Neuroprotection of Scutellarin is mediated by inhibition of microglial inflammatory activation

Neuroscience 185 (2011) 150 –160

NEUROPROTECTION OF SCUTELLARIN IS MEDIATED BY INHIBITION OF MICROGLIAL INFLAMMATORY ACTIVATION S. WANG,a,b H. WANG,c H. GUO,c L. KANG,c X. GAOa AND L. HUa*

Microglia, resident brain macrophages, serve important functions in the central nervous system. Under normal conditions, brain microglia are involved in immune surveillance and host defense against infectious agents. However, in the pathogenesis of neurodegenerative diseases and stroke, and so forth, these cells may be activated by several stimuli and activated microglia are thought to contribute to neuronal damage via the release of a diverse range of proinflammatory and/or cytotoxic factors, such as nitric oxide (NO), tumor necrosis factor-␣ (TNF-␣), interleukin-1␤ (IL-1␤), and reactive oxygen species (ROS) (Neumann et al., 2009; Tambuyzer et al., 2009; Jin et al., 2010). Activated microglia can also disrupt the blood-brain barrier and attract activated T cells, monocytes, and neutrophils into the central nervous system, by producing matrix metalloproteinase and chemokines (Zoppo et al., 2007; Yenari et al., 2006; D’Mello et al., 2009). Thus, inhibition of the microglial over-reaction and the inflammatory processes may represent a therapeutic target to alleviate the progression of these neurological diseases (Yenari et al., 2006; Kaushal and Schlichter, 2008; Novarino et al., 2004). Erigeron breviscapus (Vant.) Hand-Mazz has been one of the most widely used herbal medicines in China for treatment of ischemic cerebrovascular diseases. Scutellarin (Fig. 1), a flavone glucuronide of 5,6,4=-trihydroxyflavone-7-O-glucoronide, is believed to be the major active component of this herb (Zhang et al., 2009; Liu et al., 2005). Liposomal injection (Lv et al., 2005) and intranasal delivery (Shi et al., 2010) were developed to improve its brain distribution. Previous studies suggested that neuroprotective actions of Scutellarin may be due to its antioxidant (Hong and Liu, 2004a,b; Liu et al., 2005), antiapoptotic (Zhang et al., 2009), and calcium channel antagonist properties (Xiong et al., 2006). Recently, experimental data showed that Scutellarin exerts anti-inflammatory actions in several animal models. Scutellarin can inhibit carrageenan-induced paw edema and xylene-induced ear edema in mice (Luo et al., 2008a). Scutellarin has also been showed to protect against LPS-induced acute lung injury via inhibition of nuclear factor ␬B (NF-␬B) activation (Yu et al., 2010), concanavalin A-induced immunological liver injury (Tan et al., 2007), the xenogenic materialsinduced host inflammatory response (Ma et al., 2008), and high glucose-mediated vascular inflammation (Luo et al., 2008b). However, the effects of Scutellarin on microglial activation have not been studied to our knowledge. In the present study, we showed that Scutellarin exerted an antiinflammatory effect in rat primary microglia and BV-2

a Key Laboratory of Pharmacology of Traditional Chinese Medical Formulae, Ministry of Education, Tianjin University of Traditional Chinese Medicine, Tianjin 300193, China b Tianjin State Key Laboratory of Modern Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin 300193, China c Tianjin Key Laboratory of Chinese Medicine Pharmacology, Tianjin University of Traditional Chinese Medicine, Tianjin 300193, China

Abstract—Inhibition of microglial over-reaction and the inflammatory processes may represent a therapeutic target to alleviate the progression of neurological diseases, such as neurodegenerative diseases and stroke. Scutellarin is the major active component of Erigeron breviscapus (Vant.) Hand-Mazz, a herbal medicine in treatment of cerebrovascular diseases for a long time in the Orient. In this study, we explored the mechanisms of neuroprotection by Scutellarin, particularly its anti-inflammatory effects in microglia. We observed that Scutellarin inhibited lipopolysaccharide (LPS)induced production of proinflammatory mediators such as nitric oxide (NO), tumor necrosis factor ␣ (TNF␣), interleukin-1␤ (IL-1␤) and reactive oxygen species (ROS), suppressed LPS-stimulated inducible nitric oxide synthase (iNOS), TNF␣, and IL-1␤ mRNA expression in rat primary microglia or BV-2 mouse microglial cell line. Scutellarin inhibited LPS-induced nuclear translocation and DNA binding activity of nuclear factor ␬B (NF-␬B). It repressed the LPSinduced c-Jun N-terminal kinase (JNK) and p38 phosphorylation without affecting the activity of extracellular signal regulated kinase (ERK) mitogen-activated protein kinase. Moreover, Scutellarin also inhibited interferon-␥ (IFN-␥)-induced NO production, iNOS mRNA expression and transcription factor signal transducer and activator of transcription 1␣ (STAT1␣) activation. Concomitantly, conditioned media from Scutellarin pretreated BV-2 cells significantly reduced neurotoxicity compared with conditioned media from LPS treated alone. Together, the present study reported the anti-inflammatory activity of Scutellarin in microglial cells along with their underlying molecular mechanisms, and suggested Scutellarin might have therapeutic potential for various microglia mediated neuroinflammation. © 2011 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: Scutellarin, microglia, inflammation, neuroprotection. *Corresponding author. Tel: ⫹86-22-59596166; fax: ⫹86-22-59596168. E-mail address: [email protected] (L. Hu). Abbreviations: CM, conditioned media; DMEM, Dulbecco’s modified Eagle’s medium; ERK, extracellular signal regulated kinase; FBS, fetal bovine serum; IFN-␥, interferon-␥; IL-1␤, interleukin-1␤; iNOS, inducible nitric oxide synthase; JNK, c-Jun N-terminal kinase; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; NF-␬B, nuclear factor ␬B; NO, nitric oxide; ROS, reactive oxygen species; STAT1␣, signal transducer and activator of transcription 1␣; TNF-␣, tumor necrosis factor-␣.

