. (C) Lumbar level spinal cord from a PI mouse also reveals prominent aggregates in most motor neurons demonstrating their early formation in these neurons. (D) Lumbar level spinal cord from a 3-month-old mouse, as in (B). Motor neuron perikarya appear to be fully distended with accumulated material. (E) Electron micrograph of P5 motor neuron showing displaced cytoplasm and organelles. (F) Electron micrograph of lumbar level interneuron from a 3-month-old mouse, demonstrating only a thin shell of cytoplasm adjacent to a displaced nucleus. (G and H) Filamentous nature of the aggregates present in perikarya of motor neurons in P5 (G) and 3-month (H) mice. In both preparatians, filaments tend to course in parallel bundles. Filament size and average inter-filament distance, measured in regions with cross-section profiles in (H), are typical of the normal intra-axon filament configuration, Bar, 420 urn (A); 540 urn (B); 305 urn (C), 70 urn (D); 22 urn (E); 10 urn (F); 450 nm CC); 90 nm (H).

Neuron 396

Figure

6. Electron

Micrographs

of P5 Control

and Transgenic

Ventral

Root

Fibers

Neurofilaments are easily detectable in axons of the control mouse (A and B); similar transgenic animal (C and D). Microtubules are prominent structures in both normal and are more densely packed in the transgenic sample. As shown in this comparison, fibers myelin of comparable thickness, but the axon calibers in the normal sample are larger.

7.5% and 4.8% polyacrylamide gels in the presence of SDS. Electrophoretic analysis indicated that the three neurofilament proteins were present in seemingly normal ratios (Figure 5A). However, in the transgenic sample, the NFH protein did not resolve as a single band, but distributed into lower molecular weight species (Figure 5B). The results of immunoblotting experiments, using antibodies directed against various NFH epitopes, indicated that these lower molecular weight species were dephosphorylated forms of NFH (data not shown). The molecular mass of the transgene-encoded fusion protein calculated from the predicted aminoacid composition is 214.1 kd. This species was not observable on the 7.5% gel, but it was clearly resolved as a single band with a molecular mass greater than that of NFH on the 4.8% gel. Western blotting demonstrated that all immunologically detectable B-galactosidase localized to this band (data not shown). In the 4.8% gel, the dephosphorylated NFH species migrated as a smear. The slightly faster migration of NFM in the transgenic sample may indicate that this species is also partially dephosphorylated when sequestered in the perikarya. In comparison with the endogenous

profiles are not obvious in axons from the transgenic axons at this age (B-D), but they in both samples are generally invested with Bar, 850 nm (A and 0; 260 nm fB and D).

neurofilament proteins, the steady-state concentration of the transgene-encoded fusion protein was obviously low; less than 10% when compared by densitometry with the concentration of NFL. In so far as different subpopulations of neurons are expected to express different levels of neurofilament proteins, on an individual cell basis, this quantitative comparison must be considered as an approximation. Structure and Composition of Axoplasm Cross sections of ventral spinal root axons from P5 and S-month-old mice were examined for ultrastructural features of the cytoskeleton, and few if any neurofilament profiles were found in either. For the P5 samples, electron micrographs of fibers in the L2 ventral roots of transgenic and normal littermate controls were obtained from fibers cut sufficiently in cross section to display distinct myelin lamellae. In a blind study of 44 fibers, all were reliably classified as normal or transgenic, solely on the basis of their cytoskeletal characteristics. Even at this early stage of maturation, all fibers in the control samples contained prominent neurofilament profiles. In contrast, in the transgenic samples, neurofilaments were not apparent whereas

;;,ble

Mice

with

Neurofilament-Deficient

Axons

A --- 1

2

3

CT

CT

CT

c Figure

c

7. Analysis

c of Optic

- 4

- 5

CT

CT

T Nerve

Protein

Composition

(A) Crude tissue homogenates from optic nerves of control (C) and transgenic 0 mice, line 44A, were analyzed on a 7.5% polyacrylamide gel in the presence of SDS. Neurofilament proteins, though prominent in the control sample, are not detected in the transgenic sample (lanes 1). Western blots were immunolabeled using anti-NFL (lanes 2), anti-NFM (lanes 3), anti-NFH (lanes 4), and anti-tubulin (lanes 5) antibodies. (B) A serial dilution study reveals that NFH epitopes are clearly detectable in control samples containing 5% of the protein present in the transgenic sample.

microtubules were numerous (Figure 6). These distinguishing features were even more pronounced in the axons of mature transgenic mice. In these mice axonal neurofilaments were rarely encountered in any tract or nerve whereas axonal microtubules typically were densely packed, appeared to be excessively numerous, and occasionally ran in aberrant directions. The absence, in most axons, of both neurofilament epitopes and ultrastructurally recognizable neurofilaments suggested that neurofilament proteins were excluded from theaxonal compartment.Toevaluatethis possibility in aquantitative manner, weanalyzed optic nerve proteins by electrophoretic techniques. In protein-stained gels, samples from control mice revealed the typical proportions of the three neurofilament proteins, whereas no neurofilament proteinsweredetected in the samples from transgenic mice. A similar result was observed in more sensitive immunoblot experiments (Figure 7A). Anti-NFH antibody preparations that revealed robust signals in samples from normal mice detected only trace signals in transgenic samples, and serial dilution studies revealed that the transgenic samples contained less than 5% of the normal neurofilament content (Figure 7B).

60 50 40 z g e

0 Control

3 months

I

n NFH-Lad

30 20 10 0

8

30 20 10 O

i-h

”L

3

4

5

6

7

6

9

10

AXON CIRCUMFERElNCE Figure 8. Axon Calibers Transgenic Mice

in L4 Ventral

Roots

11

12

(urn) from

Normal

and

Light microscopy of a ventral root sample from a control (top) and a transgenic (bottom) animal. Note the generally reduced axon calibers in the transgenic sample and Ithe absence of fibers with calibers comparable to the largest present in the control root. Quantitative analysis of the axon calibers reveals a marked reduction in the transgenic sample but the apparent maintenanceof a bimodal distribution. A similar comparison of P5 lumbar level 2 ventral roots from a transgenic and littermate control indicates that, even at this early stage of fiber maturation, axons in the normal mouse have achieved larger calibers.