0306-4522/11 $ - see front matter © 2011 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2011.04.005

150

S. Wang et al. / Neuroscience 185 (2011) 150 –160

151

Measurement of cytokine and NO levels One day after seeding in 48-well plates, BV-2 cells and primary microglia were pretreated with Scutellarin (2, 10, 50 ␮M) for 30 min, and then stimulated with LPS (BV-2, 0.1 ␮g/ml; primary microglia, 1 ␮g/ml) or IFN-␥ (40 U/ml) in serum-free DMEM for 24 h or the indicated time periods. NO production in the medium was determined using the Griess Reagent System. The levels of TNF-␣ and IL-1␤ were measured using ELISA kits.

Reactive oxygen species (ROS) assay

Fig. 1. Chemical structure of scutellarin.

mouse microglial cell line and could afford neuroprotection through regulating microglial activation.

EXPERIMENTAL PROCEDURES Chemicals

Intracellular ROS was measured by DCFH oxidation. The BV-2 cells in 48-well plates or 24-well plates containing coverslips were pretreated with Scutellarin for 30 min and stimulated with LPS (0.1 ␮g/ml) for 4 h. Then cells were exposed to HBSS containing DCFH-DA (10 ␮M) for 30 min. After incubation, cells were washed with PBS, and ROS measurement was read at the 488 nm excitation and 535 nm emission on a Flaxstation 3 fluorescence plate reader (Molecular Devices, Sunnyvale, CA, USA) or a LSM 710 laser scanning confocal microscopy (Zeiss, Jena, Germany). Cellfree experiments with and without Scutellarin were conducted to determine that Scutellarin itself did not alter fluorescence.

Real time reverse transcription polymerase chain reaction (RT-PCR) BV-2 cells and primary microglia, cultured in 12-well plates, were treated with LPS (BV-2, 0.1 ␮g/ml; primary microglia, 1 ␮g/ml) or IFN-␥ (40 U/ml) in the presence or absence of Scutellarin (50 ␮M) for 8 h. Total RNA was isolated from the cells 8 h after LPS or IFN-␥ stimulation and subsequently reverse-transcribed to cDNA using TaqMan Reverse Transcription Reagents. Real time PCR was performed using SYBR Green PCR Master Mix reagent kits and the specific primers (Table 1). Data were analyzed by using the comparative threshold cycle (Ct) method.

Scutellarin was got from the Biovalley Pharm., Inc. (Yunnan, China). Bacterial lipopolysaccharide (LPS) (Escherichia coli serotype 055:B5) and 2, 7-dichlorofluorescin diacetate (DCFH-DA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Recombinant rat interferon-␥ (IFN-␥) was purchased from Peprotech (Rocky Hill, NJ, USA). Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), and Trizol were the products of Invitrogen (Carlsbad, CA, USA). TNF-␣ and IL-1␤ enzymelinked immunosorbent assay (ELISA) kits were purchased from R&D Systems (Minneapolis, MN, USA). Griess Reagent System was purchased from Beyotime (Nanjin, Jiangsu, China). TaqMan Reverse Transcription Reagents and SYBR Green PCR Master Mix reagent kit were obtained from Applied Biosystems (Foster City, CA, USA). All antibodies were obtained from Cell Signal Technology (Beverley, MA, USA). Nuclear Extraction kit, NF-␬B EZ-TFA transcription factor assay kit and chemiluminescent Western blot detection system were obtained from Millipore (Billerica, MA, USA). 8 –12% precast gels were obtained from Biorad (Hercules, CA, USA).

NF-␬B DNA-binding activation was determined by enzyme-linked DNA-protein interaction assay, as described (Koduru et al., 2009). BV-2 cells were treated with LPS (0.1 ␮g/ml) in the presence or absence of Scutellarin (50 ␮M) for 1 h. Then nuclear protein extractions were prepared using a Nuclear Extraction kit. 5 ␮g nuclear protein was used for DNA binding assay. The DNAbinding activity was measured with a chemiluminescent NF-␬B p65 EZ-TFA transcription factor assay kit according to the manu-

Cell culture

Table 1. Primers of real-time PCR

The murine BV-2 microglial cell line was grown and maintained in DMEM supplemented with 10% FBS, 100 ␮g/ml streptomycin, and 100 U/ml penicillin at 37 °C in a humidified incubator under 5% CO2 and 95% air. Primary microglia were derived from postnatal day 1 Wistar rat brains, as described previously (Wang et al., 2010). In brief, meninges-free cortices were isolated and trypsinized. The cells were plated on poly-L-lysine-coated culture flasks in DMEM containing 10% FBS and fed every third day. After 7–10 days of culture, mixed glia cultures were shaken at 100 r.p.m. for 10 min. The suspended cells were plated on multiwell culture plates. After 1-h incubation at 37 °C, the medium containing unattached cells was discarded, and adherent cells were further incubated overnight for future experiments. The homogeneity of the culture was determined by Iba-1 immunocytochemical staining and routinely found to be higher than 95% (data not shown). The human neuroblastoma cell line SH-SY5Y was cultured in RPMI 1640 medium containing 15% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin. The study was approved by the Animal Care and Use Committee at Tianjin University of Traditional Chinese Medicine.

NF-␬B DNA-binding activity

Gene

Primer pair (5=–3=) F, forward; R, reverse

Rat-GAPDH

F: CCCCCAATGTATCCGTTGTG R: TAGCCCAGGATGCCCTTTAGT F: GACATCGACCAGAAGCTGTC R: GGGCTCTGTTGAGGTCTAAAG F: GCTCCCTCTCATCAGTTCCA R: TTGGTGGTTTGCTACGACG F: GCTAGTGTG TGATGTTCCCATTAG R: CTTTTCCATCTTCTTCTTTGGGTA F: CTTCACCACCATGGAGAAGGC R: GGCATGGACTGTGGTCATGAG F: GGCAGCCTGTGAGACCTTTG R: GCATTGGAAGTGAAGCGTTTC F: CGGGGTGATCGGTCCCCAAAG R: GGAGGGCGTTGGCGCGCTGG F: CGCAGCAGCACATCAACAAGAGC R: TGTCCTCATCCTGGAAGGTCCACG

Rat-iNOS Rat-TNF␣ Rat-IL-1␤ Mouse-GAPDH Mouse-iNOS Mouse-TNF␣ Mouse-IL-1␤

152

S. Wang et al. / Neuroscience 185 (2011) 150 –160

facturer’s instruction. This assay is highly sensitive compared with the gel-retardation technique.