Axon Caliber and Myelin Thickness In addition to the marked deficiency of axonal neurofilaments and the associated promiinence of the microtubule cytoskeleton, axons in both the CNS and

398

calibers in the transgenic samples were noticeably smaller than those in the control, a result suggesting that the axons in these transgenic mice fail to develop normally. In the mature nervous system of mammals, myelin thickness correlates positively with increasing axon caliber (Berthold, 1978), and this relationship was clearly evident in the 3-month-old transgenic animals. However, fibers in thetransgenic mice had exceptionally thick myelin sheathes relative to the absolute calibers of their innervating axons. Quantitative analysis of ventral root fibers from transgenic and age-matched control samples revealed that, throughout the entire range of calibers, PNS axons in transgenic mice were relatively hypermyelinated (Figure 9). In contrast, although CNS axon calibers were also smaller than normal, they did not appear similarly hypermyelinated (data not shown). Stability

45

4 2 40 35 4 30 z, 25 d 20 *E 15 10 5

AXON Figure 9. Analysis ence in L4 Ventral Transgenic Mice

CIRCUMFERENCE

(urn)

of Myelin Area Relative to Axon CircumferSpinal Roots from 3-Month-Old Normal and

The fiber profile presented at the top of figure is typical of many encountered in the transgenic sample. Sectioned at the level of the Schwann cell nucleus, it demonstrates an exceptionally thick myelin sheath and a small caliber axon in which microtubule profiles are prominent and neurofilament profiles are absent. Fibers with similar features were never encountered in the control material. Quantitative analysis reveals that both normal and transgenic roots had elaborated a relatively linear relationship between increasing axonal circumferences and myelin areas. However, throughout the range of fiber sizes, fibers in the transgenic sampleare invested with relatively more myelin. Note also that the transgenic sample contained a population of axons with circumferences below those observed in the normal root.

PNS of mature transgenic mice were distinguished by smaller than normal calibers. From I-, 3-, 5-, and 15-month-old transgenic mice, few if any axons achieved calibers typical of the large motor neuron axons normally found in ventral spinal roots (Figure 8). Despite their reduced calibers, axons in the transgenic sample continued to be distributed in a bimodal fashion. To distinguish between a circumstance in which transgenic axons fail to achieve normal axon calibers and one in which normal calibers are achieved but fail to be maintained, spinal roots from P5 transgenic and normal mice were compared. Even at this early stage of fiber maturation, the axon

of Neurons

and

Axons

The nervous systems prepared for the quantitative investigation of myelin and axon relationships were also examined for the presence of additional abnormalities. Alhough not a prominent feature of any tract or nerve, degenerating fibers were encountered frequently enough to indicate that some neurons in these transgenic mice die prematurely. From both 3- and 5-month-old mice, cross sections of lumbar level spinal cords typically contained few if anydegenerating fibers, whereas lumbar level spinal roots frequently contained one or, rarely, two or three fibers undergoing Wallerian degeneration. Few degenerating fibers were encountered in 5-month-old optic nerve samples, whereas none were observed in samples from younger mice. In an effort to evaluate the extent and significance of this axon degeneration, we analyzed al4month-old 44A hemizygous mouse-the oldest available transgenic mouse in this line. Degenerating fibers were encountered in both the CNS and PNS of this mouse, but only rarely. Spinal cord cross sections remained essentiallyfreeof obviouslydegenerating fibers, and dorsal spinal roots were similarly intact. In contrast, ventral roots revealed increased inter-fiber spacing, indicating previous fiber loss, and most contained one or more degenerating fibers. To derive a quantitative assessment of the ventral root fiber loss, we compared the number of myelinated fibers surviving in ventral roots at lumbar levels 1 through 6, in the 14month-old transgenic mouse and an age-matched control. Consistentwith the histological findings, ventral roots in the transgenic sample containedareduced numberoffibers,6208compared with 8134 (Figure 10). Considering that lower motor neurons express the transgene during in utero development and accumulate large perikaryal aggregates by birth, it is notable that more than 75% of these neurons maintain their axons through 14 months of age. Although these findings indicated that some motor fibers degenerated prematurely, a more striking feature revealed by this M-month-old mouse was the

$ble

Mice with

1200 1000 800 800

Neurofilament-Deficient

Axons

1

400 200 0 LLII

Ll

Lz

Figure 10. Myelinated Fibers in Lumbar Month-Old Normal and 44A Transgenic Fewer than normal lumbar roots from strating that some tively old animals.

Ventral Mice

fiber numbers were observed the transgenic mouse (white motor axons had degenerated

Roots

of 14

in the larger bars), demonin these rela-

extent to which the majority of its nervous system appeared to be maintained. The prolonged survival of neurons in these transgenie mice was consistent with their generally normal behaviors. Similarly, histochemical and histological analysisof skeletal muscles revealed normal fibertype distribution and, only rarely, the presence of denervated muscle fibers (data not shown). Discussion The initial aims of this investigation were two-fold. First, in an attempt to dissect the molecular mechanisms underlying neurofilament interactions, we derived mice expressing a transgene-encoded NFH-Bgalactosidase fusion protein. If accumulated to high levels, we predicted that this protein might lead to abnormal neurofilament side arm structure and aberrant inter-filament interactions. Second, because the fusion protein terminated in B-galactosidase sequences, we intended to exploit the presence or absence of B-galactosidase activity to reveal the nature of the interactions that developed between the fusion protein molecules in different neuronal compartments. However, the fusion protein effectively blocked intermediate filament export from perikarya, a circumstance providing unexpected insights into the molecular mechanisms involved in intermediate filament interactions and the role played by neurofilaments in axon biology. In designing this experiment, we made the assumption that the NFHgenomic sequences included in the DNA construct would lead to neuron-specific expression. While the regulatory elements of neurofilament genes have been investigated (Elder et al., 1992a, 1992b), little information relevant to the particular sequences we employed was available. For NFL, both 5’ flanking sequences and intron sequences are involved in conferring the developmental and neuronspecific expression profile (Julien et al., 1987; Beaudet