Immunofluorescence and confocal microscopy BV-2 cells planted on the cover slips were stimulated with LPS (0.1 ␮g/ml) and/or Scutellarin (50 ␮M) for 45 min. Then cells were fixed in 4% paraformaldehyde, permeabilized in 0.5% Trition X-100 and blocked using 5% BSA for 1 h. Primary antibody (rabbit anti-p65 IgG, 1:100) was present at 4 °C overnight followed by washing in PBS. The secondary antibody was a donkey-anti-

rabbit IgG conjugated to FITC (1:250). DAPI was used to stain the cell nuclei. After a final brief wash, the coverslips were mounted in glycerol and viewed with a laser scanning confocal microscopy (Zeiss LSM710; Germany).

Western blotting BV-2 cells cultured in six-well dishes were pretreated for 30 min with Scutellarin (50 ␮M), and then stimulated with LPS (0.1 ␮g/ml) or IFN-␥ (40 U/ml) for 45 min (for p65), 1 h (for mitogen-activated protein kinases, MAPKs) or 30 min (for signal transducer and

Fig. 2. Scutellarin inhibits LPS-induced NO, TNF-␣, and IL-1␤ production in BV-2 cell line and rat primary microglia induced by LPS. (a) BV-2 cells were incubated with indicated concentration of LPS for 24 h. NO production in culture medium was determined using the Griess Reagent System. (b, c) BV-2 cells (b) and rat primary microglia (c) were pretreated with Scutellarin (2, 10, 50 ␮M) for 30 min and then stimulated with LPS (BV-2, 0.1 ␮g/ml; primary microglia, 1 ␮g/ml) for 24 h or the indicated time periods. NO and cytokines in the medium were determined using the Griess Reagent System and ELISA kits. The data are expressed as mean⫾SD, n⫽6. ** P⬍0.01, significantly different from control samples. # P⬍0.05, ## P⬍0.01, significantly different from the LPS-treated alone. Experiments were repeated at least three times with similar results. For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.

S. Wang et al. / Neuroscience 185 (2011) 150 –160 activator of transcription 1␣, STAT1␣). Cells were lysed and run on a SDS-PAGE gel. For translocation of NF-␬B p65, cytoplasmic and nuclear were extracted separately. The proteins were then electroblotted onto PVDF membranes. After 1 h blocking at room temperature in 5% nonfat dry milk, the membranes were incubated with primary antibodies overnight. The secondary antibody was HRP-conjugated goat anti-rabbit IgG. Antigens on the membranes were revealed by exposure to chemiluminescent Western blot detection system.

Neurotoxicity of microglia-conditioned medium Human SH-SY5Y neuroblastoma cells were plated in 96-well plates and allowed to settle for 24 h before replacement with conditioned media. BV-2 cells cultured in 48-well or six-well plates were stimulated with LPS (0.1 ␮g/ml) and/or Scutellarin (50 ␮M) for 24 h. Seven groups, including four microglia-conditioned media (CM) groups, were set up: (1) DMEM basal media (Control); (2) LPS (0.1 ␮g/ml) alone dissolved in basal media (LPS); (3) Scutellarin (50 ␮M) alone dissolved in basal media (Scu); (4) the

153

conditioned media from Control BV-2 cells (Control-CM); (5) the conditioned media from LPS-treated microglia (LPS-CM); (6) the conditioned media from LPS/Scutellarin-treated microglia (LPS/ Scu-CM); (7) Scutellarin (50 ␮M) was added to the conditioned media from LPS-stimulated microglial cells (LPS-CM⫹Scu). Then the media were transferred into the SH-SY5Y cells. And SH-SY5Y cell viability was assessed by MTT assay and Trypan Blue exclusion assay after a 24-h incubation. MTT (0.5 mg/ml) was added to each well, and incubated for another 4 h. The medium was then aspirated and DMSO was added to solubilize the colored formazan product. Absorbance was determined at 570 nm on a plate reader. For Trypan Blue exclusion assay, adherent and floating cells were pooled, collected by centrifugation. After suspension with PBS, the percentage (%) of death cells was determined by Trypan Blue dye (0.4% in PBS) staining.

Data analysis Data are expressed as means⫾SD. Comparisons were evaluated by one-way analysis of variance (ANOVA) with SPSS software

Fig. 3. Scutellarin suppresses LPS-induced mRNA expressions of iNOS, TNF-␣, and IL-1␤ in BV-2 cells and primary microglia. Cells were incubated in the presence of LPS (1 ␮g/ml, primary microglia; 0.1 ␮g/ml, BV-2 cell) with or without Scutellarin (50 ␮M) for 8 h. Total RNA was extracted, reverse-transcribed and subjected to real-time PCR. Data are expressed as means⫾SD, n⫽3. * P⬍0.05, ** P⬍0.01, significantly different from the LPS-treated alone. Experiments were repeated three times with similar results.

154

S. Wang et al. / Neuroscience 185 (2011) 150 –160

(SPSS, Chicago, IL, USA). Probability values ⬍0.05 were considered significant.

RESULTS Scutellarin inhibits LPS-induced NO, TNF-␣, and IL-1␤ production To investigate potential anti-inflammatory activity of Scutellarin on microglia activation, we first examined the effects of Scutellarin on the production of inflammatory mediators (NO, TNF-␣, and IL-1␤) in BV-2 cell line and rat primary microglia induced by LPS. LPS dose-dependently induced NO production in BV-2 (Fig. 2a). Treatment of BV-2 cells with Scutellarin before LPS stimuli (0.1 ␮g/ml) concentration dependently reduced NO, TNF-␣, and IL-1␤ production (Fig. 2b). In a similar study, as anticipated, pretreatment of rat primary microglial cells with Scutellarin resulted in significant attenuation of LPS (1 ␮g/ml)stimulated NO production at 16, 20, and 24 h (Fig. 2c). TNF-␣ production could also be suppressed by Scutellarin pretreatment in a concentration-dependent fashion in primary microglia (Fig. 2c). Scutellarin did not affect cell viability in both primary microglia and BV-2 cells under this experimental condition as measured by MTT assay (Data not shown). Scutellarin suppresses LPS-induced mRNA expressions of iNOS, TNF-␣ and IL-1␤ To examine whether the suppression of NO, TNF-␣, and IL-1␤ production by Scutellarin was due to reduced mRNA expression, real-time PCR analyses from LPSstimulated cells were conducted. BV-2 cells and primary microglia were incubated 30 min with Scutellarin (50 ␮M) and then stimulated for 8 h with LPS (0.1 ␮g/ml, BV-2 cell; 1 ␮g/ml, primary microglia). As shown in Fig. 3, Scutellarin significantly reduced iNOS, TNF-␣, and IL-1␤ mRNA levels not only in BV-2 cell but also primary microglia. Scutellarin attenuates LPS-induced intracellular ROS production Intracellular ROS plays an important role in triggering the deleterious cascade of events in inflammatory process (Qin et al., 2004). We therefore investigated whether Scutellarin could attenuate LPS-induced intracellular ROS production in microglia. The results from the plate reader showed that exposure of BV-2 cells to LPS (0.1 ␮g/ml) for 4 h led to a significant increase in intracellular ROS level and Scutellarin pretreatment attenuated LPS-induced intracellular ROS production in a dose-dependent manner (Fig. 4a). The results were further confirmed by confocal microscopy (Fig. 4b). Scutellarin inhibits LPS-induced NF-␬B activation As the NF-␬B is a major regulator of proinflammatory mediator expression in LPS-stimulated microglia, it was investigated whether NF-␬B is an important target for the action of Scutellarin in microglia. For studying the

Fig. 4. Scutellarin attenuates LPS-induced intracellular ROS production. BV-2 cells were preincubated with Scutellarin for 30 min, followed by substitution with medium containing LPS (0.1 ␮g/ml) for 4 h. Then cells were exposed to HBSS containing DCFH-DA (10 ␮M) for 30 min. After cells were washed with PBS, and ROS measurement was read at the 488 nm excitation and 535 nm emission on a fluorescence plate reader (a) or a laser scanning confocal microscopy (b). The data are expressed as mean⫾SD, n⫽6. ** P⬍0.01, significantly different from control samples. # P⬍0.05, ## P⬍0.01, significantly different from the LPS-treated alone. Experiments were repeated three times with similar results. Bar⫽20 ␮m. For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.

nuclear translocation of NF-␬B, we performed laser scanning confocal immunofluorescent microcopy using antibody of p65, a major subunit of NF-␬B. As seen from Fig. 5a, we were able to visualize clearly by confocal microscopy the translocation of p65 subunit to the nucleus after LPS stimulation. In contrast, LPS-induced nuclear translocation of NF-␬B was prevented by treatment with Scutellarin (50 ␮M). The results were further confirmed by Western blotting (Fig. 5b). Nuclear extracts from LPS/Scutellarin-treated BV-2 cells were subjected to analysis for NF-␬B DNA binding activity as measured by a sensitive multi-well chemiluminescent assay. As shown in Fig. 5c, LPS significantly induced NF-␬B DNA binding activity compared with the untreated cells, while

S. Wang et al. / Neuroscience 185 (2011) 150 –160

155

Fig. 5. Scutellarin inhibits LPS-induced NF-␬B nuclear translocation (a, b) and DNA binding activity (c). (a) After pretreatment with Scutellarin (50␮M) for 30 min, BV-2 cells were stimulated with 0.1 ␮g/ml LPS for 45 min. The nuclear translocation of NF-␬B subunit p65 was assessed by confocal fluorescence microscopy using anti-p65 antibody. Representative laser confocal microcopy images showed localization of p65 (green stain) with nuclei stained with DAPI (blue stain) in cells exposed to LPS with or without Scutellarin. The arrows indicate the changes of p65 in the nuclei. Bar⫽20 ␮m. (b) Cytoplasmic and nuclear extracts were separated and immunoblotted by anti-p65 antibody. The data are expressed as mean⫾SD, n⫽3, from three independent experiments. (c) Nuclear protein lysates of BV-2 cells were prepared after 1 h of treatment with LPS (0.1 ␮g/ml) and/or Scutellarin (50 ␮M). The DNA-binding activity was measured with a chemiluminescent NF-␬B p65 EZ-TFA transcription factor assay kit. The data are expressed as mean⫾SD, n⫽3. ** P⬍0.01, significantly different from control samples. # P⬍0.05, ## P⬍0.01, significantly different from the LPS-treated alone. Experiments were repeated three times with similar results. For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.

pretreatment with Scutellarin (50 ␮M) could inhibit LPSinduced NF-␬B binding capacity in BV-2 cells. Scutellarin suppresses LPS-induced p38 and c-Jun N-terminal kinase (JNK) phosphorylation in LPSstimulated microglial cells but not extracellular signal regulated kinase (ERK) MAPK phosphorylation To determine whether Scutellarin modulates MAPKs, which are upstream molecules in the NF-␬B signaling

pathway, BV-2 cells were pretreated with Scutellarin (50 ␮M) for 30 min and stimulated with LPS for a 1 h incubation period. The 1 h treatment of LPS was determined to be optimal in a preliminary study that examined MAPK phosphorylation at 15, 30, and 1 h after LPS treatment (data not shown). The results (Fig. 6) showed that the LPS-induced phosphorylation of p38 and JNK MAPK was markedly inhibited by Scutellarin. However, no effect of Scutellarin was observed on LPS induced phosphorylation of ERK.

156

S. Wang et al. / Neuroscience 185 (2011) 150 –160

Fig. 6. Scutellarin suppresses LPS-induced p38 and JNK phosphorylation in LPS-stimulated microglial cells but not ERK MAPK phosphorylation. BV-2 cells were pretreated with Scutellarin for 30 min and stimulated with LPS for a 1 h incubation period. Cells were lysed, run on a SDS-PAGE gel, transferred to membranes, and blotted with specific antibodies to phosphorylated p38 and p38, phosphorylated JNK and JNK, phosphorylated ERK and ERK. The data are expressed as mean⫾SD, n⫽3, from three independent experiments. ** P⬍0.01, significantly different from control samples. ## P⬍0.01, significantly different from the LPS-treated alone.