et al., 1992), and the NFH-based construct we generated contained both 2.9 kb of 5’ flanking sequences and complete NFH intron sequences. In multiple lines, its expression was restricted to neurons and appeared to follow a developmental pattern which may represent that of the endogenous NFH gene. In rodents, high levels of NFH are detected only postnatally (Shaw and Weber, 1982; Cote et al., 1993). This circumstance has led to the suggestion that the NFH gene is first expressed during the final maturation of axons after their targets have been contacted and their outgrowth has stopped (Mitchisom and Kirshner, 1988). However, Cochard and Paulin (1983) and Carden et al. (1987a) have observed low level NFH expression in the fetal nervous system. Our results, using a sensitive B-galactosidase histochemical assay, indicate that the NFH-regulated transgene is also expressed during fetal development, particularly in neuronal populations that mature early. Transient low level punctate labeling in developing spinal roots, if not within axons, may nonetheless be consistent with the normal expression profile of endogenous neurofilament genes, as NFM has been observed in developing Schwann cells (Kelly et al., 1902). Three formal mechanisms could lead to the observed perikaryal accumulation of neurofilaments. First, the overexpression of the NFH molecule, in the form of the human protein (Cot6 et al., 1993), and the overexpression of mouse NFL (Xu et al., 1993) have been reported tocause abnormal neurofilament accumulation in other transgenic mice. It-r those preparations, only exceptionally high levels of transgeneencoded NFL and NFH protein lead to disruption of the neurofilament cytoskeleton, and at least for NFL, overexpression results in increased axonal neurofilament density with no apparent affect upon axon caliber or neuronal survival, until a threshold Qfold higher than the normal neurofilament concentration is reached (Monteiro et al., 1990). In contrast, the steady-stateconcentration of fusion protein in mature line 44A mice is very low relative to that of the endogenous neurofilament proteins, demonstrating that a mechanism other than a quantitative change in the amount of accumulated neurofilament sequences was responsible for our observations. Also, prominent intermediate filament aggregates had formed in spinal cord neurons in newborn line 44A mice prior to the stageof neuronal maturation when neurofilament expression becomes maximal. Secoind, because the fusion protein does not contain the complete NFH sequence, the truncated form of thlis protein could interact aberrantly either with other neurofilament proteins or with molecules necessary for axon transport. These possibilities cannot be ruled out with the available data, and it is conceivable that the apparent hypophosphorylation of the endogenous NFH protein is a direct reflection of such a perturbation. The third possibility, and the one we consider most likely, is that incorporation of the fusion protein into filaments, through NFH sequences, alters the dynamics

of side arm-mediated inter-filament interactions. The carboxyl domain of the NFH molecule is thought to project away from the filament core, contributing to the formation of neurofilament side arms (Hirokawa, 1982; Leterrier and Eyer, 1987). The B-galactosidase sequences added to the carboxy-terminal domain of NFH would therefore be exposed at the surface of the filaments intowhich the fusion protein had assembled. Since B-galactosidase monomers form stable tetramers (Langley and Zabin, 1976), high affinity 8-galactosidase interactions could develop between fusion proteins incorporated into different neurofilaments. Support forthis possibilityarisesfrom the facts that 8-galactosidase activity requires monomer interaction and all fusion protein epitopes were localized in aggregates that express B-galactosidase activity. The configuration of peripherin and a-internexin in relation to the three neurofilament proteins is not fully understood but they presumably become incorporated into the perikaryal aggregates by forming their normal associations with neurofilaments (Corbo and Hays, 1992). The ultrastructural analysis of the perikaryal aggregates revealed close parallel arrays of filaments, highly reminiscent of the typical neurofilament configuration and packing density seen in axons (Hirokawa, 1982; Hirokawa et al., 1984). Several lines of evidence indicate that such a filament configuration occurs only in the presence of strong inter-filament interactions (Hirokawa, 1991; Gotowet al., 1992). Considering the relatively low level of fusion protein accumulation detected in line 44A mice, a small number of fusion protein molecules incorporated into each filament may be sufficient to confer high affinity inter-filament interactions. Furthermore, most cells contain only one or a few aggregates, suggesting that once filaments begin to associate, they tend to remain aggregated. In the dendritic compartment smaller aggregates were occasionally found (Figure 3), but as demonstrated for the microtubule-associated protein MAP2 (Tucker et al., 1989), their presence there could result from local de novo neurofilament synthesis rather than from fractionation and transport of aggregates assembled in the perikarya. This result highlights the possibility that an exceptional protein species, present in only trace amounts, may effectively perturb an otherwise normal neurofilament cytoskeleton. Such a mechanism could underlie the formation of the neurofilament aggregates present in many neurodegenerative diseases, including Lewy and Hirano bodies. In one model of neurofilament turnover, assembled filaments are thought to be degraded at the axon terminus by acalcium-dependent protease (Roots, 1983). The failure to export neurofilaments from the perikarya would, of course, separate them from this site of neurofilament processing and, in the absence of a compensating mechanism, lead to their relentless accumulation in the cell body. This was not observed. Rather, in the +X-month-old mouse, perikaryal aggre-

gates were not noticeably larger than those observed in 3-month-old mice (data not shown). Furthermore, biochemical analysis of spinal cord samples from 3-month-old transgenic mice revealed no absolute increase in accumulated neurofilaments, suggesting that filaments may turn over in the cell body. Since phosphorylation protects neurofilaments from proteolysis (Goldstein et al., 1987; Pant, 1988), their overall hypophosphorylated statemaycontributetoanyturnover that occurs in the perikarya. The results of several investigations suggest that neurofilaments are a major determinant of axon caliber (Friedeand Samorajski, 1970; Hoffman et al., 1983, 1984,1985a, 1985b,l987; de Waegh et al., 1992; Sakaguchi et al., 1993). This interpretation is directly supported by the results of the present study. In samples processed through standard aldehyde fixation and Epon embedding procedures, axon calibers, throughout both the CNS and PNS of the transgenic mice, were obviously thinner than normal. In the periphery, axon calibers were measured and found to be approximately 50% of control values. If the simultaneous accumulation of perikaryal filaments did not compromise the synthetic capabilities of the neurons projecting these axons, it follows that axonal neurofilaments are essential in establishing mature axon calibers; axons with a normal neurofilament cytoskeleton expressapproximately4timesthecrosssectionalarea of those without. The massive enlargement of the motor neuron perikarya in these mice is fully consistent with a model in which neurofilaments serve to occupy a large proportion of the normal cell volume. Despite the large deficiency in axon volumes seen in both the quiverer quail (Yamasaki et al., 1991,1992) and the mice described here, neurofilaments cannot be the exclusive determinant of relative axon calibers. If they were, all axons without neurofilaments should be of an equivalent caliber. However, in both of these animal models, axons continue to be distributed across a range of circumferences in a typical multimodal manner requiring that components other than neurofilaments contribute to theestablishment of relative axon calibers. It is therefore possible that axonal neurofilaments provide the structural means by which axons achieve the appropriate radial growth as defined primarily by other factors. In this light, it will also be of interest to determine whether the axon calibers of the smallest myelinated fibers fall below the typical lower limit for myelination observed in the normal nervous system (Voyvodic, 1989). For normally myelinated fibers, a positive correlation exists between the volume of myelin elaborated by Schwann cells and the caliber of their innervating axons (Berthold, 1978). In the PNS of these transgenic mice, this general relationship was achieved, but relative to their absolute axon calibers, all fibers developed markedly thicker than normal myelin. Because attenuation of axon caliber occurs apparent as early as the first week of ex utero life, before maximum axon calibers are achieved, this unique quantitative