Scutellarin inhibits IFN-␥-induced NO production, iNOS mRNA expression and STAT1␣ activation IFN-␥ is another well-established stimulus that promotes the expression of inflammatory molecules (e.g. iNOS) through STAT1␣, while independent on NF-␬B (Jana et al., 2007). Thus, the effects of Scutellarin on microglial cells activated by IFN-␥ were also investigated. As shown in Fig. 7a, Scutellarin inhibited IFN␥-induced NO production in a concentration-dependent manner with almost complete inhibition achieved at 50 ␮M. The results also showed that Scutellarin significantly reduced IFN␥-induced iNOS mRNA expression levels (Fig. 7b) and phosphorylation of STAT1␣ (Fig. 7c). Scutellarin protects neurons through inhibition of microglial activation A number of studies have demonstrated that activated microglia induce neural cell degeneration (Yenari et al., 2006; Kaushal and Schlichter, 2008; Novarino et al., 2004). Since Scutellarin could suppress microglial activation, we investigated whether the effects of Scutellarin on activated microglia translated to its neuroprotective effect. The neuronal toxicity of conditioned media was evaluated by using SH-SY5Y cells as target neuron. Both MTT test (Fig. 8a) and Trypan Blue exclusion assay (Fig. 8b) proved that LPS alone has no direct neurotoxicity, while the conditioned media from LPS-stimulated microglia (LPS-CM) were potently toxic to SH-SY5Y cells. This suggested that the toxicity of the conditioned media from LPS-treated microglia was mostly dependent on neurotoxic factors from

activated microglia, and not on contaminating LPS, consistent with previous report (Pan et al., 2008). Scutellarin alone, under normal conditions, did not influence SH-SY5Y cell viability too (Control vs. Scu). However, Scutellarin could directly provide significant neuroprotection against the toxicity of activated microglia (LPS-CM⫹Scu vs. LPSCM). As expected, the conditioned media from LPS/Scutellarin-treated microglia provided almost complete neuroprotection from the conditioned media from LPS-stimulated microglia (LPS/Scu-CM vs. LPS-CM). Notably, the direct neuroprotective effect of Scutellarin was no better than the conditioned media from LPS/Scutellarin-treated microglia (LPS-CM⫹Scu vs. LPS/Scu-CM), suggesting that Scutellarin may exert its neuroprotective effects, at least partly, via reducing the abnormal elevation inflammatory mediators.

DISCUSSION In this study, we examined the anti-inflammatory action of Scutellarin in microglia, the signal transduction pathways involved in these processes and if this action leads to neuroprotective effect. We observed that Scutellarin inhibited LPS-induced production of pro-inflammatory mediators (NO, TNF␣, IL-1␤, and ROS), suppressed LPS-stimulated increase in mRNA levels of iNOS, TNF␣, and IL-1␤ in rat primary microglia or BV-2 mouse microglial cell line. Scutellarin suppressed LPS-induced nuclear translocation and DNA binding activity of NF-␬B. It repressed the LPSinduced JNK and p38 phosphorylation without affecting the activity of ERK MAPK. Moreover, it also inhibited IFN-␥-

S. Wang et al. / Neuroscience 185 (2011) 150 –160

157

Fig. 7. Scutellarin inhibits IFN-␥-induced NO production (a), iNOS mRNA expression (b) and tyrosine 701 phosphorylation of STAT1␣ (c) in microglia. BV-2 cells were incubated with medium alone or activated with IFN-␥ (40 U/ml) in the presence or absence of Scutellarin (indicated concentrations or 50 ␮M) for 24 h (a), 8 h (b) or 30 min (c). Then NO production, iNOS mRNA expression, and tyrosine phosphorylation of STAT1␣ were determined by Greiss System (a), real-time PCR (b) or Western blotting (c), respectively. The data are expressed as mean⫾SD, n⫽6 (a) or 3 (b, c). ** P⬍0.01, significantly different from control samples. ## P⬍0.01, significantly different from the LPS-treated alone. Experiments were repeated three times with similar results.

induced NO production, iNOS mRNA expression, and STAT1␣ activation. Concomitantly, conditioned media from Scutellarin pretreated BV-2 cells significantly reduced neurotoxicity compared with conditioned media from LPS treated alone. These results suggested Scutellarin might have therapeutic potential for various microglia mediated neuroinflammatory diseases. It has been proposed that activated microglia are involved in the pathogenesis of most neuropathological conditions such as stroke, Alzheimer disease, Parkinson disease, Creutzfeld-Jacob disease, HIV-associated dementia, and multiple sclerosis. Controversial findings exist regarding the role of microglia in pathological status. Several studies demonstrated that microglia triggered by injured/dying neurons mediate a reduction of neuronal damage and induction of tissue repair (Majumdar et al., 2007; Neumann et al., 2008; Suzuki et al., 2004), whereas more evidence shows the neurotoxic properties of activated microglia after damage (Yenari et al., 2006; Kaushal and Schlichter, 2008; Novarino et al., 2004). It is not strange that the role of microglia in neuroprotection has been in debate. Because inflammation has the double effect in many pathological processes. Anyway, previous in vivo or in vitro studies have revealed that drugs such as minocy-

cline (Plane et al., 2010; Yenari et al., 2006; Fan et al., 2007; Hayakawa et al., 2008), histone deacetylase inhibitors (Kim et al., 2007), naloxone (Liu et al., 2000), dextromethorphan (Liu et al., 2003), MW01-5-188WH (Ranaivo et al., 2006) can afford neuroprotection through modulating microglial cells. Our previous study and others also proved that active components from herbs, such as Salvianolic acid B (Wang et al., 2010) and Luteolin (Jang et al., 2008), also have similar effects. But these arguments remind us that we should think of the problem of therapeutic time window and dose carefully, not to hamper their critical role in host defense and their neuroregenerative properties, when these anti-inflammatory drug were applied in the treatment of brain diseases. NF-␬B appears to be an important intracellular target of Scutellarin. NF-␬B is clearly one of the most important regulators of proinflammatory gene expression such as TNF-␣, IL-1␤, IL-6, IL-8, iNOS, and COX-2 (D’Acquisto et al., 2002). NF-␬B is maintained in a latent form in the cytoplasm where it is in complex with I␬B. After stimulating the cells with various agents, I␬B is phosphorylated and subsequently degraded by ubiquitination. NF-␬B is then free to translocate to the nucleus where it binds to DNA leading to the activation of a wide variety of inflammatory