gble

Mice with

Neurofilament-Deficient

Axons

relationship appears to arise from diminished radial growth of axons (axon dystrophy) rather than from an atrophic process affecting axons that had matured normally(axonal atrophy). Whilethis uniquequantitative relationship could arise through the action of unknown compensatory mechanisms, it could equally signify the continued presence of a normal, axonally derived molecular signal that is interpreted by Schwann cells to define their appropriate levels of myelin elaboration. In this model of axon-Schwann cellinteraction,theabsolutecaliberoftheinnervating axon is not a component in the signaling mechanism and had the axons achieved the calibers appropriate for the signals they emanated, normalized quantitative relationships between myelin thickness and axon calibers would have been realized. By extension, the hypermyelination apparent in atrophied axons in motor neuron disease (Carpenter, 1968) may not be consequent upon their earlier, mature axon-Schwann cell relationships, but rather, may reflect the continued delivery of normal axonal signals to the innervated Schwann cell population. Note however, that CNS fibers were not similarly hypermyelinated, suggesting that a different mechanism is used to signal between axons and oligodendrocytes. The neurofilament-deficient axons in the quiverer quail have significantly reduced conduction velocities (Sakaguchi et al., 1993). Preliminaryelectrophysiological studies indicate that a similar change occurs throughout the nervous system of the transgenic mice described here. In spite of this, their within cage behaviors were surprisingly unremarkable, and consistent with this, the majority of their neurons and axons appear to be maintained throughout life, with a small loss of motor axons observed only in theoldest mouse examined. Therefore, in the mouse, an organized neurofilament network is not essential for axonal maintenance and perikarya can survive in the presence of massive filamentous aggregates. Whether the neurons in larger or longer lived mammalian species would tolerate such extensive cy-toskeletal disruptions cannot be accurately predicted, but both the present results and the apparent stability of the neurofilamentdeficient axons in the quiverer quail suggest such a possibility. In contrast, anti-neurofilament antibodies injected into Xenopus oocytes were found to perturb earlier stages of axonal development (Szaro et al., 199l).Therefore, it is noteworthythat disruption of the neuronal cytoskeleton in the transgenic mice begins when circuit formation is nearing completion. The disruption of neurofilaments in quiverer quail occurs relatively earlier in development, during axon outgrowth when NFL is first expressed, thus raising the possibility that the abnormal behaviors of quiverer quail may be consequent upon abnormalities in circuit development. The accumulation of neurofilaments and the associated disruption of the perikaryal and axonal cytoplasm are proposed to play a critical role in the evolution of human motor neuron disease(Carpenter, 1968)

and in late life neurodegenerative disease in the form of Lewy and Hirano bodies. The present results might suggest that even a gross disruption in the normal distribution of neurofilaments is well tolerated, but the composition of the filamentous aggregates in these mice is unique, and the filamentous accumulations that form under other circumstances may have radically different properties. In addition, the failure to investaxonswith a neurofilamentcytoskeleton during maturation is fundamentally different from a perturbation of the cytoskeleton occurring in neurons that havematured normally. Finally,theaccumulation of neurofilaments observed in axons in various neurodegenerative diseases may have consequences on neuronal function and survival that do not occur when neurofilaments are sequestered in perikarya and dendrites, as seen in these transgenic mice. Despite the pronounced differences in the viability of neurons in the transgenic mice described here and those in which very high levels of normal NFL and NFH proteins are expressed (Xu et al., 1993; Cot6 et al., 1993), it is of interest that motor neurons are the one population in which we have solfar observed convincing evidence of degeneration, This, combined with the early and high levels of filament accumulation observed in these cells, suggests that motor neurons either synthesize or process neurofilaments in a unique manner. How this may relate to the suggested role of neurofilaments in the develiopment of motor neuron disease or the recent report that a mutation in the superoxide dismutase gene causes one form of the disease (Rosen et al., 1993) remains to be elucidated. The mice we have described here express a reproducible disruption in their neurofilament cytoskeleton, providing an opportunity to investigate further the function of axonal neurofilaments in the normal, regenerating, and diseased mammalian nervous system. Finally, multifunctional fusion proteins, similar to that expressed in these mice, may prove equally effective in disrupting the relationships between other components of the cytoskeleton and thus offer a general strategy by which structural and functional relationships can be investigated. Experimental

Procedures

Derivation of the NH/-lacZ Construct The mouse NW gene, included in a 15 kb Kpnl-Sal1 fragment, was previously subcloned into the pT3T7-18 vector (BRL) (lulien et al., 1986). The gene was released from this vector with Kpnl and EcoRV, gel isolated, and religated into1 the pGNA vector (Le Mouellic et al., 1998), which was previously digested with Kpnl and Xmnl. The blunt end junction between the NFH gene and the /acZ gene (EcoRV-Xmnl) results in an in-frame ligation between the two genes and was verified by DNA sequencing. All molecular biology was performed using protocols described by Sambrook et al. (1989). Production of Transgenic Mice The NH-/-/acZ construct was recovered as a Kpnl-Sall fragment from the pGNA vector, gel purified using DEAE paper, and microinjected into male pronuclei of B6C3F2 ‘zygotes. The injected

NWMXY 402

embryos were transferred to the oviducts of pseudopregnant B6C3Fl females. DNA was extracted from tail biopsies of the mice derived from these females and analyzed for the presence of transgene sequences by the polymerase chain reaction, using primersspecificforthelacZgene(5’-3’GAAAACCCTGGCGTCCCAACTT and CTGAACTTCACCCTCCAGTACAGC), and by Southern blotting, using a 3 kb fragment of the /acZ gene as a probe. Seven mice were positive, and from these, five lines were established. Southern analysis of Sacll- and EcoRV-digested genomic DNA indicated a complex transgene insertion in founder 44, and during subsequent breeding, three transgene loci with distinguishing flanking fragments segregated, and lines bearing each were established. Detection of P-Calactosidase Enzymatic Activity Mice were lethally anesthetized by intraperitoneal injection of avertin (8 mglkg) and transcardially perfused with 0.5% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) at 4OC. Tissues were removed and postfixed with the same aldehyde mixture for an additional 45 min. These samples were rinsed in 0.1 M phosphate buffer (pH 7.4) and incubated overnight at 37OC in 3.1 mM potassium ferricyanide, 3.1 mM potassium ferrocyanide, 1 mM MgCI,, and 0.4 mg/ml Bluo-gal (BRL) in 0.1 M phosphate buffer (pH 7.4). In tissues in which bacterial B-galactosidase activity was present, a blue reaction product was deposited.

(1 mM EGTA, 1 mM MgCl*, in 0.1 M MES buffer [pH 7.4]), at a ratio of 1 ml of buffer for 1 g of tissue. Protein concentration was determined according to the method of Bradford (1976), using bovine serum albumin as the standard. Proteins were analyzed by SDS-polyacrylamide gel electrophoresis according to the technique of Laemmli (1970), on small slab gels. These gels were either stained with Coomassie brilliant blue, or transferred to nylon membrane (Hybond, Amersham) for immunoblotting according to the procedure of Towbin et al. (1979) and Burnett (1981). Replica blots were saturated with Blotto/Tween buffer (5% [wtlvol] nonfat dry milk, 0.2% Tween-20, and 0.9% NaCl in 100 mM Tris buffer [pH 7.5]), and incubated with the first antibody diluted in the Blotto/Tween buffer. The membrane was washed extensively in the Blotto/Tween buffer and incubated for 1 hr at room temperature with a peroxidase-labeled secondary antibody, which was revealed with the ECL kit from Amersham according to manufacturer’s instructions. The antibodies were stripped from the membrane by incubating in 100 mM B-mercaptoethanol, 2% SDS, 62.5 mM Tris (pH 6.7), for 30 min at 55OC. The same membrane was reblocked and serially reprobed with the additional antibodies. The anti-NFL, -NFM, and -8-tubulin antibodies used in this Western blotting analysis were purchased from Amersham; RS18, an antibody recognizing a phosphorylated form of NFH, was provided by Dr. B. Anderton (London). All antibodies were used at a final concentration of 1:lOOO. Acknowledgments

lmmunocytochemistry Mice were lethally anesthetized with avertin (8 mglkg) and perfused transcardially with 2% paraformaldehyde-lysine-periodate at 4°C (McLean and Nakane, 1974). Tissues were placed in the same fixative for an additional 2-5 hr and transferred to 30% sucrose in 0.1 M phosphate buffer at 4OC, where they remained for l-3 days. Tissues were then briefly rinsed in 0.1 M phosphate and embedded in 15% gelatin. Tissue blocks were trimmed, frozen in isopentane at -40°C, and stored under isopentane at -80°C until sectioning. Cryostat sections (12 urn thick) were placed on coated slides and postfixed in ice-cold formol-sucrose for 30 min. The sections were then blocked with 7% normal goat and horse serum for20 min at room temperature and incubated in 100 ul of primary antibody overnight at room temperature. Biotinylated secondary antibodies (horse anti-mouse IgG, 1:200, or goat anti-rabbit, 1:2BO; Vector Laboratories) allowed the visualization of bound primary antibody using the Vectastain kit (Vector Laboratories), according to the supplier’s instructions. Antibodies and dilutions employed were as follows: polyclonal mouse anti+-galactosidase (1:lOBO); monoclonal mouse antiNFH antibodies RM0217 (undiluted), RMD09 (undiluted), and RT-97 (1:500); polyclonal rabbit anti-NFL (1:500); and anti-peripherin and anti-a-internexin (undiluted). RM0217, RMD09, and the polyclonal rabbit anti-NFL antibodies were generously provided by Dr. V. M.-Y. Lee (Lee et al., 1987). RT-97 was kindly supplied by Dr. J. Wood (London, England). The anti-peripherin and anti-a-internexin antibodies were generously provided by Dr. R. Liem (New York). Antiserum to B-galactosidase was provided by Dr. A. CBte (Montreal, Canada). Electron Microscopy Avertin-anesthetized mice were perfused with freshly prepared 0.5% paraformaldehyde, 2.5% glutaraldehyde in 0.1 M phosphate buffer at room temperature (pH 7.4). Dissected tissues were incubated in the same fix at room temperature for times varying from hours to days. After a brief rinse in 0.1 M phosphate buffer, each sample was postfixed in 1% osmium tetroxide for 1 hr, washed three times in 0.1 M phosphate buffer, and dehydrated in a graded series of ethanol. The tissues were then embedded in Epon, and sections for light and electron microscopy were prepared with a Reichert Jung Ultracut microtome. Ultrathin sections were stained with lead citrate and examined in a Philips CM-10 electron microscope. Electrophoresis Spinal cords

and lmmunoblot and optic nerves

Analysis were homogenized

in RB buffer

We thank Drs. B. Anderton, A. C&e, V. M.-Y. Lee, R. K. H. Liem, and J. Wood for antibodies, P. Brulet and J. P. Julien for genomic and plasmid sequences, and A. Aguayo and S. Carpenter for discussions. S. Albretchson, S. Gauthier, I. Tretjakoff, and P. Valera provided excellent technical assistance. Support for this work came, in part, from the Montreal branch of the Ludwig Institute for Cancer Research, the Muscular Dystrophy Association of Canada, and the Medical Research Council of Canada. Salary support for J. E. came, in part, from INSERM (France). A. P. is an associate investigator of the Canadian Network for Neuronal Regeneration and Functional Recovery. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received

September

29, 1993;

revised

November

24, 1993.

References Balcarek, J. M., and Cowan, glial fibrillary acidic protein of the intermediate filament 13, 5527-5543.

N. J. (1985). Structure of the mouse gene: implications for the evolution multigene family. Nucl. Acids Res.

Beaudet, L., Charron, G., Houle, D., Tretjakoff, I., Peterson, A., and Julien, J.-P. (1992). lntragenic regulatoryelementscontribute to transcriptional control of the neurofilament light gene. Gene 116, 205-214. Berthold, C. H. (1978). Morphology of normal peripheral axons. In Physiology and Pathobiology of Axons, S. G. Waxman, ed. (New York: Raven Press), pp. 3-63. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 284-294. Brady, S.T. (1993). Motor neuronsand and health. Cell 73, l-3.

neurofilaments

in sickness

Burnett, W. N. (1981). Western blotting. Electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal Biochem. 772,195-203. Carden, M. J., Schlaepfer, W. W., and Lee, V. M.-Y. (1985). The structure, biochemical properties, and immunogenicity of neurofilament peripheral regions are determined by phosphorylation state. J. Biol. Chem. 260, 9805-9817.