158

S. Wang et al. / Neuroscience 185 (2011) 150 –160

Fig. 8. Scutellarin provides neuroprotection through inhibition of microglial activation. BV-2 cells cultured in 48-well plates were stimulated with LPS (0.1 ␮g/ml) and/or Scutellarin (50 ␮M) for 24 h. Seven groups, including four microglia-conditioned media (CM) groups, were set up: (1) DMEM basal media (Control); (2) LPS (0.1 ␮g/ml) alone dissolved in basal media (LPS); (3) Scutellarin (50 ␮M) alone dissolved in basal media (Scu); (4) the conditioned media from Control BV-2 cells (Control-CM); (5) the conditioned media from LPS-treated microglia (LPS-CM); (6) the conditioned media from LPS/Scutellarintreated microglia (LPS/Scu-CM); (7) Scutellarin (50 ␮M) was added to the conditioned media from LPS-stimulated microglial cells (LPSCM⫹Scu). Then the media were transferred into the SH-SY5Y cells. And SH-SY5Y cell viability was assessed by MTT assay (a) and Trypan Blue exclusion assay (b) after a 24-h incubation. The data are expressed as mean⫾SD, n⫽6 (a) or 4 (b). ** P⬍0.01, compared with Control-CM group. ## P⬍0.01, compared with LPS-CM group. $ P⬍0.05, $$ P⬍0.01, compared with LPS/Scu-CM group. Experiments were repeated three times with similar results.

response target genes (D’Acquisto et al., 2002). In the present study, we have shown that Scutellarin regulated protein levels of the inflammatory-related cytokines and at the RNA level (Figs. 2 and 3). In addition, we have clearly shown that Scutellarin inhibited LPS-induced nuclear translocation of NF-␬B using confocal fluorescence microscopy and DNA binding of NF-␬B complex (Fig. 5). However, NF-␬B also plays an important role in cell growth and survival. Five isoforms of NF-␬B (p105/p50, p100/p52, p65, RelA/p65, RelB, and cRel) play different role in regulation of hundreds of targets genes of NF-␬B (Mohamed and McFadden, 2009). Drugs that target specific isoforms may reduce side effects and improve therapeutic benefits.

It is a subject of our future study to ascertain the effects of Scutellarin on differential NF-␬B isoforms. Our data showed that Scutellarin repressed the LPSinduced p38 and JNK phosphorylation in activated microglia (Fig. 6). Therapeutic strategies aimed at inhibiting p38 and JNK have emerged as a means to treat brain diseases such as Parkinson’s and Alzheimer’s (Waetzig and Herdegen, 2004; Repici and Borsello, 2006; Tikka et al., 2001; Du et al., 2001). Interestingly, minocycline, which provides neuroprotection by reducing microglial activation in a variety of experimental models of neurological diseases (Yenari et al., 2006; Fan et al., 2007; Hayakawa et al., 2008; reviewed by Plane et al., 2010), is through inhibition of p38 MAPK (Tikka et al., 2001; Du et al., 2001). Some studies suggest that NF-␬B is downstream of ERK (Jiang et al., 2001). But other investigations have showed that there are two independent signaling pathways (Park et al., 2007). In the present study, Scutellarin inhibited NF-␬B activation without affecting the activity of ERK MAPK (Fig. 6), suggested that ERK is not upstream of NF-␬B activation, at least in LPS-stimulated microglial cells, consistent with Park et al. (2007). Interestingly, Scutellarin could also inhibit IFN-␥-induced NO production, iNOS mRNA expression, and STAT1␣ activation (Fig. 7). IFN-␥-induced NO production is primarily through the activation of the transcription factor STAT1␣ following phosphorylation (D’Alimonte et al., 2007; Jana et al., 2007), while independent on NF-␬B (Jana et al., 2007) in microglia. Our results suggested that Scutellarin is capable of attenuating the expression of not only those proinflammatory molecules whose expression depends on the activation of NF-␬B, but also those via STAT1␣ transcription factor. Guanosine was believed to be the first agent that can inhibit both pathways, reported in 2007 (D’Alimonte et al., 2007). To our best knowledge, Scutellarin was the second such agent. Scutellarin could protect cultured neurons directly against glutamate (Hong and Liu, 2004b), hydrogen peroxide (Hong and Liu, 2004a; Liu et al., 2005), cobalt chloride (Wang et al., 2007), oxygen, and glucose deprivation (Xu et al., 2007). Here, our data not only confirmed its direct neuroprotection but also provided a new mechanism underlying the neuroprotective activity of Scutellarin. As shown in Fig. 8, the conditioned media from LPS/Scutellarin-treated microglia provided almost complete neuroprotection from the conditioned media from LPS-stimulated microglia. This effect was significantly stronger than its direct neuroprotection (SH-SY5Y cells exhibited a better survival when Scutellarin was added to their culture containing the conditioned medium from LPS-stimulated microglia). These results suggested that Scutellarin offered neuroprotective effects via reducing the abnormal elevation inflammatory mediators in addition to its direct neuroprotection. It should be noted that in addition to the inflammatory factors measured in our manuscript (i.e. NO, TNF-␣, and IL-1␤), LPS and IFN-␥ both can induce the production of a wide spectrum of neurotoxic mediators (e.g. IL-1␣, IL-6, IL-18, gamma interferon inducible protein 1, prostaglandin

S. Wang et al. / Neuroscience 185 (2011) 150 –160

E2, quinolinic acid, and glutamate) in microglia cells through the MAPKs-NF␬B pathway (reviewed by Block and Hong, 2005; Rock et al., 2004), which may also be down-regulated by Scutellarin and contributing to its neuroprotective effect. Nevertheless, MAPKs-NF␬B signal transduction pathways of LPS-induced proinflammatory factors production and correlation of this cascade with Scutellarin is far from clear, and needs further investigation.