$ble

Mice with

Neurofilament-Deficient

Axons

Carden, M. J., Lee, V. M.-Y., and Schlaepfer, Hexanedione neuropathy is associated with ing of neurofilament proteins. Neurochem.

W. W. (1986). 2,5covalent crosslinkPathol. 5, 15-35.

of the three 479-491.

Carden, M. J., Trojanowski, I. Q., Schlaepfer, W. W., and Lee, V. M.-Y. (1987a).Two+tageexpression of neurofilament polypeptides during rat neurogenesis with early establishment of adult phosphorylation patterns. J. Neurosci. 7, 3489-3504. Carden, M. J., Goldstein, M., Bruce, J., Cooper, H., and Schlaepfer, W. (1987b). Studies of neurofilaments that accumulate in proximal axons of rat intoxicated with /3$-iminodiproprionitrile (IDPN). Neurochem. Pathol. 7, 189-205. Carpenter, S. (1968). Proximal enlargement eases. Neurology 78, 841-851.

in motor

neuron

dis-

and neurofilament neuron disease.

J.

de Waegh, S. M., Lee, V. M.-Y., and Brady, S. T. (1992). Local modulation of neurofilament phosphorylation, axonal caliber, and slow axonal transport by myelinating Schwann cells. Cell 68, 451-463. R. A. (1992a). of the human

Elder, G. A., Liang, Z., Lee, N., Friedrich, V. L., and Lazzarini, R. A. (1992b). Novel DNA binding proteins participate in the regulation of human neurofilament gene expression. Mol. Brain Res. 15, 85-98. Escurat, M., Djabali, K., Cumpel, M., Gros, F., and Portier, M.-M. (1990). Differential expression of two neuronal intermediatefilament proteins, peripherin and the low-molecular-mass neurofilament protein (NF-L), during development of the rat. J. Neurosci. 70, 764-784. Eyer, J., and Leterrier, J. F. (1988). Influence of the phosphorylation state of neurofilament proteins on the interactions between purified filaments in vitro. Biochem. J. 252, 655-660. Fliegner, K. H., and biology of neuronal 109-167.

Liem, R. K. H. (1991). Cellular and molecular intermediate filaments. Int. Rev. Cytol. 737,

Fliegner, K. H., Ching, C. Y., and Liem, R. K. H. (1990). The predicted amino acid sequence of a-internexin is that of a novel neuronal intermediate filament protein. EMBO J. 9, 749-755. Franke, mediate 3-4.

W. W. (1987). Nuclear laminins and cytoplasmic filament proteins: a growing multigene family.

interCell 48,

Friede, R. L., and Samorajski, T. (1970). Axon caliber related to neurofilaments and microtubules in sciatic nerve fibers of rats and mice. Anat. Rec. 767, 379-388. Geisler, N. F., Kaufmann, F., Fischer, S., Plessmann, U., and Weber, K. (1983). Neurofilament architecture combines structural principles of intermediate filaments with carboxy-terminal extensions increasing in size between triplex proteins. EMBO 1. 2, 1295-1302. Ceisler, N., Fischer, S., Vanderkerckhove, J., Plessmann, U., and Weber, K. (1984). Hybrid character of large neurofilament protein (NF-M): intermediate filament type sequences followed by a long acidic carboxy-terminal extension. EMBO J. 3, 2701-2706. Ceisler, N. S., Fischer, S., Vanderkerckhove, J., Van Damme, Plessmann, U., and Weber, K. (1985). Protein-chemical characterization of NF-H, the largest mammalian neurofilament component; intermediate filament-type sequences followed by a unique carboxy-terminal extension. EMBO 1. 4, 57-63. Clicksman,

M. A,, and Willard,

M. (1985). Differential

expression

Ann.

Goldman, J. E., and Yen, S.-H. (1986). Cytoskeletal malities in neurodegenerative diseases. Ann 223.

NY Acad.

Sci. 455,

protein abnorNeural. 79, 209-

Goldstein, M. E., Sternberger, N. H., and Sternberger, L.A. (1987). Phosphorylation protects neurofilaments against proteolysis. J. Neuroimmunol. 74, 149-160.

Gotow,T. M.,Takeda, M., Tanaka, T., and Hashimoto, P. H. (1992). Macromolecular structure of reassembled fleurofilaments as revealed by the quick-freeze deep-etch mica method: difference between NF-M and NF-H subunits in their ability to form crossbridges. Eur. J. Cell. Biol. 58, 331-345.

C&b, F., Collard, J-F., and Julien, J.-P. (1993). Progressive neuronopathy in transgenic mice expressing the human neurofilament heavy gene: a mouse model of amyotrophic lateral sclerosis. Cell 73, 35-46.

Elder, G. A., Liang, Z., Snyder, S. E., and Lazzarini, Multiple nuclear factors interact with the promoter neurofilament gene. Mol. Brain Res. 75, 99-107.

polypeptides.

Goldstein, M. E., Weiss, S. R., Lazzarini, IR. A., Sneidman, P., Lees, J. F., and Schlaepfer, W. W. (1988). mRNA levels of all three neurofilament proteins decline following nerve transection. Mol. Brain Res. 3, 287-292.

Cochard, P., and Paulin, D. (1984). Initial expression of neurofilaments and vimentin in the central and peripheral nervous system of the mouse embryo in viva. J. Neurosci. 4, 2080-2094. Corbo, M., and Hays, A. P. (1992). Peripherin protein coexist in spinal spheroids of motor Neuropathol. Exp. Neural. 57, 531-537.

neurofilament

Griffin, J. W., and Price, D. duced by toxic chemicals. toxicology, P. Spencer and Williams and Wilkins), pp.

L. (1980). Proximal axonopathies inIn Experimental ,and Clinical NeuroH. H. Schaumburg, eds. (Baltimore: 161-178.

Griffin, J. W., Hoffman, P. N., Clark,A. W., Carrol, P. T., and Price, D. L. (1978). Slow axonal transport of neutofilament proteins; impairment bybv-iminodiproprionitrileadministration. Science 202, 633-635. Hirokawa, N. (1982). Cross linker system between neurofilaments, microtubules, and membranous organelles in frog axons revealed by the quick-freeze, deep-etching method. J. Cell Biol. 94, 129-142. Hirokawa, N. (1991). Molecular architecture and dynamics of the neuronal cytoskeleton. In The Neuronal Cytoskeleton, R. D. Burgoyne, ed. (New York: Wiley-Liss Inc.), pp. 5-74. Hirokawa, N., Clicksman, zation of mammalian neuronal cytoskeleton.

M. A., and Willard, M. B. (1984). Organineurofilament polypeptides within the J. Cell Biol. 98, 1523-1536.

Hisanaga, S., and Hirokawa, N. (1989). The effects of dephosphorylation on the structure of the projections of neurofilaments. Neurosci. 9, 959-966.

J.

Hoffman, P. N., Lasek, R. J., Griffin, J. W., and Price, D. L. (1983). Slowing of theaxonal transportof neurofilament proteinsduring development. J. Neurosci. 3, 1694-1700. Hoffman, P. N., Griffin, J. W., and Price, D. L. (1984). Control of axonal caliber by neurofilament transport. J. Cell Biol. 99, 705714. Hoffman, P. N., Griffin, J., Gold, ing of neurofilament transport oping nerve fibers. J. Neurosci.

B., and Price, D. L. (1985a). Slowand the radial growth of devel5, 2920-2929.

Hoffman, P. N., Thompson, G., Criffin,J., and Price, D. L. (1985b). Changes in neurofilament transport coincide temporally with alterations in the caliber of axons in regenerating motor fibers. J. Cell Biol. 707, 1332-1340. Hoffman, P. N., Cleveland, D. W., Griffin, J. W., Landers, P. W., Cowan, N. J., and Price, D. L. (1987). Neurofilament gene expression: a major determinant of axonal caliber. Proc. Natl. Acad. Sci. USA 84, 3472-3476. Julien, J.-P., and Mushynski, tion sites in mammalian Chem. 257, 10467-10470.

W. E. (1982). neurofilament

Mqltiple phosphorylapolypeptides. J. Biol.

Julien, J.-P., Meijer, D., Hurst, J., and Crosveld, F. (1986). Cloning and developmental expression of the murine neurofilament gene family. Mol. Brain Res. 7, 243-250. Julien, J. P., Tretjakoff, I., Beaudet, L., and Peterson, A. (1987). Expression and assembly of a human neulrofilament protein in transgenic mice provide a novel neuronal marking system. Genes Dev. 7, 1085-1095. Julien, J.-P., CBt6, F., Beaudet, L., Sidky, M., Flavell, D., Grosveld, F., and Mushynski, W. (1988). Sequence and structure of the mouse gene coding for the largest neurofilament subunit. Gene 68, 307-314.

Nf3lWJn 404

Kaplan, M. P., Chin, S. S. M., Fliegner, K. H., and Liem, R. K. H. (1998). Alpha-internexin, a novel neuronal intermediate filament protein, precedes the low molecular weight neurofilament protein (NF-L) in thedeveloping rat brain. J. Neurosci. 70,2735-2748. Kelly, 8. M., Gillespie, C. S., Sherman, D. L., and Brophy, P. J. (1992). Schwann cells of the myelin-forming phenotype express neurofilament protein NF-M. J. Cell Biol. 778, 397-410. Laemmli, U. K. (1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227,680~685. Langley, K. E., and Zabin, I. (1976). B-Calactosidasea complementation: propertiesof the complemented enzymeand mechanism of the complementation reaction. Biochem. 75, 4866-4873. Lasek, R. J., Oblinger, M., and Drake, P. (1983). Molecular biology of neuronal geometry: expression of neurofilament genes influences axonal diameter. Cold Spring Harbor Symp. Quant. Biol. 78, 731-744. Lee, V. M.-Y., Carden, M., Schlaepfer, W., and Trojanowski, J. (1987). Monoclonal antibodies distinguish several differentially phosphorylated states of the two largest rat neurofilament subunits (NFH and NFM) and demonstrate their existence in the normal nervous system of adult rats. J. Neurosci. 7, 3474-3488. Lee, V. M.-Y., Otvos, L., Carden, M. J., Hollosi, M., Dietzschold, B., and Lazzarini, R. A. (1988). Identification of the major multiphosphorylation site in mammalian neurofilaments. Proc. Natl. Acad. Sci. USA 85, 1998-2882. Le Mouellic, H., Lallemand, Y., and Brulet, P. (1990). Targeted replacement of the homeobox gene Hox-3.1 by the Escherichia coli lacZ in mouse chimeric embryos. Proc. Natl. Acad. Sci. USA 87, 4712-4716. Lendahl, U., Zimmerman, L. B., and McKay, R. D. G. (1998). CNS stem cells express a new class of intermediate filament protein. Cell 60, 585-595. Leterrier, J. F., and Eyer, J. (1987). Properties of highly viscous gels formed by neurofilaments in vitro. A possible consequence of a specific inter-filament cross-bridging. Biochem. J. 245, 93101. Liem, R. K. H. (1993). Molecular biology of neuronal filaments. Curr. Opin. Cell Biol. 5, 12-16.

intermediate

McLean, I. W., and Nakane, P. K. (1974). Periodatelysinepara formaldehyde fixative. A new fixative for immunoelectron croscopy. J. Histochem. Cytochem. 22,1077-1883. Mitchison, T., and Kirshner, M. (1988). nerve growth. Neuron 7,761-772. Monaco, Cambetti, transport diameter.

Cytoskeletal

mi-

dynamics

in

S., Autilio-Cambetti, L., Lasek, R. J., Katz, M. J., and P. (1989). Experimental increase of neurofilament rate: decreases in neurofilament number and in axon J. Neuropathol. Exp. Neurol. 48, 23-32.