CONCLUSIONS Together, the present study reported the anti-inflammatory activity of Scutellarin in microglial cells along with their underlying molecular mechanisms, and suggested Scutellarin may be of value in the treatment of various microglia mediated neuroinflammatory diseases. Acknowledgments—This work is supported by National Natural Science Foundation of China (81001654), National Key Technology R&D Program (2007BAI47B04), University Science & Technology Program of Tianjin (20070314), Specialized Research Fund for the Doctoral Program of Higher Education (200800630002), Tianjin Natural Science Fund (08JCYBJC10800), Scientific and Technological Special Project (2009ZX09301), Program for Changjiang Scholars and Innovative Research Team in University.

REFERENCES Block ML, Hong JS (2005) Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Prog Neurobiol 76(2):77–98. D’Acquisto F, May MJ, Ghosh S (2002) Inhibition of nuclear factor kappa B (NF-␬B): an emerging theme in anti-inflammatory therapies. Mol Interv 2(1):22–35. D’Alimonte I, Flati V, D’Auro M, Toniato E, Martinotti S, Rathbone MP, Jiang S, Ballerini P, Di Iorio P, Caciagli F, Ciccarelli R (2007) Guanosine inhibits CD40 receptor expression and function induced by cytokines and b amyloid in mouse microglia cells. J Immunol 178:720 –731. D’Mello C, Le T, Swain MG (2009) Cerebral microglia recruit monocytes into the brain in response to tumor necrosis factor ␣ signaling during peripheral organ inflammation. J Neurosci 29:2089 –2102. Du Y, Ma Z, Lin S, Dodel RC, Gao F, Bales KR, Triarhou LC, Chernet E, Perry KW, Nelson DLG, Luecke S, Phebus LA, Bymaster FP, Paul SM (2001) Minocycline prevents nigrostriatal dopaminergic neurodegeneration in the MPTP model of Parkinson’s disease. Proc Natl Acad Sci U S A 98(25):14669 –14674. Fan R, Xu F, Previti ML, Davis J, Grande AM, Robinson JK, Nostrand WE (2007) Minocycline reduces microglial activation and improves behavioral deficits in a transgenic model of cerebral microvascular amyloid. J Neurosci 27(12):3057–3063. Hayakawa K, Mishima K, Nozako M, Hazekawa M, Mishima S, Fujioka M, Orito K, Egashira N, Iwasaki K, Fujiwara M (2008) Delayed treatment with minocycline ameliorates neurologic impairment through activated microglia expressing a high-mobility group Box1inhibiting mechanism. Stroke 39:951–958. Hong H, Liu GQ (2004a) Protection against hydrogen peroxide-induced cytotoxicity in PC12 cells by scutellarin. Life Sci 74(24): 2959 –2973. Hong H, Liu GQ (2004b) Scutellarin attenuates oxidative glutamate toxicity in PC12 cells. Planta Med 70(5):427– 431. Jana M, Jana A, Liu X, Ghosh S, Pahan K (2007) Involvement of phosphatidylinositol 3-kinase-mediated up-regulation of I␬B␣ in anti-inflammatory effect of gemfibrozil in microglia. J Immunol 179:4142– 4152.

159

Jang S, Kelley KW, Johnson RW (2008) Luteolin reduces IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1. Proc Natl Acad Sci U S A 105(21):7534 –7539. Jiang B, Brecher P, Cohen RA (2001) Persistent activation of nuclear factor-␬B by interleukin-1␤ and subsequent inducible NO synthase expression requires extracellular signal-regulated kinase. Arterioscler Thromb Vasc Biol 21:1915–1920. Jin R, Yang G, Li G (2010) Inflammatory mechanisms in ischemic stroke: role of inflammatory cells. J Leukoc Biol 87:779 –789. Kaushal V, Schlichter LC (2008) Mechanisms of microglia-mediated neurotoxicity in a new model of the stroke penumbra. J Neurosci 28:2221–2230. Kim HJ, Rowe M, Ren M, Hong JS, Chen PS, Chuang DM (2007) Histone deacetylase inhibitors exhibit anti-inflammatory and neuroprotective effects in a rat permanent ischemic model of stroke: multiple mechanisms of action. J Pharmacol Exp Ther 321:892– 901. Koduru S, Sowmyalakshmi S, Kumar R, Gomathinayagam R, Rohr J, Damodaran C (2009) Identification of a potent herbal molecule for the treatment of breast cancer. BMC Cancer 9:41–51. Liu B, Du L, Hong JS (2000) Naloxone protects rat dopaminergic neurons against inflammatory damage through inhibition of microglia activation and superoxide generation. J Pharmacol Exp Ther 293:607– 617. Liu H, Yang X, Tang R, Liu J, Xu H (2005) Effect of scutellarin on nitric oxide production in early stages of neuron damage induced by hydrogen peroxide. Pharmacol Res 51(3):205–210. Liu Y, Qin L, Li G, Zhang W, An L, Liu B, Hong JS (2003) Dextromethorphan protects dopaminergic neurons against inflammationmediated degeneration through inhibition of microglial activation. J Pharmacol Exp Ther 305:212–218. Luo P, Zhang Z, Yi T, Zhang H, Liu X, Mo Z (2008a) Anti-inflammatory activity of the extracts and fractions from Erigeron multiradiatus through bioassay-guided procedures. J Ethnopharmacol 119(2): 232–237. Luo P, Tan ZH, Zhang ZF, Zhang H, Liu XF, Mo ZJ (2008b) Scutellarin isolated from Erigeron multiradiatus inhibits high glucose-mediated vascular inflammation. Yakugaku Zasshi 128(9):1293–1299. Lv W, Guo J, Li J, Huang L, Ping Q (2005). Distribution of liposomal breviscapine in brain following intravenous injection in rats. Int JPharm 306:99 –106. Ma JY, Jiang WW, Zhou ZT, Li JM, Wang HY (2008) The promoting angiogenesis and anti-inflammation effect of scutellarin on polyglycolic acid scaffold of balb/c mice model. J Asian Nat Prod Res 10(11–12):1147–1153. Majumdar A, Cruz D, Asamoah N, Buxbaum A, Sohar I, Lobel P, Maxfield FR (2007) Activation of microglia acidifies lysosomes and leads to degradation of Alzheimer amyloid fibrils. Mol Biol Cell 18:1490 –1496. Mohamed RM, McFadden G (2009) NF-␬B inhibitors: strategies from poxviruses. Cell Cycle 8(19):3125–3132. Neumann H, Kotter MR, Franklin RJM (2009) Debris clearance by microglia: an essential link between degeneration and regeneration. Brain 132:288 –295. Neumann J, Sauerzweig S, Rönicke R, Gunzer F, Dinkel K, Ullrich O, Gunzer M, Reymann KG (2008) Microglia cells protect neurons by direct engulfment of invading neutrophil granulocytes: a new mechanism of CNS immune privilege. J Neurosci 28(23):5965– 5975. Novarino G, Fabrizi C, Tonini R, Denti MA, Malchiodi-Albedi F, Lauro GM, Sacchetti B, Paradisi S, Ferroni A, Curmi PM, Breit SN, Mazzanti M (2004) Involvement of the intracellular ion channel CLIC1 in microglia-mediated ␤-amyloid-induced neurotoxicity. J Neurosci 24:5322–5330. Pan XD, Chen XC, Zhu YG, Zhang J, Huang TW, Chen LM, Ye QY, Huang HP (2008) Neuroprotective role of tripchlorolide on inflammatory neurotoxicity induced by lipopolysaccharide-activated microglia. Biochem Pharmacol 76(3):362–372.