Monteiro, M. J., Hoffman, P. N., Ceahart, J. D., and Cleveland, D. (1998). Expression of NF-L in both neuronal and nonneuronal cells of transgenic mice: increased neurofilament density in axons without affecting caliber. J. Cell Biol. 777, 1543-1557. Muma, N. A., Hoffman, P. N., Slunt, S. H., Applegate, M. D., Lieberburg, I., and Price, D. L. (1998). Alterations in levels of mRNAs coding for neurofilament protein subunits during regeneration. Exp. Neural. 707, 230-235. Oblinger, M., and Lasek, R. (1988). Axotomy induced alterations in the synthesis and transport of neurofilaments and microtubules in dorsal root ganglion cells. J. Neurosci. 8, 1747-1758. Osamu, O., Gahara, Y., Miyake, T., Teraoka, H., and Kitamura, T. (1993). Neurofilament deficiency in quail caused by nonsense mutation in neurofilament-L gene. J. Cell Biol. 727, 387-395. Pachter, J. S., and Liem, R. K. H. (1984). The differential appearance of neurofilament triplet polypeptides in the developing rat optic nerve. Dev. Biol. 703, 288-210. Pant, H. (1988). Dephosphorylation of neurofilament proteins enhances their susceptibility to degradation by calpain. Biothem. J.256,665-668. Parry, D., and Steiner?, ture. Curr. Opin. Cell

P. M. (1992). Intermediate Biol. 4, 94-98.

filament

struc-

Roots, B. (1983). Neurofilament accumulation apses by leupeptin. Science 227, 971-972.

induced

in syn-

Rosen, D., Siddique, T., Patterson, D., Figlewicz, D., Sapp, P., Hentati, A., Donaldson, D., Coto, P., O’Regan, J., Deng, H-X., Rahmani, Z., Krizus, A., McKenna-Yasek, D., Cayabyab, A., Caston, S., Berger, R., Tanzi, R., Halperin, J., Herzfeldt, B., Van den Berg, R., Hung, W-Y., Bird, T., Deng, G., Mulder, D., Smyth, C., Laing. N., Soriano, E., Pericak-Vance, M., Haines, I., Rouleau, G., Cusella, J., Horvitz, R., and Brown, R. (1993). Mutations in Cui Zn superoxidedismutasegeneareassociated with familial amyotrophic lateral sclerosis. Nature 362, 59-62. Sakaguchi, T., Okada, M., Kitamura, T., and Kawasaki, K. (1993). Reduced diameter and conductance velocity of myelinated fibers in the sciatic nerve of a neurofilament-deficient mutant quail. Neurosci. Lett. 753, 65-68. Sambrook, J., Fritsch, Cloning: A Laboratory bor, New York: Cold

E. F., and Maniatis, T. (1989). Molecular Manual. Second Edition (Cold Spring HarSpring Harbor Laboratory).

Schmidt, M. L., Carden, M. I., Lee, V. M.-Y., and Trojanowski, 1. Q. (1987). Phosphate dependent and independent neurofilament epitopes in the axonal swellings of patients with motor neuron disease and controls. Lab. Invest. 56,282-294. Schmidt, M. L., Lee, V. M.-Y., and Trojanowski, J. Q. (1989). Analysis of epitopes shared by Hirano bodies and human neurofilament proteins in normal and Alzheimer’s disease hippocampus. Lab. Invest. 60, 513-522. Schmidt, M. L., Murray, J., Lee, V. M.-Y., Hill, W. D., Wertkin, A., and Trojanowski, J. Q. (1991). Epitope map of neurofilament protein domains in cortical and peripheral nervous system Lewy bodies. Amer. J. Pathol. 739, 53-65. Shaw, G., and Weber, K. (1982). Differential expression of neurofilament triplet proteins in brain development. Nature298,277279. Steiner& P. M., and Roop, D. R. (1988). Molecular and cellular biology of intermediate filaments. Annu. Rev. Biochem. 57,593625. Sternberger, L. A., and Sternberger, N. H. (1983). Monoclonal antibodies distinguish phosphorylated and nonphosphorylated forms of neurofilaments in situ. Proc. Natl. Acad. Sci. USA 80, 6126-6130. Szaro, B. G., Grant, P., Lee,V. M.-Y., and Gainer, H. (1991). Inhibition of axonal development after injection of neurofilament antibodies into a Xenopus laevis embryo. J. Comp. Neural. 308,576585. Towbin, H., Staehlin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350-4354. Toyoshima, I., Yamamoto, A., Masamune, O., and Satake, M. (1989). Phosphorylation of neurofilament proteins and localization of axonal swellings in motor neuron disease. J. Neurol. Sci. 89, 269-277. Troncoso, J. C., Hoffman, P. N., Griffin, J. W., Hess-Koziow, K. M., and Price, D. L. (1985). Aluminum intoxication: a disorder of neurofilament transport in motoneurons. Brain Res. 342,172175. Troncoso, J. C., Sternberger, L. A., Sternberger, N. H., Hoffman, P. N., and Price, D. L. (1986). lmmunocytochemical studies of neurofilament antigens in the neurofibrillary pathology induced by aluminum. Brain Res. 364, 295-300. Tucker, R. P., Garner, C. C., and Matus, A. (1989). In situ localization of microtubule-associated protein mRNA in the developing and adult rat brain. Neuron 2, 1245-1256. Voyvodic, J. T. (1989). Target size regulates caliber tion of sympathetic axons. Nature 342, 430-433.

and myelina-

Watson, D., Griffin, J., Fittro, K., and Hoffman, P. (1989). Phosphorylation-dependent immunoreactivity of neurofilaments increases during axonal maturation and B,J3-iminodiproprionitrile intoxication. J. Neurochem. 53, 1818-1829.

z5ble

Mice

with

Neurofilament-Deficient

Axons

Willard, M., and Simon, C. (1983). Modulation of neurofilament axonal transport during the development of rabbit retinal ganglion cells. Cell 35, 551-559. Wong, J., and Oblinger, M. (1987). Changes in neurofilament gene expression occur after axotomy of dorsal root ganglion neurons: an in situ hybridization study. Metab. Brain Dis. 2,291303. Wuiek, I. R.,andCambetti, transport is proportional J. Neurosci. 75, 75-83.

R. l.(1986).Theamountof to the radial dimensions

slowaxonal of the axon.

Xu, Z., Cork, L. C., Griffin, J. W., and Cleveland, D. W. (1993). Increased expression of neurofilament subunit NF-L produces morphological alterations that resemble the pathology of human motor neuron disease. Cell 73, 23-33. Yamasaki, hypotrophic tant strain

H.,

Itakura, C., and Mizutani, M. (1991). Hereditary axonopathywith neurofilament deficiency in a muof the Japanese quail. Acta Neuropathol. 82,427-434.

Yamasaki, H., Bennett, C. S., Itakura,C, and Mizutani, M. (1992). Defective expression of neurofilament protein subunits in hereditary hypotrophic axonopathy of quail. Lab. Invest. 66, 734743. Zabin, I. (1982). for protein-protein

g-Galactosidase interaction.

acomplementation. Mol. Cell. Biochem.

A model 49, 87-96.