160

S. Wang et al. / Neuroscience 185 (2011) 150 –160

Park JS, Woo MS, Kim DH, Hyun JW, Kim WK, Lee JC, Kim HS (2007) Anti-inflammatory mechanisms of isoflavone metabolites in lipopolysaccharide-stimulated microglial cells. J Pharmacol Exp Ther 320:1237–1245. Plane JM, Shen Y, Pleasure DE, Deng W (2010) Prospects for minocycline neuroprotection. Arch Neurol. doi:10.1001/archneurol. 2010.191PubMed]. Qin L, Liu Y, Wang T, Wei SJ, Block ML, Wilson B, Liu B, Hong JS (2004) NADPH oxidase mediates lipopolysaccharide-induced neurotoxicity and proinflammatory gene expression in activated microglia. J Biol Chem 279:1415–1421. Ranaivo HR, Craft JM, Hu W, Guo L, Wing LK, Eldik LJV, Watterson DM (2006) Glia as a therapeutic target: selective suppression of human amyloid-␤-induced upregulation of brain proinflammatory cytokine production attenuates neurodegeneration. J Neurosci 26(2):662– 670. Repici M, Borsello T (2006) JNK pathway as therapeutic target to prevent degeneration in thecentral nervous system. Adv Exp Med Biol 588:145–155. Rock RB, Gekker G, Hu S, Sheng WS, Cheeran M, Lokensgard JR, Peterson PK (2004) Role of microglia in central nervous system infections. Clin Microbiol Rev 17:942–964. Shi S, Wu J, Dai W, Li C, Ge W (2010) Evaluation of brain-targeted trendence of scutellarin nasal administration. Zhongguo Zhong Yao Za Zhi 35(18):2453–2456. Suzuki T, Hide I, Ido K, Kohsaka S, Inoue K, Nakata Y (2004) Production and release of neuroprotective tumor necrosis factor by P2X7 receptor-activated microglia. J Neurosci 24(1):1–7. Tambuyzer BR, Ponsaerts P, Nouwen EJ (2009) Microglia: gatekeepers of central nervous system immunology. J Leukoc Biol 85: 352–370. Tan ZH, Yu LH, Wei HL, Liu GT (2007) The protective action of scutellarin against immunological liver injury induced by conca-

navalin A and its effect on pro-inflammatory cytokines in mice. J Pharm Pharmacol 59(1):115–121. Tikka T, Fiebich BL, Goldsteins G, Keinanen R, Koistinaho J (2001) Minocycline, a tetracycline derivative, is neuroprotective against excitotoxicity by inhibiting activation and proliferation of microglia. J Neurosci 21(8):2580 –2588. Waetzig V, Herdegen T (2004) Neurodegenerative and physiological actions of c-Jun N-terminal kinases in the mammalian brain. Neurosci Lett 361:64 – 67. Wang LX, Zeng JP, Wei XB, Wang FW, Liu ZP, Zhang XM (2007) Effects of scutellarin on apoptosis induced by cobalt chloride in PC12 cells. Chin J Physiol 50(6):301–307. Wang SX, Hu LM, Gao XM, Guo H, Fan GW (2010) Anti-inflammatory activity of Salvianolic acid B in microglia contributes to its neuroprotective effect. Neurochem Res 35:1029 –1037. Xiong Z, Liu C, Wang F, Li C, Wang W, Wang J, Chen J (2006) Protective effects of breviscapine on ischemic vascular dementia in rats. Biol Pharm Bull 29(9):1880 –1885. Xu W, Zha RP, Wang WY, Wang YP (2007) Effects of scutellarin on PKCgamma in PC12 cell injury induced by oxygen and glucose deprivation. Acta Pharmacol Sin 28(10):1573–1579. Yenari MA, Xu L, Tang XN, Qiao Y, Giffard RG (2006) Microglia potentiate damage to blood-brain barrier constituents improvement by minocycline in vivo and in vitro. Stroke 37:1087–1093. Yu LH, Wei HL, Liu GT (2010) Scutellarin protects against lipopolysaccharide-induced acute lung injury via inhibition of NF-kappaB activation in mice. J Asian Nat Prod Res 12(3):175–184. Zhang HF, Hu XM, Wang LX, Xu SQ, Zeng FD (2009) Protective effects of scutellarin against cerebral ischemia in rats: evidence for inhibition of the apoptosis-inducing factor pathway. Planta Med 75(2):121–126. Zoppo GJ, Milner R, Mabuchi T, Hung S, Wang X, Berg GI, Koziol JA (2007) Microglial activation and matrix protease generation during focal cerebral ischemia. Stroke 38:646 – 651.

(Accepted 2 April 2011) (Available online 19 April 2011)